Bifidobacterium longum LFS01 and application thereof

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses bifidobacterium longum LFS01 and application thereof. The bifidobacterium longum LFS01 is preserved in the China General Microbiological Culture Collection Center on July 9, 2025, the preservation number is CGMCC (China General Microbiological Culture Collection Center) NO.35159, and the bifidobacterium longum LFS01 is classified and named as the bifidobacterium longum LFS01. The bifidobacterium longum LFS01 provided by the invention can be specifically and efficiently colonized in an intestinal tract after gut cleaning, proliferation of pathogenic bacteria is inhibited through competitive rejection, an intestinal barrier is repaired in a multi-target manner, intestinal inflammation can be effectively relieved, a flora structure can be improved, mucous membrane integrity can be recovered, and the intestinal tract can be effectively protected. A safe and effective biological prevention and treatment strategy is provided for solving the problems of flora disorder and pathogenic bacterium infection caused by gut purging.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain of Bifidobacterium longum LFS01 and its applications. Background Technology

[0002] Gastrointestinal endoscopy is the gold standard for diagnosing and treating digestive tract diseases, and its clinical application is becoming increasingly widespread. However, to ensure a clear examination view, strict bowel preparation is necessary before the procedure, which involves nearly completely emptying the intestines by taking large amounts of laxatives. While this process achieves the diagnostic and treatment goals, it also creates a brief "ecological vacuum" in the intestines. At this time, opportunistic pathogens such as Clostridium difficile and multidrug-resistant Enterobacteriaceae may preferentially colonize and rapidly expand due to their strong environmental adaptability and proliferative capacity, seizing ecological niches. The damaged intestinal barrier cannot effectively prevent these pathogens and their toxins from translocating into the bloodstream, thus greatly increasing the risk of serious complications such as postoperative infection and bacteremia, especially for vulnerable populations such as the elderly and those with weakened immune systems.

[0003] Currently, clinical methods for preventing post-colon cleansing infections mainly focus on aseptic techniques and antibiotic prophylaxis. However, the overuse of antibiotics can further exacerbate gut microbiota dysbiosis and may lead to the selection of drug-resistant strains, creating a vicious cycle. Therefore, developing a biological prevention strategy for post-colon cleansing infections that can proactively reshape the gut microbiota and enhance mucosal barrier function has become an urgent clinical challenge. Summary of the Invention

[0004] To develop a biological prevention strategy for post-colon cleansing infections, this invention provides a strain of Bifidobacterium longum LFS01 and its applications. The Bifidobacterium longum LFS01 provided by this invention can specifically and efficiently colonize the intestines after colon cleansing, competitively inhibiting the proliferation of pathogenic bacteria and repairing the intestinal barrier at multiple targets. It can effectively alleviate intestinal inflammation, improve the flora structure, and restore mucosal integrity, providing a safe and effective biological control strategy for addressing flora imbalance and pathogenic bacterial infections caused by colon cleansing.

[0005] This invention provides a strain of Bifidobacterium longum ( Bifidobacterium longum LFS01, characterized in that the *Bifidobacterium longum* LFS01 was deposited at the China General Microbiological Culture Collection Center on July 9, 2025, with the accession number CGMCC NO.35159, and classified and named *Bifidobacterium longum* LFS01. Bifidobacterium longum LFS01.

[0006] The Bifidobacterium longum LFS01 provided by this invention can specifically and efficiently colonize the intestine after bowel cleansing. It inhibits the proliferation of pathogenic bacteria through competitive exclusion and repairs the intestinal barrier at multiple targets. It can effectively alleviate intestinal inflammation, improve the flora structure, and restore mucosal integrity, providing a safe and effective biological control strategy for solving the problems of flora disorder and pathogenic bacterial infection caused by bowel cleansing.

[0007] Furthermore, the 16S rDNA sequence of the strain is shown in SEQ ID NO: 1.

[0008] This invention also provides the application of Bifidobacterium longum LFS01 in the preparation of drugs for the prevention or treatment of pathogenic bacterial infections after gastroscopy and colonoscopy.

[0009] Furthermore, the pathogenic bacterium is *Citrobacter citric acid* (Citrobacter citric acid). Citrobacter rodentium ).

[0010] Furthermore, the drug uses Bifidobacterium longum LFS01 as its active ingredient.

[0011] Furthermore, the drug also includes a pharmaceutically acceptable excipient; the excipient is PBS buffer.

[0012] Furthermore, the drug is prepared by diluting Bifidobacterium longum LFS01 to 1×10⁻⁶ with PBS buffer. 9 CFU / mL was obtained.

[0013] Furthermore, the drug is used to alleviate intestinal inflammation and intestinal mucosal barrier damage in animals caused by pathogenic bacterial infection after bowel cleansing.

[0014] Furthermore, the drug is used to improve the gut microbiota structure.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: The *Bifidobacterium longum* LFS01 provided by this invention can rapidly colonize damaged intestines after bowel cleansing. It effectively inhibits pathogen proliferation through competitive exclusion and significantly upregulates mucin MUC2 expression and promotes sIgA secretion, thereby rebuilding the intestinal chemical and immune barriers. Experimental results show that after intervention with *Bifidobacterium longum* LFS01, the integrity of the intestinal mucosal structure is restored, crypt morphology is improved, and inflammatory infiltration is significantly reduced, confirming that *Bifidobacterium longum* LFS01 has a multi-target synergistic protective effect, effectively preventing infection and repairing intestinal mucosal damage.

[0016] The Bifidobacterium longum LFS01 strain provided by this invention has been screened and functionally verified. It is specifically designed for the special clinical scenario of post-colon cleansing infection, which solves the problem that ordinary probiotics are ineffective in this environment. It has extremely strong environmental tolerance and colonization ability, and works synergistically from multiple dimensions such as competitive exclusion, antibacterial, barrier repair and immune regulation. In addition, the powerful barrier repair and anti-inflammatory functions of Bifidobacterium longum LFS01 also make it have great application potential in other intestinal infectious diseases, antibiotic-associated diarrhea, inflammatory bowel disease and other fields.

[0017] Information on the preservation of biological materials: LFS01, referred to in this invention as *Bifidobacterium longum* LFS01, was deposited on July 9, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.35159. The address of the depository is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, postcode: 100101, and its classification name is *Bifidobacterium longum* LFS01. Bifidobacterium longum LFS01. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. The drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is the genomic information of Bifidobacterium longum LFS01.

[0020] Figure 2 The figures show the organ index and intestinal immunoglobulin SIgA level of mice in each group; in the figure, A is the spleen index of mice; B is the colon length of mice; and C is the colon SIgA level.

[0021] Figure 3 Figure 1 shows the colonic structure and expression level of mucin MUC2 in each group of mice; in the figure, A is the HE staining image of the mouse colon; B is the length of the mouse colonic crypts; C is the length of the mouse colon. Muc2 The relative expression level of mRNA.

[0022] Figure 4The abundance of Bifidobacteria and the beta-diversity of gut microbiota in the colon tissue of mice in each group were analyzed. In the figure, A is the relative abundance of Bifidobacteria in the intestines of mice in different groups; B is the PCoA analysis of gut microbiota in the CC group and CC+CR group; C is the PCoA analysis of gut microbiota in the CC+CR group and CC+CR+BIFI group; D is the PCoA analysis of gut microbiota in the NC group, CC group, CC+CR group and CC+CR+BIFI group. Detailed Implementation

[0023] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0024] Example 1: Isolation and identification of Bifidobacterium longum LFS01.

[0025] I. Isolation of bacterial strains In the experimental examples of this invention, the culture medium used to culture Bifidobacterium longum was MRS medium containing 0.05% L-cysteine. MRS liquid medium: 10g peptone, 8g beef extract, 4g yeast extract, 20g glucose, 1mL Tween-80, 2g dipotassium hydrogen phosphate, 5g sodium acetate, 2g triamine citrate, 0.05g manganese sulfate, 0.2g magnesium sulfate, 1L distilled water, pH adjusted to 6.5, sterilized at 121℃ for 15min. Improved MRS solid culture medium formula and preparation method: 10g peptone, 8g beef extract, 5g yeast extract, 20g glucose, 1mL Tween 80, 5g sodium acetate, 2g triammonium citrate, 0.05g manganese sulfate, 0.2g magnesium sulfate, 2g potassium dihydrogen phosphate, 15g agar, distilled water to a final volume of 1L, pH 6.2, autoclave at 121℃ for 15min, cool to 50℃, add 10mg of filtered sterilized mupirocin lithium salt and 0.1g of cysteine ​​hydrochloride to every 200ml of culture medium, mix well, and pour into sterile Petri dishes.

[0026] Fecal samples from healthy adults were serially diluted with sterile PBS buffer to prepare a bacterial suspension. An appropriate amount of the suspension was evenly spread onto modified MRS solid medium plates and placed in an anaerobic incubator with an oxygen concentration <0.5%. The plates were incubated at 37°C for 48 hours. Single colonies were then picked using a sterile inoculation loop and inoculated into MRS liquid medium containing 0.05% L-cysteine. The plates were then incubated anaerobically at 37°C for 48 hours. The bacterial suspension was then streaked onto fresh modified MRS solid medium plates, and the plates were incubated anaerobically at 37°C for 48 hours. This process of picking, liquid incubation, and streaking was repeated three times to obtain purified single colonies. These purified single colonies were then inoculated into MRS liquid medium containing 0.05% L-cysteine ​​and incubated anaerobicly at 37°C for 48 hours to allow the strain to multiply and yield the target strain.

[0027] Microscopic observation revealed that the target bacterial strain was a Gram-positive bacterium, non-motile, non-spore-forming, and obligately anaerobic; the bacterial cells were rod-shaped, and the colonies were milky white, smooth, round, and small with neat edges.

[0028] II. Identification of Strains The target strain isolated was subjected to PCR using universal 16S rDNA primers 27F and 1492R. The PCR products were then sequenced. The 27F sequence was AGAGTTTGATCCTGGCTCAG, and the 1492R sequence was TACGGCTACCTTGTTACGACTT. Amplification conditions were as follows: pre-denaturation at 94℃ for 5 min, one cycle; denaturation at 94℃ for 30 s, annealing at 54℃ for 30 s, extension at 72℃ for 90 s, 35 cycles; and extension at 72℃ for 10 min, one cycle. The PCR products were sequenced. The obtained 16S rDNA sequence was BLAST-aligned with the NCBI Genome database. The results showed that the target strain was similar to known... Bifidobacterium longum The homology with subsp. suillum was 99.86%, confirming it as a different strain of the same species of Bifidobacterium longum, named Bifidobacterium longum LFS01. The genome length of Bifidobacterium longum LFS01 is 2299907 bp, and the information is as follows: Figure 1 As shown. The 16S rDNA sequence information is shown in SEQ ID NO: 1.

[0029] SEQ ID NO: 1: AGTCAGACGGCTGCATCCCACAAGGGGTTAGGCCA CCGGCTTCGGGTGCTGCCCACTTTCATGACTTGACGGGCGGTGTGTACAA GGCCCGGGAACGCATTCACCGCGACGTTGCTGATTCGCGATTACTAGCGA CTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGG TTTTCAGGGATCCGCTCCGCGTCGCCGCGTCGCATCCCGTTGTACCGGCCA TTGTAGCATGCGTGAAGCCCTGGACGTAAGGGGCATGATGATCTGACGTC ATCCCCACCTTCCTCCGAGTTAACCCCGGCGGTCCCCCGTGAGTTCCCGG CATAATCCGCTGGCAACACGGGGCGAGGGTTGCGCTCGTTGCGGGACTTA ACCCAACATCTCACGACACGAGCTGACGACGACCATGCACCACCTGTGA ACCCGCCCCGAAGGGAAGCCGTATCTCTACGACCGTCGGGAACATGTCAA GCCCAGGTAAGGTTCTTCGCGTTGCATCGAATTAATCCGCATGCTCCGCCG CTTGTGCGGGCCCCCGTCAATTTCTTTGAGTTTTAGCCTTGCGGCCGTACT CCCCAGGCGGGATGCTTAACGCGTTAGCTCCGACACGGAACCCGTGGAA CGGGCCCCACATCCAGCATCCACCGTTTACGGCGTGGACTACCAGGGTAT CTAATCCTGTTCGCTCCCCACGCTTTCGCTCCTCAGCGTCAGTAACGGCCC AGAGACCTGCCTTCGCCATTGGTGTTCTTCCCGATATCTACACATTCCACC GTTACACCGGGAATTCCAGTCTCCCCTACCGCACTCAAGCCCGCCCGTAC CCGGCGCGGATCCACCGTTAAGCGATGGACTTTCACACCGGACGCGACGA ACCGCCTACGAGCCCTTTACGCCCAATAATTCCGGATAACGCTTGCACCCT ACGTATTACCGCGGCTGCTGGCACGTAGTTAGCCGGTGCTTATTCAACGGG TAAACTCACTCTCGCTTGCTCCCCGATAAAAGAGGTTTACAACCCGAAGG CCTCCATCCCTCACGCGGCGTCGCTGCATCAGGCTTGCGCCCATTGTGCA ATATTCCCCACTGCTGCTCCCGTAGGAGTCTGGGCCGTATCTCAGTCCCA ATGTGGCCGGTCGCCCTCTCAGGCCGGCTACCCGTCGAAGCCACGGTGGG CCGTTACCCCGCCGTCAAGCTGATAGGACGCGACCCCATCCCATACCGCG AAAGCTTCCCAGAAGACCATGCGATCAACTGGAGCATCCGGCATTACCA CCCGTTTCCAGGAGCTATTCCGGTGTATGGGGCAGGTCGGTCACGCATTAC TCACCCGTTCGCCACTCTCACCATCAAGCAAAGCCTGATGGATCCCGTTC GACTGCATGGTAAGCACCGAACCAA.

[0030] III. Lactic acid production performance of Bifidobacterium longum LFS01 Single colonies of *Bifidobacterium longum* strain LFS01 were picked and inoculated into MRS liquid medium containing 0.05% L-cysteine ​​(w / v). After overnight incubation, 200 μL of the bacterial culture was collected for later use. L-lactic acid assay was performed using a kit purchased from Nanjing Jiancheng Biotechnology Institute. The specific steps are as follows:

[0031] After obtaining the bacterial culture samples, add 2.5 μL of 10-fold diluted bacterial culture and 180 μL of reagent I to the test wells of a 96-well plate; add 2.5 μL of 3 mmol / L standard solution and 180 μL of reagent I to the standard wells; add 2.5 μL and 180 μL of reagent I to the blank wells. Gently shake the plate to mix, incubate at 37°C for 3 min, and measure the absorbance value A1 at 546 nm using a microplate reader. Then add 60 μL of reagent II to each well, gently shake the plate to mix, incubate at 37°C for 5 min, and measure the absorbance value A2 again at 546 nm. Calculate ΔA = A2 - A1, where ΔA in the test wells is recorded as ΔA_test, ΔA in the standard wells is recorded as ΔA_standard, and ΔA in the blank wells is recorded as ΔA_blank. Calculate the L-lactic acid content of *Bifidobacterium longum* LFS01 using the following formula, in mmol / L:

[0032] L-lactic acid content = (△A determination - △A blank / △A standard - △A blank) × C standard × N dilution factor.

[0033] In the test results, the ΔA value was 0.1890, the ΔA blank value was 0.0075, the ΔA standard value was 0.1103, the C standard value was 3, and the N dilution factor was 10. Therefore, the L-lactic acid content of Bifidobacterium longum LFS01 = 0.1815 / 0.1028 × 3 × 10 = 52.9 mmol / L.

[0034] Example 2: The effect of Bifidobacterium longum LFS01 on preventing infection after bowel cleansing and improving intestinal mucosal damage.

[0035] I. Experimental Materials Citric acid-corroding bacteria Citrobacterrodentium The material was purchased from Beijing Beina Chuanglian Biotechnology Research Institute Co., Ltd., and is referred to as CR in this invention.

[0036] II. Animal Experiments Twenty 7-week-old SPF mice were placed in a 12-hour light-dark alternating environment for one week for acclimatization. They were then randomly divided into four groups: normal group (NC); colon cleansing group (CC); colon cleansing + CR group (CC+CR); and colon cleansing + CR + Bifidobacterium longum LFS01 group (CC+CR+BIFI). There were 5 mice in each group.

[0037] All mice were administered 5 g / kg polyethylene glycol via gavage to establish the colonic model, with each gavage administration being 0.15 ml, 30 min apart, and 5 times daily. Normal mice were administered an equal volume of PBS via gavage. Mice in the CR infection group were administered CR via gavage 24 h after colonic modeling, with a gavage volume of 1 × 10⁻⁶ ml. 8 CFU / animal; Bifidobacterium longum LFS01 was administered by gavage 24 hours after CR infection, and diluted with PBS to 1×10⁻⁶. 9CFU / mL, 0.2 mL was administered to each mouse by gavage, which is equivalent to 1 × 10⁻⁶ CFU / mL. 9 CFU / animal, once daily for 11 days; other groups received the same amount of PBS.

[0038] During the experiment, the mice's weight was recorded daily, and their feces were collected. The mice had free access to food and water every day. On the 12th day, the mice were sacrificed, and their colons were taken and their total length was measured using a standard ruler. The spleen tissue was also weighed, and the spleen index of the mice was expressed as spleen weight / mouse body weight.

[0039] Figure 2 Figures A and B show that the spleen index of the CC group mice was significantly lower than that of the NC group mice, indicating that the bowel cleansing process leads to a decrease in the body's immunity. Compared with the CC group mice, the spleen index of the CC+CR group mice was significantly increased and the colon length was decreased, indicating that the infection of pathogens after bowel cleansing induced an inflammatory state in the spleen and intestines. Compared with the CC+CR group mice, the spleen index of the CC+CR+BIFI group mice was significantly decreased and the colon length was significantly increased, indicating that in the intestinal environment after bowel cleansing, the Bifidobacterium longum LFS01 of this invention can inhibit the spleen and colon inflammation induced by pathogen colonization in the intestine.

[0040] III. SlgA Level Detection Mouse colonic mucosal samples were collected and homogenized thoroughly in pre-chilled PBS buffer containing protease inhibitors. The supernatant was then obtained by centrifugation at 12000g for 15 min at 4°C. The mouse secretory immunoglobulin A specific ELISA kit (purchased from Shanghai Zhuocai Biotechnology Co., Ltd.) was used for detection. After the kit was incubated at 24°C for 30 min, the positions of the standard and sample wells were set. 50 μL of standard working solutions (1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL, 16 μg / mL, and 32 μg / mL) were added to the standard wells, and 50 μL of the test sample was added to the sample wells. The reaction plate was covered with sealing film and incubated at 37°C in the dark for 60 min. The sealing film was then removed, and the plate was washed 5 times using an automatic plate washer, immersing for 30 seconds each time. After washing, the plate was thoroughly dried with absorbent paper. Two drops each of solution A and solution B were added to all wells, the reaction plate was covered with sealing film, and incubated at 37°C in the dark for 15 min. Add 50 μL of stop solution to each well and read the OD value of each well at 450 nm using a microplate reader. Plot a standard curve using the standard concentrations and OD values. Create the standard curve equation using computer software and calculate the concentration of secretory immunoglobulin A (sIgA) using the OD values ​​of the sample wells. The relationship between standard concentrations and OD values ​​is shown in Table 1. The standard curve equation is: y = 15.625x - 1.7949, R0 2 =0.9944; where y is the sIgA concentration and x is the OD450.

[0041] Table 1. Correspondence between standard concentration and OD value After bowel cleansing, pathogenic bacterial infections can significantly damage the intestinal mucosal immune system and suppress sIgA secretion levels. SIgA can effectively block the colonization of pathogens and toxin translocation through mechanisms such as neutralizing pathogens, inhibiting bacterial adhesion, and promoting pathogen clearance, thereby forming a highly effective immune barrier on the intestinal lumen surface. Figure 2 The results showed that the sIgA level was significantly increased in the CC+CR+BIFI group compared with that in the CC+CR group, indicating that the Bifidobacterium longum LFS01 of the present invention can activate the intestinal mucosal immune system and significantly increase the secretion level of sIgA, further proving that the Bifidobacterium longum LFS01 provided by the present invention can colonize and inhibit the adhesion and invasion of pathogens in a cleansed environment.

[0042] IV. Pathological analysis and Muc2 expression level analysis of colon tissue Paraffin sectioning and HE staining of mouse colon: After euthanasia and dissection of mice in a biosafety cabinet, colon tissue was immediately taken and fixed in paraformaldehyde fixative at 4°C for 24 hours. After fixation, the tissue blocks were trimmed flat with a scalpel in a fume hood, placed in an embedding frame, and labeled accordingly. The dehydration box was placed in a dehydrator and processed sequentially according to the following procedure: 75% ethanol for 4 hours, 85% ethanol for 2 hours, 90% ethanol for 2 hours, 95% ethanol for 1 hour, anhydrous ethanol I for 30 minutes, anhydrous ethanol II for 30 minutes, xylene I for 10 minutes, xylene II for 10 minutes, 65°C paraffin I for 1 hour, 65°C paraffin II for 1 hour, and 65°C paraffin III for 1 hour to obtain paraffin-impregnated tissue; I, II, and III represent different treatment times with the same reagent. After being impregnated with paraffin, the tissue was placed in an embedding frame according to the embedding requirements. After being cooled and solidified on a -20°C freezing stage, the paraffin block was trimmed. A 4μm thick section was cut using a paraffin microtome. After being spread in 40°C warm water, the section was attached to a glass slide and then baked in a 60°C oven until completely dry. The section was then immersed in molten paraffin, cooled to form a protective film, and then baked at 67°C to melt the wax film, thus obtaining paraffin sections. Paraffin sections were treated sequentially with the following solutions: environmentally friendly dewaxing solution I for 20 min, environmentally friendly dewaxing solution II for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% ethanol for 5 min. Afterward, they were rinsed with running water and then subjected to H&E staining as follows: high-resolution constant staining pretreatment solution for 1 min, hematoxylin for 5 min, rinsed with running water, 95% ethanol for 1 min, and eosin stain for 15 s. After rinsing again with running water, they were sequentially treated with: anhydrous ethanol I, II, and III for 2 min each, n-butanol I and II for 2 min each, and xylene I and II for 2 min each. Neutral resin was obtained for mounting, and the sections were observed under a microscope. Images were acquired and pathological analysis was performed. I, II, and III represent different treatment times with the same reagents.

[0043] The results of microstructural analysis of colon tissue from each group of mice are shown below. Figure 3 The results showed that the colonic mucosa of mice in the CC group was mildly damaged; mice in the CC+CR group showed severe colitis, characterized by crypt enlargement and extensive inflammatory cell infiltration; in contrast, the colonic mucosa of mice in the CC+CR+BIFI group was intact, the crypts were shortened, and the inflammatory infiltration was significantly reduced, indicating that Bifidobacterium longum LFS01 can effectively alleviate intestinal barrier damage and inflammatory response induced by bowel cleansing and infection, demonstrating a significant protective effect on the intestinal mucosa.

[0044] Muc2 expression level analysis: First, 20 mg of mouse colon tissue was placed in a homogenizing tube containing grinding beads and lysis buffer, and homogenized using a high-throughput tissue homogenizer at 4℃ and 60Hz for 60 s to achieve thorough homogenization. RNA was then extracted using the chloroform-isopropanol method, and finally purified by dissolving in DEPC water. The concentration was adjusted to 500 ng / μL using Nano Drop quantification. Reverse transcription was performed using the Hifair® Ⅲ first-strand cDNA synthesis premix kit purchased from Shanghai Sangon Biotech Co., Ltd. The kit's operating procedures were strictly followed, sequentially performing genomic DNA removal and cDNA synthesis reactions at 25℃ for 5 min, 55℃ for 15 min, and 85℃ for 5 min to obtain high-quality cDNA for subsequent qPCR analysis of Muc2 expression levels.

[0045] The primer sequences for Muc2 are as follows: Forward Primer: 5'-ATGCCCACCTCCTCAAAGAC-3', SEQ ID NO: 2; Reverse Primer: 5'-GTAGTTTCCGTTGGAACAGTGAA-3', SEQ ID NO: 3.

[0046] The qPCR reaction system consisted of: 5 μL SGExcel FastSYBR Master premix, 0.5 μL 10 μM Forward Primer, 0.5 μL 10 μM Reverse Primer, 1 μL cDNA, and RNase-free ddH2O to a final volume of 10 μL. The reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 5 s, 60℃ annealing and extension for 20 s with fluorescence acquisition, for 40 cycles; finally, melting curve analysis was performed from 65℃ to 95℃ with fluorescence acquisition, in increments of 0.5℃ and 5 s per step.

[0047] Muc2 It is a core component of mucin secreted by goblet cells in the intestine and forms the physical basis of the intestinal mucosal barrier. Figure 3The C-value showed that, compared with the CC+CR group mice, the colon tissue of the CC+CR+BIFI group mice had lower concentrations of [unclear - likely referring to a specific type of protein]. Muc2 The significantly increased expression level indicates that the intervention of Bifidobacterium longum LFS01 provided in this invention can significantly improve... Muc2 The expression level of [something] can be improved, thereby repairing the intestinal mucosal barrier damage caused by pathogenic bacterial infection after bowel cleansing.

[0048] V. 16S rRNA Sequencing and Analysis According to the instructions of the QIAamp® Fast DNA Stool Mini Kit purchased from Shanghai Sangon Biotech Co., Ltd., mouse fecal microbial genomic DNA was extracted in an RNase-free environment as follows: 100 mg of mouse fecal sample was accurately weighed into a pre-chilled centrifuge tube, 1 mL of InhibitEX Buffer and grinding beads were added and vortexed for homogenization. After centrifugation at 16000g for 1 min, 600 μL of the supernatant was mixed with 25 μL of proteinase K solution, and 600 μL of Buffer AL was added and vortexed. The mixture was incubated at 70℃ for 10 min. Subsequently, 600 μL of anhydrous ethanol was added to precipitate the sample. The mixture was transferred in portions to a QIAamp rotary column for centrifugation. After washing twice with Buffer AW1 and Buffer AW2, the rotary column was centrifuged and dried. Finally, 200 μL of Buffer ATE was used for elution to obtain mouse fecal microbial genomic DNA.

[0049] Mouse fecal microbial genomic DNA samples were transported to Tianjin Yunsitop Biotechnology Co., Ltd. at below 0°C, where the company constructed the high-throughput sequencing library and performed sequencing based on the Illumina MiSeq platform. The experimental procedure followed standard methods provided by Illumina, including sample quality control, library construction, library quality control, and library sequencing. After the genomic DNA samples passed quality control, the DNA was fragmented. Then, the fragmented DNA underwent end repair, 3' end A addition, sequencing adapter ligation, purification and fragment screening of the ligation product, library amplification, and product purification to form a sequencing library. After passing quality control, the library was sequenced using an Illumina sequencer. The raw sequencing data underwent quality control and host filtering to obtain Clean Data. The Clean Data was then used for sequence assembly, species annotation, and species difference analysis using Megahit.

[0050] Figure 4 The results showed that the relative abundance of Bifidobacterium in the intestines of mice in the CC+CR+BIFI group was significantly increased by about 3.5 times compared with that in mice in the CC+CR group, indicating that Bifidobacterium longum LFS01 in this invention can colonize and grow in the intestines of mice that have undergone intestinal cleansing and are infected with pathogens. Figure 4B showed that there were significant differences in the gut microbiota between CC+CR mice and CC group mice, indicating that infection with pathogens after bowel cleansing can significantly alter the overall structure of the gut microbiota. Figure 4 Figures C and D show that the gut microbiota of CC+CR+BIFI mice and CC+CR mice were significantly different, and more similar to those of NC and CC mice. This indicates that the intervention with Bifidobacterium longum LFS01 provided by this invention can significantly alter the structure of the gut microbiota in mice infected with pathogens after bowel cleansing, and its structure is closer to that of normal mice. These results demonstrate that the Bifidobacterium longum LFS01 provided by this invention can effectively promote the recovery of gut microbiota after bowel cleansing and infection with pathogens.

[0051] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments.

[0052] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A strain of Bifidobacterium longum ( Bifidobacterium longum LFS01, characterized in that, The *Bifidobacterium longum* LFS01 was deposited at the China General Microbiological Culture Collection Center on July 9, 2025, with accession number CGMCC NO. 35159, and classified as *Bifidobacterium longum* LFS01. Bifidobacterium longum LFS01.

2. The Bifidobacterium longum LFS01 according to claim 1, characterized in that, The 16S rDNA sequence of the strain is shown in SEQ ID NO:

1.

3. The use of Bifidobacterium longum LFS01 as described in claim 1 in the preparation of a medicament for the prevention or treatment of pathogenic bacterial infection after gastroscopy and colonoscopy.

4. The application according to claim 3, characterized in that, The pathogenic bacterium is *Citrobacter citric acid bacterium* (… Citrobacter rodentium ).

5. The application according to claim 3, wherein the drug uses Bifidobacterium longum LFS01 as the active ingredient as described in claim 1.

6. The application according to claim 3, characterized in that, The drug also includes pharmaceutically acceptable excipients; the excipients are PBS buffer.

7. The application according to claim 6, characterized in that, The drug was prepared by diluting Bifidobacterium longum LFS01 to 1×10⁻⁶ with PBS buffer. 9 CFU / mL was obtained.

8. The application according to claim 3, characterized in that, The drug is used to alleviate intestinal inflammation and intestinal mucosal barrier damage in animals caused by pathogenic bacterial infection after bowel cleansing.

9. The application according to claim 3, characterized in that, The drug is used to improve the gut microbiota structure.

Images