Gene editing system and its application in preparation of scn5a gene mutation arrhythmia model pig nuclear transfer donor cell

Abstract

The application discloses a gene editing system and application thereof in preparation of a heart rate arrhythmia model pig nuclear transfer donor cell with SCN5A gene mutation. The application provides a method for preparing a recombinant cell: a DNA molecule shown in SEQ ID NO: 18 is used to replace a DNA molecule shown in SEQ ID NO: 19 in chromosomal DNA of a pig cell, so that a recombinant pig cell is obtained. The application adopts CRISPR / Cas9 technology combined with ssODN homologous recombination technology to carry out directional gene editing of the SCN5A gene, simulates natural pathogenic genetic characteristics of heart rate arrhythmia, and obtains a single cell clone with directional mutation of the SCN5A gene, thereby laying a foundation for cultivating a heart rate arrhythmia model pig through somatic cell nuclear transfer animal cloning technology in the later stage.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of gene editing, and particularly relates to a gene editing system and application thereof in preparation of a porcine nuclear transfer donor cell of an arrhythmia model of SCN5A gene mutation. BACKGROUND

[0002] Arrhythmia is a disorder of the rate of myocardial contraction, or any variation in the normal rhythm or rate of the heartbeat. It includes both regular and irregular abnormal rhythms, and loss of rhythm. Arrhythmias are clearly related to abnormal expression of ion channel genes, and mutations in multiple ion channel genes can cause various arrhythmias. At present, it is known that most primary electrical abnormalities are caused by mutations in genes encoding various major ion channel subunits, and therefore, such diseases can be called "ion channel diseases". Nav1.5 channel is a major type of human cardiac sodium ion channel, responsible for the initiation and propagation of action potentials, and is encoded by the SCN5A gene.

[0003] The mechanism of occurrence and development of arrhythmia and the development of corresponding drugs need to be studied on the basis of animal models. At present, the commonly used animal model is a mouse model, and obvious arrhythmia is observed in SCN5A gene knockout mice. However, mice are quite different from humans in terms of size, organ size, physiology, pathology, and other aspects, and cannot truly simulate the normal physiological and pathological states of humans. Pigs, as large animals, are similar to humans in size and physiological functions, are easy to breed in large quantities, and have lower requirements in terms of ethics, morality, and animal protection, and are ideal animal models for human diseases.

[0004] Gene editing is a biological technology that has made significant progress in recent years, including gene editing based on homologous recombination, ZFN, TALEN, CRISPR / Cas9, and other editing technologies based on nucleases. Among them, the CRISPR / Cas9 technology is the most advanced gene editing technology at present. At present, gene editing technology is increasingly applied to the preparation of animal models.

[0005] Homologous recombination (HDR) is a process of exchanging DNA sequence information through sequence homology: that is, a repair template containing the desired insert is included in the repair template, and the two ends of the repair template are recombination arms with sequence homology near the insertion site. In the past, double-stranded DNA (dsDNA) has been commonly used as a repair template, but recent studies have revealed the superiority of single-stranded oligonucleotide deoxynucleotide (ssODN) as a HDR donor template. First, ssODN as a donor template is more specific to the insertion site than dsDNA template, and dsDNA template is prone to random insertion. Second, ssODN requires shorter homologous recombination arms than dsDNA template, and a single-sided 30-60 base recombination arm design can achieve efficient and stable HDR, which provides higher insertion efficiency than similar dsDNA templates. Third, dsDNA is prone to be incorporated by the NHEJ repair pathway, resulting in replication of the homologous arm or partial integration of the dsDNA template, while ssODN is less likely to occur. In addition, dsDNAs are harmful to cultured cells, linear or plasmid dsDNAs have low transfection efficiency and cause adverse reactions in cells, while ssODN templates have more advantages in these aspects. SUMMARY

[0006] The purpose of the present application is to provide a gene editing system and its application in preparing SCN5A gene mutation arrhythmia model pig nuclear transfer donor cells.

[0007] The present application provides a method for preparing a recombinant pig cell, comprising the following steps: replacing the DNA molecule represented by SEQ ID NO: 19 in the chromosomal DNA of the pig cell with the DNA molecule represented by SEQ ID NO: 18 to obtain a recombinant pig cell.

[0008] The implementation of replacing the DNA molecule represented by SEQ ID NO: 19 in the chromosomal DNA of the pig cell with the DNA molecule represented by SEQ ID NO: 18 is: co-transfecting SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein into pig cells.

[0009] The ratio of pig cells, SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein is 100,000 pig cells: 0.8-1.2 μg SCN5A-gRNA2: 0.8-1.2 μg SCN5A-gRNA3: 1.8-2.2 μg SCN5A-mutant-ss153: 3-5 μg NCN protein.

[0010] The ratio of the pig cells, SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein is 100,000 pig cells: 1 μg SCN5A-gRNA2: 1 μg SCN5A-gRNA3: 2 μg SCN5A-mutant-ss153: 4 μg NCN protein.

[0011] The co-transfection is specifically in the form of electroporation.

[0012] The parameter setting of the electroporation is specifically 1450V, 10ms, 3pulse.

[0013] The co-transfection can be specifically performed by using a mammalian nucleic transfection kit (Neon kit, Thermofisher) and a NeonTM transfection system electroporator.

[0014] The application also protects a kit comprising SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein.

[0015] The application also protects a kit comprising SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and PRONCN protein.

[0016] The application also protects a kit comprising SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and a specific plasmid.

[0017] The kit also comprises E. coli BL21 (DE3).

[0018] The kit also comprises pig cells.

[0019] The application provides the application of SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein in the preparation of a kit.

[0020] The application also provides the application of SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and PRONCN protein in the preparation of a kit.

[0021] The application also provides the application of SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and a specific plasmid in the preparation of a kit.

[0022] The use of any of the above-mentioned kits is as follows (a) or (b) or (c): (a) preparing a recombinant pig cell; (b) preparing a pig model of arrhythmia; (c) preparing a cell model of arrhythmia or a tissue model of arrhythmia or an organ model of arrhythmia.

[0023] The ratio of SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein is 0.8-1.2 μg SCN5A-gRNA2: 0.8-1.2 μg SCN5A-gRNA3: 1.8-2.2 μg SCN5A-mutant-ss153: 3-5 μg NCN protein, respectively.

[0024] The ratio of SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein is 0.8-1.2 μg SCN5A-gRNA2: 0.8-1.2 μg SCN5A-gRNA3: 1.8-2.2 μg SCN5A-mutant-ss153: 3-5 μg NCN protein, respectively.

[0025] The ratio of pig cells, SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein is 100,000 pig cells: 0.8-1.2 μg SCN5A-gRNA2: 0.8-1.2 μg SCN5A-gRNA3: 1.8-2.2 μg SCN5A-mutant-ss153: 3-5 μg NCN protein, respectively.

[0026] The ratio of pig cells, SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein is 100,000 pig cells: 0.8-1.2 μg SCN5A-gRNA2: 0.8-1.2 μg SCN5A-gRNA3: 1.8-2.2 μg SCN5A-mutant-ss153: 3-5 μg NCN protein, respectively.

[0027] The above-mentioned SCN5A-gRNA2 is an sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 16.

[0028] Specifically, the SCN5A-gRNA2 is as shown in SEQ ID NO: 16.

[0029] Specifically, the SCN5A-gRNA2 is as shown in SEQ ID NO: 11.

[0030] The SCN5A-gRNA3 is a sgRNA, and the target sequence binding region is shown as nucleotides 3-22 of SEQ ID NO: 17.

[0031] Specifically, the SCN5A-gRNA3 is shown as SEQ ID NO: 17.

[0032] Specifically, the SCN5A-gRNA3 is shown as SEQ ID NO: 12.

[0033] Specifically, the SCN5A-mutant-ss153 is a single-stranded DNA molecule shown as SEQ ID NO: 18.

[0034] The NCN protein is a Cas9 protein or a fusion protein having the Cas9 protein.

[0035] Specifically, the NCN protein is shown as SEQ ID NO: 3.

[0036] The pig cell is a pig fibroblast.

[0037] The pig cell is a pig primary fibroblast.

[0038] The pig cell is a pig primary fibroblast obtained from a newborn pig.

[0039] The method for preparing the NCN protein comprises the following steps:

[0040] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium;

[0041] (2) culturing the recombinant bacterium at 30°C using a liquid medium, then adding IPTG and performing 25°C induction culture, and then collecting the bacterial bodies;

[0042] (3) performing bacterial body disruption on the collected bacterial bodies to collect a crude protein solution;

[0043] (4) purifying the fusion protein having a His6 tag from the crude protein solution using affinity chromatography;

[0044] (5) performing enterokinase enzyme cutting on the fusion protein having a His6 tag, and then removing the protein having a His6 tag using Ni-NTA resin to obtain the purified NCN protein;

[0045] The fusion gene shown as nucleotides 5209-9852 of SEQ ID NO: 1 is in the plasmid pKG-GE4.

[0046] The method for preparing the NCN protein comprises the following steps:

[0047] (1) Introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium.

[0048] (2) Inoculating the recombinant bacterium obtained in step (1) into a liquid LB medium containing ampicillin and performing shaking culture;

[0049] (3) Inoculating the bacterial solution obtained in step (2) into a liquid LB medium and performing shaking culture at 30°C and 230 rpm until the OD value is 1.0, then adding IPTG to make the concentration in the system 0.5 mM, and then performing shaking culture at 25°C and 230 rpm for 12 hours, and then centrifuging to collect the bacterial bodies; 600nm

[0050] (4) Taking the bacterial bodies obtained in step (3) and washing with PBS buffer;

[0051] (5) Taking the bacterial bodies obtained in step (4), adding crude extraction buffer and suspending the bacterial bodies, then performing bacterial body disruption, then centrifuging to collect the supernatant, filtering with a 0.22 μm pore size filter membrane, and collecting the filtrate;

[0052] (6) Purifying the fusion protein (the fusion protein shown in SEQ ID NO: 2) with His6 tag from the filtrate obtained in step (5) by affinity chromatography;

[0053] (7) Taking the post-column solution collected in step (6), concentrating using an ultrafiltration tube, and then diluting with 25 mM Tris-HCl (pH 8.0);

[0054] (8) Adding the recombinant bovine enterokinase with His6 tag to the solution obtained in step (7) and performing enzyme cutting;

[0055] (9) Mixing the solution after step (8) with Ni-NTA resin, incubating, and then centrifuging to collect the supernatant;

[0056] (10) Taking the supernatant obtained in step (9), concentrating using an ultrafiltration tube, and then adding enzyme storage solution, which is the NCN protein solution.

[0057] The specific method for purifying the fusion protein with His6 tag from the filtrate obtained in step (5) by affinity chromatography is as follows:

[0058] ​First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then load 50 ml of the filtrate obtained in step (5) at a flow rate of 0.5-1 ml / min; then wash the column with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then wash the column with 5 column volumes of buffer to remove the impurities at a flow rate of 1 ml / min; then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the column eluate (90-100 ml).

[0059] Any of the above-mentioned PRONCN proteins comprises, from upstream to downstream, the following elements: a signal peptide, a chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, a nuclear localization signal.

[0060] The signal peptide functions to promote protein secretion expression. The signal peptide can be selected from the group consisting of an E. coli alkaline phosphatase (phoA) signal peptide, a Staphylococcus aureus protein A signal peptide, an E. coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably a phoA signal peptide. The phoA signal peptide is used to guide the secretion expression of the target protein into the periplasmic cavity of the bacteria, so as to separate the intracellular protein of the bacteria, and the target protein secreted into the periplasmic cavity of the bacteria is soluble expression, which can be cleaved by the signal peptide enzyme in the periplasmic cavity.

[0061] The chaperone protein functions to increase the solubility of the protein. The chaperone can be any protein that helps form disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can act as a chaperone to help the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improve the stability, folding accuracy of the protein, and increase the solubility and activity of the target protein.

[0062] The protein tag functions for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, further preferably a His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein.

[0063] The function of the protease cleavage site is to be used to remove the non-functional segment after purification to release the natural form of Cas9 protein. The protease can be selected from enterokinase, Factor Xa, Thrombin, TEV protease, HRV 3C protease, WELQut protease or any other endoprotease, and enterokinase is further preferred. EK is an enterokinase cleavage site, which is convenient for using enterokinase to remove the fused TrxA-His segment to obtain the natural form of Cas9 protein. After the commercial enterokinase with a His tag is used to cut the fusion protein, the TrxA-His segment and the enterokinase with a His tag can be removed by one affinity chromatography to obtain the natural form of Cas9 protein, thereby avoiding the damage and loss of the target protein caused by multiple purification and dialysis.

[0064] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. NLS is a nuclear localization signal, and an NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, to enable Cas9 to more effectively enter the cell nucleus for gene editing.

[0065] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.

[0066] The PRONCN protein is specifically shown in SEQ ID NO: 2.

[0067] Any of the above-mentioned specific plasmids includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a gene encoding PRONCN protein, and a terminator.

[0068] The promoter may specifically be a T7 promoter, which is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.

[0069] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, IPTG can be used to induce expression of the target protein at low temperatures. This can prevent the impact of premature expression of the target protein on host bacterial growth. Inducing expression at low temperatures also significantly improves the solubility of the expressed target protein.

[0070] The ribosome binding site is a ribosome binding site during protein translation and is necessary for protein translation.

[0071] The terminator may specifically be a T7 terminator, which can effectively terminate gene transcription at the end of the target gene, thereby preventing other downstream sequences other than the target gene from being transcribed and translated.

[0072] For the codons of the spCas9 protein, this application has optimized its codons to make it fully adapt to the codon preference of the Escherichia coli high-efficiency expression strain E. coli BL21 (DE3) selected in this application, thereby improving the expression level of the Cas9 protein.

[0073] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.

[0074] The Lac operon is shown in nucleotides 5140 to 5164 of SEQ ID NO: 1.

[0075] The ribosome binding site is shown in nucleotides 5178 to 5201 of SEQ ID NO: 1.

[0076] The coding sequence of the alkaline phosphatase signal peptide is shown in nucleotides 5209 to 5271 in SEQ ID NO: 1.

[0077] The coding sequence of the TrxA protein is shown in nucleotides 5272-5598 in SEQ ID NO: 1.

[0078] The coding sequence of His-Tag is shown in nucleotides 5620-5637 in SEQ ID NO: 1.

[0079] The coding sequence of the enterokinase cleavage site is shown in nucleotides 5638 to 5652 in SEQ ID NO: 1.

[0080] The coding sequence of the nuclear localization signal is shown in nucleotides 5656-5670 of SEQ ID NO: 1.

[0081] The coding sequence of the spCas9 protein is shown in nucleotides 5701-9801 in SEQ ID NO: 1.

[0082] The coding sequence of the nuclear localization signal is shown in nucleotides 9802-9849 of SEQ ID NO: 1.

[0083] The T7 terminator is shown as nucleotides 9902-9949 in SEQ ID NO: 1.

[0084] Specifically, the specific plasmid is plasmid pKG-GE4.

[0085] The DNA molecule shown in SEQ ID NO: 1 at nucleotides 5121-9949.

[0086] Specifically, the plasmid pKG-GE4 described above is shown in SEQ ID NO: 1.

[0087] The present application also protects the recombinant pig cell prepared by the method described above.

[0088] The recombinant pig cell is a double-allele same mutant recombinant cell with a target site mutation.

[0089] The double-allele same mutant with a target site mutation means that both homologous chromosomes have completed replacement of single-stranded Donor DNA.

[0090] The replacement of single-stranded Donor DNA means that the DNA molecule shown in SEQ ID NO: 19 is replaced by the DNA molecule shown in SEQ ID NO: 18 in the chromosomal DNA of the pig cell.

[0091] The DNA molecule shown in SEQ ID NO: 19 is located in the SCN5A gene in the chromosomal DNA of the pig cell.

[0092] Pig SCN5A gene information: encoding voltage-gated sodium ion channel alpha subunit 5; located on chromosome 13; Gene ID is 100152567, Sus scrofa.

[0093] The protein encoded by the pig SCN5A gene is shown in NCBI XP_020927335.1 (13-MAY-2017).

[0094] The protein encoded by the pig SCN5A gene has the protein segment shown in SEQ ID NO: 8.

[0095] The pig SCN5A gene has the DNA segment shown in SEQ ID NO: 9.

[0096] The present application also protects the use of the recombinant pig cell in preparing a pig model of arrhythmia.

[0097] The recombinant pig cell is used as a donor cell for somatic cell cloning, and a cloned pig, i.e., a pig model of arrhythmia, can be obtained.

[0098] The present application also protects the pig tissue of the model pig prepared using the recombinant pig cell, i.e., an arrhythmia tissue model.

[0099] The present application also protects the pig organ of the model pig prepared using the recombinant pig cell, i.e., an arrhythmia organ model.

[0100] The present application also protects a pig cell of a model pig prepared by using the recombinant pig cell, i.e. an arrhythmia cell model.

[0101] The present application also protects the use of the recombinant cell, the arrhythmia tissue model, the arrhythmia organ model, the arrhythmia cell model or the arrhythmia model pig for (d1) or (d2) or (d3) or (d4) as follows:

[0102] (d1) screening of drugs for treating arrhythmia;

[0103] (d2) performing efficacy evaluation of arrhythmia drugs;

[0104] (d3) performing efficacy evaluation of gene therapy and / or cell therapy for arrhythmia;

[0105] (d4) studying pathogenesis of arrhythmia.

[0106] The pig according to any of the above embodiments can be a Jiangxiang pig.

[0107] The pig according to any of the above embodiments can be a newborn Jiangxiang pig.

[0108] The pig according to any of the above embodiments can be a Bama pig.

[0109] The pig according to any of the above embodiments can be a newborn Bama pig.

[0110] Compared with the prior art, the present application has at least the following beneficial effects:

[0111] (1) The research object (pig) of the present application has better applicability than other animals (mice, primates).

[0112] Rodents such as mice are very different from humans in terms of body size, organ size, physiology, pathology, etc., and cannot truly simulate the normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are effective in mice are ineffective in human clinical trials. As for large animals, primates are the closest relatives of humans, but they are small in size, mature late (6-7 years old for mating), and are single-birth animals, with a very slow population expansion rate and high feeding costs. In addition, cloning of primates is low in efficiency, difficult and costly.

[0113] Pigs, as a model animal, do not have the above shortcomings. Pigs are the closest animals to humans except primates, and their body size, weight, organ size, and the like are similar to those of humans. Pigs are similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. Meanwhile, pigs mature early (4-6 months), have high reproductive capacity, and can form a large population in 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding costs are much lower than those of primates. Therefore, pigs are very suitable as a model animal for human diseases.

[0114] (2) The vector constructed by the application uses the strong promoter T7-lac capable of efficiently expressing the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic alkaline phosphatase (phoA) to guide the secretion expression of the target protein into the bacterial periplasmic cavity, so as to separate the target protein from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasmic cavity is soluble expression. Meanwhile, the Cas9 protein is expressed in fusion with the thioredoxin TrxA, and the TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability, folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein. Meanwhile, an enterokinase cleavage site is designed after the His tag, which facilitates the removal of the fused TrxA-His polypeptide fragment, and the Cas9 protein in a natural form is obtained. After the fusion protein is cleaved by the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed by one-step affinity chromatography, and the Cas9 protein in a natural form is obtained, avoiding the damage and loss of the target protein caused by multiple purifications and dialysis. Meanwhile, one NLS site is designed at the N- and C-termini of the Cas9, respectively, so that the Cas9 can more effectively enter the nucleus for gene editing. In addition, the E. coli BL21(DE3) is selected as the target protein expression strain, which can efficiently express the exogenous gene cloned in the expression vector (such as pET-32a) containing the bacteriophage T7 promoter. Meanwhile, the codon of the Cas9 protein is optimized to completely adapt to the codon bias of the expression strain, thereby improving the expression level of the target protein. In addition, the expression of the target protein is induced by IPTG at low temperature after the bacteria grow to a certain amount, which can avoid the influence of the premature expression of the target protein on the growth of the host bacteria, and the induction expression at low temperature also significantly improves the solubility of the expressed target protein. After the above optimization design and experimental implementation, the activity of the obtained Cas9 protein is significantly higher than that of the commercial Cas9 protein.

[0115] (3) The Cas9 high-efficiency protein complex constructed and expressed by the application is combined with gRNA of in vitro transcription to perform gene editing, and the optimal use amount and ratio of Cas9 and gRNA are optimized, and the synthesized ssODN is used as Donor DNA, and finally the single cell clone with target site mutation is obtained at a rate of 21.3%, which is much higher than the conventional point mutation efficiency (<5%).

[0116] (4) The single cell clone with target site mutation obtained by the application is used for somatic cell nuclear transfer animal cloning, and the cloned pig containing the target site mutation can be directly obtained, and the mutation can be stably inherited.

[0117] In the mouse model, the fertilized egg is microinjected with gene editing materials, and then embryo transfer is performed, and the probability of directly obtaining a point mutation offspring is very low (less than 1%), and hybrid breeding of offspring is required, which is not suitable for long gestation period of large animals (such as pigs) model making. Therefore, the application adopts the method of primary cell in vitro editing and ssODN homologous recombination and screening of positive editing single cell clones, which has high technical difficulty and challenge, and then the corresponding disease model pig is directly obtained through somatic cell nuclear transfer animal cloning technology, which can greatly shorten the model pig production cycle and save manpower, material resources and financial resources.

[0118] The application adopts the CRISPR / Cas9 technology combined with the ssODN homologous recombination technology to perform gene editing of the SCN5A gene, simulates the natural genetic characteristics of arrhythmia, and obtains the single cell clone with precise point mutation of the SCN5A gene, which lays a foundation for cultivating the arrhythmia model pig through the somatic cell nuclear transfer animal cloning technology in the later stage. The model pig will provide a powerful experimental tool for studying the pathogenesis of arrhythmia and drug research and development.

[0119] The application lays a solid foundation for obtaining the arrhythmia model pig with SCN5A gene mutation through gene editing means, which will help to study and reveal the pathogenesis of arrhythmia caused by SCN5A gene mutation, and can be used for drug screening, drug efficacy detection, gene therapy and cell therapy research, and can provide effective experimental data for further clinical application, and further provide a powerful experimental means for successfully treating human arrhythmia. The application has great application value for developing arrhythmia drugs and revealing the pathogenesis of the disease. BRIEF DESCRIPTION OF DRAWINGS

[0120] Figure 1 It is a structural schematic diagram of plasmid pET-32a.

[0121] Figure 2 It is a structural schematic diagram of plasmid pKG-GE4.

[0122] Figure 3Electrophoresis map for gRNA and NCN protein dosage optimization in Example 2.

[0123] Figure 4 Electrophoresis map for comparison of gene editing efficiency of NCN protein and commercial Cas9 protein in Example 2.

[0124] Figure 5 Electrophoresis map for PCR amplification using different primer pairs with genomic extracted from ear tissue of pig named BX4 as template in Example 3.

[0125] Figure 6 Electrophoresis map for PCR amplification using primer pair SCN5A-E11-JDF186 and SCN5A-E11-JDR593 with genomic DNA of 10 pigs as template in Example 3.

[0126] Figure 7 Alignment of forward sequencing of single cell clone No. 38 with SCN5A-mutant-ss153 sequence.

[0127] Figure 8 Alignment of forward sequencing of single cell clone No. 24 with SCN5A-mutant-ss153 sequence. DETAILED DESCRIPTION

[0128] The application will be further described in conjunction with the specific embodiments, and the examples given are only for the purpose of illustrating the application, but not for limiting the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0129] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified. The recombinant plasmids constructed in the examples have been sequenced and verified. Commercial Cas9-A protein is a commercially available Cas9 protein with good effect. Commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, 5% CO2, 5% O2 in a constant temperature incubator.

[0130] The porcine primary fibroblasts used in Example 2 were prepared from ear tissues of newborn Congjiang Xiang pigs. The porcine primary fibroblasts used in Examples 3 and 4 were both prepared from ear tissues of newborn Bama Xiang pigs. Method for preparing primary porcine fibroblasts from pig ear tissue: ① Remove 0.5 g of pig ear tissue, remove hair and bone tissue, and soak in 75% alcohol for 30-40 seconds. Wash five times with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco), followed by one wash with PBS buffer. ② Mince the tissue with scissors and digest with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 hour. Centrifuge at 500 g for 5 minutes and discard the supernatant. ③ Resuspend the pellet in 1 mL of complete culture medium and plate onto a 10 cm diameter cell culture dish sealed with 0.2% gelatin (VWR) containing 10 mL of complete culture medium. Culture until the cells reach approximately 60% of the bottom of the dish. ④ After completing step 3, trypsinize and harvest the cells, then resuspend them in complete culture medium for subsequent electroporation experiments.

[0131] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in the patent application 202010084343.6. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 395-680 constitute a CMV enhancer, the nucleotides 682-890 constitute an EFla promoter, the nucleotides 986-1006 encode a nuclear localization signal (NLS), the nucleotides 1016-1036 encode a nuclear localization signal (NLS), the nucleotides 1037-5161 encode a Cas9 protein, the nucleotides 5162-5209 encode a nuclear localization signal (NLS), the nucleotides 5219-5266 encode a nuclear localization signal (NLS), the nucleotides 5276-5332 encode a polypeptide P2A (the amino acid sequence of the polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, and the cleavage site is between the first and the second amino acid residues from the C terminus), the nucleotides 5333-6046 encode an EGFP protein, the nucleotides 6056-6109 encode a polypeptide T2A (the amino acid sequence of the polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the cleavage site is between the first and the second amino acid residues from the C terminus), the nucleotides 6110-6703 encode a Puromycin protein (referred to as Puro protein), the nucleotides 6722-7310 constitute a WPRE sequence element, the nucleotides 7382-7615 constitute a 3’LTR sequence element, and the nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 911-6706 form a fusion gene, which expresses a fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein with the Cas9 protein, a protein with the EGFP protein, and a protein with the Puro protein.

[0132] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in the patent application 202010084343.6. In SEQ ID NO: 3 in the patent application 202010084343.6, the nucleotides 2280-2539 constitute a hU6 promoter, and the nucleotides 2558-2637 are used for transcription to form a gRNA backbone. When used, a DNA molecule with a length of about 20 bp (a target sequence binding region used for transcription to form a gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain a gRNA.

[0133] Example 1, Preparation and purification of NCN protein

[0134] I. Construction of prokaryotic Cas9 high-efficiency expression vector

[0135] The schematic diagram of the structure of plasmid pET-32a is shown in Figure 1 .

[0136] Plasmid pKG-GE4 is obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4) is shown in SEQ ID NO: 1, which is a circular plasmid, and the schematic diagram of the structure is shown in Figure 2 .

[0137] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode a phoA signal peptide, nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag (also known as His6 tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode a spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for E. coli BL21 (DE3) strain.

[0138] The main modification of the plasmid pKG-GE4 is as follows: ① The coding region of the TrxA protein is retained, which can help the expressed target protein form disulfide bonds, increase the solubility and activity of the target protein; the coding sequence of the alkaline phosphatase signal peptide is added before the coding region of the TrxA protein, which can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cleaved by the prokaryotic periplasmic signal peptide enzyme; ② The coding sequence of His-Tag is added downstream of the coding sequence of TrxA protein, which can be used for enrichment of the expressed target protein; ③ The coding sequence of enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the coding sequence of His-Tag, and the purified protein will remove His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ The codon-optimized Cas9 gene suitable for expression in E. coli BL21 (DE3) strain is inserted, and the coding sequence of nuclear localization signal is added upstream and downstream of the gene to increase the nuclear localization ability of the purified Cas9 protein in the later stage.

[0139] The fusion gene in the plasmid pKG-GE4 is shown as nucleotides 5209-9852 in SEQ ID NO: 1, which encodes the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein for short). Due to the presence of alkaline phosphatase signal peptide and enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.

[0140] II. Inducing expression

[0141] 1. Introduce the plasmid pKG-GE4 into E. coli BL21 (DE3) to obtain a recombinant strain.

[0142] 2. Inoculate the recombinant strain obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin, and culture at 37°C with 200 rpm shaking overnight.

[0143] 3. Inoculate the bacterial solution obtained in step 2 into liquid LB medium, and culture at 30°C with 230 rpm shaking until the OD value = 1.0, then add isopropyl thiogalactoside (IPTG) to make its concentration in the system 0.5 mM, then culture at 25°C with 230 rpm shaking for 12 hours, then centrifuge at 4°C at 10000 g for 15 minutes, and collect the bacterial cells. 600nm

[0144] 4. Take the bacterial cells obtained in step 3, and wash with PBS buffer.

[0145] ​III. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0146] 1. Take the bacteria obtained in step 2, add crude extraction buffer and suspend the bacteria, then use a homogenizer to break the bacteria (1000 par cycles three times), then centrifuge at 4°C, 15000g for 30 min, collect the supernatant, and filter the supernatant with a 0.22 μm pore size filter membrane, collect the filtrate. In this step, 10 ml of crude extraction buffer is added per g of wet weight of bacteria. Crude extraction buffer: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, 1 mM PMSF, and the rest is ddH2O.

[0147] 2. Purify the fusion protein by affinity chromatography.

[0148] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate of 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate of 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate of 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate of 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, collect the post-column solution (90-100 ml).

[0149] Ni-NTA agarose column: Kingsway, L00250 / L00250-C, filler is 10 ml.

[0150] Equilibration buffer: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the rest is ddH2O.

[0151] Buffer: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, and the rest is ddH2O.

[0152] Eluent: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the rest is ddH2O.

[0153] IV. Enzymatic digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

[0154] 1. Take 15 ml of the solution collected after passing through the column in step three, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). A total of 6 ml is obtained using 6 ultrafiltration tubes.

[0155] 2. Add commercially sourced recombinant bovine enterokinase with His6 tag (Shenguo Biotech, C620031, recombinant bovine enterokinase light chain with His6 tag, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in step 1 (about 6 ml), and perform enzyme digestion at 25°C for 16 hours. Add 2 units of enterokinase for every 50 μg of protein.

[0156] 3. Take the solution after completing step 2 (about 6 ml), mix it with 480 μl of Ni-NTA resin (Genscript, L00250 / L00250-C), rotate it to mix at room temperature for 15 min, then centrifuge it at 7000 g for 3 min to collect the supernatant (4-5.5 ml).

[0157] 4. Take the supernatant obtained in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then add enzyme storage solution to adjust the protein concentration to 5 mg / ml, which is the NCN protein solution. Enzyme storage solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (by volume) glycerol, and the rest is ddH2O. Sequencing shows that the protein in the NCN protein solution has the N-terminal 15 amino acid residues shown in SEQ ID NO: 3, i.e., NCN protein.

[0158] The NCN protein used in the subsequent examples is provided by the NCN protein solution.

[0159] Example 2, Performance of NCN Protein

[0160] Two gRNA target sites targeting the TTN gene are selected as follows:

[0161] TTN-gRNA1 target site: AGAGCACAGTCAGCCTGGCG;

[0162] TTN-gRNA2 target site: CTTCCAGAATTGGATCTCCG.

[0163] The primers used to identify the target fragments containing the gRNA in the TTN gene are as follows:

[0164] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0165] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0166] I. Preparation of gRNA

[0167] 1. Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

[0168] TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0169] TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0170] 2. In vitro transcription of gRNA

[0171] Take TTN-T7-gRNA1 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification, to obtain TTN-gRNA1. TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0172] Take TTN-T7-gRNA2 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification, to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0173] II. Optimization of the ratio of gRNA to NCN protein dosage

[0174] 1. Co-transfection of porcine primary fibroblasts

[0175] Group 1: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.

[0176] Group 2: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.

[0177] Group 3: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0178] Group 4: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.

[0179] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0180] Co-transfection was performed by electroporation. Mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3 pulse) were used.

[0181] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0182] 3. After completing step 2, trypsinize and collect the cells, extract genomic DNA, perform PCR amplification using primer pair TTN-F55 and TTN-R560, and then perform 1% agarose gel electrophoresis.

[0183] The electrophoretogram is shown in Figure 3The 505 bp band is a wild type band (WT), and the band of about 254 bp (251 bp is theoretically deleted from the wild type band of 505 bp) is a deletion mutant band (MT).

[0184] The gene deletion mutation efficiency = (MT gray level / MT band bp number) / (WT gray level / WT band bp number + MT gray level / MT band bp number) x 100%. The first group of gene deletion mutation efficiency is 19.9%, the second group of gene deletion mutation efficiency is 39.9%, the third group of gene deletion mutation efficiency is 79.9%, and the fourth group of gene deletion mutation efficiency is 44.3%. The fifth group does not occur mutation.

[0185] The results show that when the mass ratio of two gRNAs to NCN protein is 1:1:4, and the actual amount used is 1 μg:1 μg:4 μg, the gene editing efficiency is the highest. Therefore, the optimal amount of two gRNAs and NCN protein is determined to be 1 μg:1 μg:4 μg.

[0186] III. Comparison of gene editing efficiency of NCN protein and commercial Cas9 protein

[0187] 1. Co-transfection of porcine primary fibroblasts

[0188] Cas9-A group: co-transfect TTN-gRNA1, TTN-gRNA2 and commercial Cas9-A protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-A protein.

[0189] pKG-GE4 group: co-transfect TTN-gRNA1, TTN-gRNA2 and NCN protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0190] Cas9-B group: co-transfect TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.

[0191] Control group: co-transfect TTN-gRNA1, TTN-gRNA2 into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0192] Co-transfection was performed by electroporation, using Neon kit (Thermofisher) and Neon TM transfection system (parameters: 1450V, 10ms, 3pulse).

[0193] 2. After step 1, the cells were cultured with complete medium for 12-18 hours, and then new complete medium was used for culture. The total culture time after electroporation was 48 hours.

[0194] 3. After step 2, the cells were trypsinized and collected, genomic DNA was extracted, and PCR amplification was performed using the primer pair TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0195] The electrophoretogram is shown in Figure 4 The gene deletion mutation efficiency of the commercial Cas9-A protein was 28.5%, the gene deletion mutation efficiency of the NCN protein was 85.6%, and the gene deletion mutation efficiency of the commercial Cas9-B protein was 16.6%.

[0196] The results show that, compared with the commercial Cas9 protein, the NCN protein prepared by the application can significantly improve the gene editing efficiency.

[0197] Example 3, screening of SCN5A gene high-efficiency gRNA target sites

[0198] Pig SCN5A gene information: encoding voltage-gated sodium ion channel α subunit 5; located on chromosome 13; Gene ID is 100152567, Sus scrofa. The protein encoded by the pig SCN5A gene is shown in NCBI XP_020927335.1 (13-MAY-2017). The partial segment amino acid sequence of the protein encoded by the pig SCN5A gene is shown in SEQ ID NO: 8. In the pig genomic DNA, the SCN5A gene has 27 exons, and the 11th coding exon and its upstream and downstream 100bp are shown in SEQ ID NO: 9.

[0199] I. Analysis of SCN5A gene pre-set mutation sites and adjacent genomic sequence conservation

[0200] 10 newborn Bama pigs, including 6 females (named BC1, BC2, BC3, BC4, BC5, BC6, respectively) and 4 males (named BX1, BX2, BX3, BX4, respectively).

[0201] SCN5A-E11-JDF186: AATCGCTTCAGCATCACCCA;

[0202] SCN5A-E11-JDR593: GGATCTGCCTGGCATAGCAT;

[0203] SCN5A-E11-JDF99: AAGTTGAGCTGGGGTGGATG;

[0204] SCN5A-E11-JDR457: CAGTCCACAGTGCTGTTCCT.

[0205] The genomic DNA of pig named BX4 was extracted as a template, and different primer pairs were used for PCR amplification, and then 1% agarose gel electrophoresis was performed. The electrophoresis map is shown in Figure 5 . Figure 5 Group 1: using the primer pair composed of SCN5A-E11-JDF99 and SCN5A-E11-JDR457; Group 2: using the primer pair composed of SCN5A-E11-JDF99 and SCN5A-E11-JDR593; Group 3: using the primer pair composed of SCN5A-E11-JDF186 and SCN5A-E11-JDR457; Group 4: using the primer pair composed of SCN5A-E11-JDF186 and SCN5A-E11-JDR593. The results show that the primer pair composed of SCN5A-E11-JDF186 and SCN5A-E11-JDR593 is preferably used for amplification of the target fragment.

[0206] The genomic DNA of 10 pigs was used as a template, and the primer pair composed of SCN5A-E11-JDF186 and SCN5A-E11-JDR593 was used for PCR amplification, and then 1% agarose gel electrophoresis was performed. The electrophoresis map is shown in Figure 6 . The PCR amplification product was recovered and sequenced, and the sequencing results were compared and analyzed with the SCN5A gene sequence in the public database. The conserved region common to 10 pigs was selected for gRNA target site design.

[0207] II. Screening of target sites

[0208] Through screening NGG (avoiding possible mutation sites), several target sites were preliminarily screened, and 4 target sites were further screened through pre-experiments.

[0209] The 4 target sites are as follows:

[0210] SCN5A-E11-gRNA1 target site: TGATGAAAACAGCACAGCAG;

[0211] SCN5A-E11-gRNA2 target site: ATGATGAAAACAGCACAGCA;

[0212] SCN5A-E11-gRNA3 target: GCACCAGCAGAGACGTGCGG;

[0213] SCN5A-E11-gRNA4 target: AAGGCACCAGCAGAGACGTG.

[0214] III. Preparation of recombinant plasmid

[0215] The plasmid pKG-U6gRNA was digested with restriction enzyme BbsI, and the vector skeleton (a linear large fragment of about 3 kb) was recovered.

[0216] SCN5A-E11-gRNA1-S and SCN5A-E11-gRNA1-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(SCN5A-E11-gRNA1). The plasmid pKG-U6gRNA(SCN5A-E11-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10 SCN5A-E11-gRNA1 .

[0217] sgRNA SCN5A-E11-gRNA1 (SEQ ID NO: 10):

[0218] UGAUGAAAACAGCACAGCAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0219] SCN5A-E11-gRNA2-S and SCN5A-E11-gRNA2-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(SCN5A-E11-gRNA2). The plasmid pKG-U6gRNA(SCN5A-E11-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11 SCN5A-E11-gRNA2 .

[0220] sgRNA SCN5A-E11-gRNA2 (SEQ ID NO: 11):

[0221] AUGAUGAAAACAGCACAGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0222] SCN5A-E11-gRNA3-S and SCN5A-E11-gRNA3-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (SCN5A-E11-gRNA3). Plasmid pKG-U6gRNA (SCN5A-E11-gRNA3) expresses the sgRNA shown in SEQ ID NO: 12 SCN5A-E11-gRNA3 .

[0223] sgRNA SCN5A-E11-gRNA3 (SEQ ID NO: 12):

[0224] GCACCAGCAGAGACGUGCGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0225] SCN5A-E11-gRNA4-S and SCN5A-E11-gRNA4-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (SCN5A-E11-gRNA4). Plasmid pKG-U6gRNA (SCN5A-E11-gRNA4) expresses the sgRNA shown in SEQ ID NO: 13 SCN5A-E11-gRNA4 .

[0226] sgRNA SCN5A-E11-gRNA4 (SEQ ID NO: 13):

[0227] AAGGCACCAGCAGAGACGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0228] SCN5A-E11-gRNA1-S:caccgTGATGAAAACAGCACAGCAG;

[0229] SCN5A-E11-gRNA1-S: caccgCTGCTGTGCTGTTTTCATCA

[0230] SCN5A-E11-gRNA2-S: caccgATGATGAAAACAGCACAGCA

[0231] SCN5A-E11-gRNA2-A: aaacTGCTGTGCTGTTTTCATCATc

[0232] SCN5A-E11-gRNA3-S: caccGCACCAGCAGAGACGTGCGG

[0233] SCN5A-E11-gRNA3-A: aaacCCGCACGTCTCTGCTGGTGC

[0234] SCN5A-E11-gRNA4-S: caccgAAGGCACCAGCAGAGACGTG

[0235] SCN5A-E11-gRNA4-A: aaacCACGTCTCTGCTGGTGCCTTc

[0236] SCN5A-E11-gRNA1-S, SCN5A-E11-gRNA1-A, SCN5A-E11-gRNA2-S, SCN5A-E11-gRNA2-A, SCN5A-E11-gRNA3-S, SCN5A-E11-gRNA3-A, SCN5A-E11-gRNA4-S, SCN5A-E11-gRNA4-A are all single-stranded DNA molecules.

[0237] IV. Comparison of editing efficiency of different target sites

[0238] 1. Co-transfection

[0239] The first group: co-transfecting plasmid pKG-U6gRNA (SCN5A-E11-gRNA1) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SCN5A-E11-gRNA1): 1.08 μg of plasmid pKG-GE3.

[0240] The second group: the plasmid pKG-U6gRNA(SCN5A-E11-gRNA2) and the plasmid pKG-GE3 were co-transfected into the porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of the plasmid pKG-U6gRNA(SCN5A-E11-gRNA2): 1.08 μg of the plasmid pKG-GE3.

[0241] The third group: the plasmid pKG-U6gRNA(SCN5A-E11-gRNA3) and the plasmid pKG-GE3 were co-transfected into the porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of the plasmid pKG-U6gRNA(SCN5A-E11-gRNA3): 1.08 μg of the plasmid pKG-GE3.

[0242] The fourth group: the plasmid pKG-U6gRNA(SCN5A-E11-gRNA4) and the plasmid pKG-GE3 were co-transfected into the porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of the plasmid pKG-U6gRNA(SCN5A-E11-gRNA4): 1.08 μg of the plasmid pKG-GE3.

[0243] The fifth group: the porcine primary fibroblasts were subjected to the electroporation without the plasmid under the same electroporation parameters.

[0244] The co-transfection was performed by the electroporation, and the mammalian nucleic acid transfection kit (Neon kit, Thermofisher) and the Neon TM transfection system electroporator (the parameters were set as: 1450V, 10ms, 3pulse) were used.

[0245] 2. After step 1 was completed, the cells were cultured with the complete culture solution for 12-18 hours, and then new complete culture solution was used for the culture. The total culture time after the electroporation was 48 hours.

[0246] 3. After step 2 was completed, the cells were trypsinized and collected, the cells were lysed, the genomic DNA was extracted, the primer pair composed of SCN5A-E11-JDF186 and SCN5A-E11-JDR593 was used for the PCR amplification, and then 1% agarose gel electrophoresis was performed. The target product was cut and recovered, and then sent to a sequencing company for sequencing. Then the sequencing results were analyzed by using the web-based Synthego ICE tool to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first group to the fourth group were 74%, 79%, 85%, and 75%, respectively, and the gene editing did not occur in the fifth group. The results showed that the editing efficiencies of SCN5A-E11-gRNA2 and SCN5A-E11-gRNA3 were higher.

[0247] Example 4, Preparation of recombinant cells with SCN5A gene directed mutation

[0248] Two high efficiency gRNA target points (SCN5A-E11-gRNA2 and SCN5A-E11-gRNA3) screened in Example 3 were selected.

[0249] I. Preparation of gRNA

[0250] 1. Preparation of SCN5A-T7-gRNA2 transcription template and SCN5A-T7-gRNA3 transcription template

[0251] SCN5A-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.

[0252] SCN5A-T7-gRNA3 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.

[0253] 2. In vitro transcription of gRNA

[0254] SCN5A-T7-gRNA2 transcription template was taken, and Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) was used for in vitro transcription, then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification, and SCN5A-gRNA2 was obtained. SCN5A-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 16.

[0255] SCN5A-T7-gRNA3 transcription template was taken, and Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) was used for in vitro transcription, then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification, and SCN5A-gRNA3 was obtained. SCN5A-gRNA3 is a single-stranded RNA, as shown in SEQ ID NO: 17.

[0256] SCN5A-gRNA2 (SEQ ID NO: 16):

[0257] GGGACCAGCAGAGACGUGCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0258] SCN5A-gRNA3 (SEQ ID NO: 17):

[0259] GGGCACCAGCAGAGACGUGCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0260] II. Synthesis of single-stranded Donor DNA with SCN5A gene mutation

[0261] SCN5A gene mutation associated with arrhythmia (the codon GAG encoding the 558th amino acid residue E in SCN5A gene is mutated to stop codon TAG), corresponding to the 11th exon of pig SCN5A gene.

[0262] Synthesis of single-stranded Donor DNA, which contains synonymous mutation of the 3' end sequence of the PAM or adjacent PAM of SCN5A-E11-gRNA2 and SCN5A-E11-gRNA3 in addition to the above-mentioned point mutation (G is mutated to T). The single-stranded Donor DNA is named SCN5A-mutant-ss153.

[0263] SCN5A-mutant-ss153 is shown as SEQ ID NO: 18.

[0264] SCN5A-mutant-ss153 (SEQ ID NO: 18):

[0265] ttttcaccttccgccggcgagacctgggttccgaaacagattttgcggatgatgaaaacagcacagcTggAgacagcTagagTcaccgcacgtctctgctggtgccttggcccctgcgccggcctagtgtccagggacagcccagtcccggag

[0266] The DNA segment corresponding to the single-stranded Donor DNA in the wild-type pig primary fibroblast chromosomal DNA is shown as SEQ ID NO: 19.

[0267] SEQ ID NO: 19

[0268] ttttcacctt ccgccggcga gacctgggtt ccgaaacaga ttttgcgg atgatgaaaacagcacagca ggggacagcg agagcca ccgcacgtctctgctggtgc cttggcccct gcgccggcct agtgtccagg gacagcccag tcccggag

[0269] III. Transfection of porcine primary fibroblasts

[0270] 1. Co-transfect SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 pg SCN5A-gRNA2: 1 pg SCN5A-gRNA3: 2 pg SCN5A-mutant-ss153: 4 pg NCN protein. Co-transfection is performed by electroporation, using the Neon kit (Thermofisher) and the Neon TM transfection system electroporator (parameters set at: 1450V, 10ms, 3 pulses).

[0271] 2. After step 1 is completed, use complete culture medium to culture for 16-18 hours, then replace the new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0272] 3. After step 2 is completed, use trypsin to digest and collect the cells, then wash with complete culture medium, then resuspend with complete culture medium, then pick up each monoclonal and transfer to a 96-well plate (1 cell per well, each well contains 100 pl of complete culture medium), and culture for 2 weeks (replace the new complete culture medium every 2-3 days).

[0273] 4. After step 3 is completed, use trypsin to digest and collect the cells (the cells obtained in each well, about 2 / 3 are inoculated into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0274] 5. Take the 6-well plate of step 4, culture until the cells reach 80% confluence, use trypsin to digest and collect the cells, and use cell freezing solution (90% complete culture medium + 10% DMSO, by volume) to freeze the cells.

[0275] 6. Take the centrifuge tube from step 4, remove the cells, lyse the cells, and extract genomic DNA. Perform PCR amplification using the primer pair consisting of SCN5A-E11-JDF186 and SCN5A-E11-JDR593, followed by electrophoresis. Use primary porcine fibroblasts as a wild-type control (WT).

[0276] 7. After completing step 6, recover the PCR amplification product and sequence it.

[0277] There is only one sequencing result for primary porcine fibroblasts, and its genotype is wild type (also known as homozygous wild type). If a single-cell clone has two sequencing results, one of which is consistent with the sequencing result of primary porcine fibroblasts and the other has a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is heterozygous; if a single-cell clone has two sequencing results, both of which have a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is biallelic different mutation type; if a single-cell clone has one sequencing result and has a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is biallelic identical mutation type; if a single-cell clone has one sequencing result and is consistent with the sequencing result of primary porcine fibroblasts, the genotype of the single-cell clone is wild type (also known as homozygous wild type).

[0278] The results are shown in Table 1. The genotype of single-cell clone numbered 42 was wild-type. The genotype of single-cell clones numbered 9, 11, 16, 17, 25, 26, 28, 33, 38, 39, 40, 41, 44, and 46 was heterozygous. The genotype of single-cell clones numbered 2, 3, 4, 5, 6, 7, 8, 10, 21, 22, 34, 37, 45, and 47 was biallelic with different mutations. The genotype of single-cell clones numbered 1, 12, 13, 14, 15, 18, 19, 20, 23, 24, 27, 29, 30, 31, 32, 35, 36, and 43 was biallelic with identical mutations. The rate of obtaining SCN5A gene-edited single-cell clones was 97.9%.

[0279] The single cell clone numbered 38, 44 is heterozygous mutant at the target site (i.e. one of the two homologous chromosomes is replaced by the single-stranded Donor DNA, and the other is wild type). The single cell clone numbered 3, 4, 5, 8, 34, 37 is double heterozygous mutant at the target site (i.e. one of the two homologous chromosomes is replaced by the single-stranded Donor DNA, and the other is mutated in other ways). The single cell clone numbered 24, 30 is double homozygous mutant at the target site (i.e. both of the two homologous chromosomes are replaced by the single-stranded Donor DNA). The ratio of the single cell clone with the target site mutation (i.e. the single cell clone numbered 3, 4, 5, 8, 24, 30, 34, 37, 38, 44) is 21.3%.

[0280] An exemplary sequencing alignment result is shown in Figure 7 and Figure 8 . Figure 7 is the alignment result of the forward sequencing of the single cell clone numbered 38 and the sequence of SCN5A-mutant-ss153, which is heterozygous mutant at the target site. Figure 8 is the alignment result of the forward sequencing of the single cell clone numbered 24 and the sequence of SCN5A-mutant-ss153, which is double homozygous mutant at the target site.

[0281] Table 1 Genotype determination results of the single cell clones of SCN5A gene editing

[0282]

[0283]

[0284] Note: The target site mutation refers to the replacement of the single-stranded Donor DNA; i.e. the DNA molecule shown in SEQ ID NO: 18 replaces the DNA molecule shown in SEQ ID NO: 19 in the chromosomal DNA.

[0285] The single cell clone with double homozygous mutant at the target site (i.e. both of the two homologous chromosomes are replaced by the single-stranded Donor DNA), i.e. the single cell clone numbered 24, 30 in Table 1, is the target single cell clone. The target single cell clone is used as a nuclear transfer donor cell for somatic cloning, and a cloned pig, i.e. an arrhythmia model pig, can be obtained.

[0286] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a specific example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. A method for preparing a recombinant pig cell, comprising the steps of: replacing the DNA molecule of SEQ ID NO: 19 in the chromosomal DNA of the pig cell with the DNA molecule of SEQ ID NO: 18 to obtain a recombinant pig cell; Replacing the DNA molecule of SEQ ID NO: 19 in the chromosomal DNA of the pig cell with the DNA molecule of SEQ ID NO: 18 is achieved by co-transfecting SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153, and NCN protein into the pig cell; the SCN5A-gRNA2 is a sgRNA whose target sequence binding region is represented by nucleotides 3-22 of SEQ ID NO: 16; the SCN5A-gRNA3 is a sgRNA whose target sequence binding region is represented by nucleotides 3-22 of SEQ ID NO: 17; and the SCN5A-mutant-ss153 is a single-stranded DNA molecule represented by SEQ ID NO: 18; The NCN protein is shown in SEQ ID NO: 3; The preparation method of the NCN protein comprises the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria; (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria; (3) crushing the collected bacteria and collecting the crude protein solution; (4) purifying the His6-tagged fusion protein from the crude protein solution using affinity chromatography; (5) The His6-tagged fusion protein was cleaved with enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein; The plasmid pKG-GE4 is shown in SEQ ID NO:

1.

2. The method according to claim 1, wherein: The ratios of pig cells, SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153 and NCN protein are as follows: 100,000 pig cells: 0.8-1.2μg SCN5A-gRNA2: 0.8-1.2μg SCN5A-gRNA3: 1.8-2.2μg SCN5A-mutant-ss153: 3-5μg NCN protein.

3. A kit comprising SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153, and NCN protein; SCN5A-gRNA2 is the SCN5A-gRNA2 described in claim 1; SCN5A-gRNA3 is the SCN5A-gRNA3 described in claim 1; SCN5A-mutant-ss153 is the SCN5A-mutant-ss153 described in claim 1; NCN protein is the NCN protein described in claim 1; The purpose of the kit is as follows (a) or (b) or (c): (a) preparing recombinant pig cells; (b) preparing arrhythmia model pigs; (c) preparing an arrhythmia cell model or an arrhythmia tissue model or an arrhythmia organ model.

4. Use of SCN5A-gRNA2, SCN5A-gRNA3, SCN5A-mutant-ss153, and NCN protein in preparing kits; SCN5A-gRNA2 is the SCN5A-gRNA2 described in claim 1; SCN5A-gRNA3 is the SCN5A-gRNA3 described in claim 1; SCN5A-mutant-ss153 is the SCN5A-mutant-ss153 described in claim 1; NCN protein is the NCN protein described in claim 1; The purpose of the kit is as follows (a) or (b) or (c): (a) preparing recombinant pig cells; (b) preparing arrhythmia model pigs; (c) preparing an arrhythmia cell model or an arrhythmia tissue model or an arrhythmia organ model.

Images