High efficiency sequencing library construction method, primer set and kit

By using a primer set consisting of three primers for two rounds of PCR amplification, the problems of low efficiency and high cost in amplicon sequencing library construction were solved, achieving more efficient and lower-cost amplicon sequencing library construction, while improving library coverage and uniformity and avoiding cross-contamination between samples.

CN116064753BActive Publication Date: 2026-04-14SHENZHEN UNI MEDICA TECH
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2018-08-28
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing methods for constructing amplicon sequencing libraries are inefficient, costly, have poor library coverage and uniformity, and are prone to cross-contamination between samples.

Method used

Two rounds of PCR amplification were performed using a primer set consisting of three primers. In the first round of PCR, sample tags and sequencing adapter sequences were introduced, and all sample amplification products were merged. In the second round of PCR, sequencing adapters were added to simplify the operation and improve coverage and uniformity.

Benefits of technology

It significantly reduced reagents and workload, lowered costs, improved PCR amplification efficiency, constructed amplicon sequencing libraries with better coverage and uniformity, and avoided cross-contamination between samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064753B_ABST
    Figure CN116064753B_ABST
Patent Text Reader

Abstract

The application describes a high-efficiency sequencing library construction method, primer set and kit, the construction method comprising: obtaining DNA of multiple samples; performing first PCR amplification on the DNA of each sample by using a first primer, a second primer and a third primer; combining the amplification products of the multiple samples into one tube; performing second PCR amplification on the combined amplification products by using a fourth primer and a fifth primer to obtain a sequencing library; the first primer is a first sequencing tag sequence and an amplicon-specific forward primer; the second primer is a second sequencing tag sequence and an amplicon-specific reverse primer; the third primer is a second sequencing adapter sequence, a sample tag sequence and a second sequencing tag sequence; the sample tag sequence is used for marking different samples; the fourth primer is a first sequencing adapter sequence and a first sequencing tag sequence; and the fifth primer is a second sequencing adapter sequence. According to the application, a high-efficiency sequencing library construction method, primer set and kit can be provided.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application was filed on [date]. August 28, 2018 Application number is 201810986265.1 The invention is named Amplification Methods for constructing subsequent sequencing libraries, primer sets, and kits A divisional application of the patent application. Technical Field

[0002] This invention belongs to the field of gene sequencing technology, specifically relating to a method for constructing a high-efficiency sequencing library, as well as primer sets and reagent kits. Background Technology

[0003] With the surge in information throughput in recent years, high-throughput sequencing technology has become increasingly widely used in life sciences and medicine, playing a particularly important role in disease diagnosis and prevention. This is mainly reflected in prenatal screening, tumor diagnosis, prevention of major diseases, and health-related metagenomic analysis. Although whole-genome sequencing has made significant strides in terms of sequencing time and cost, the massive data analysis and extraction of genetic information remain time-consuming and labor-intensive. In comparison, whole-exome sequencing and gene panel sequencing directly target most gene sequences that may cause diseases. Amplicon sequencing, with its stronger targeting, rapid data analysis, and lower cost, is more advantageous for clinical disease detection. For example, as a second-line test for newborn screening, using the Illumina second-generation high-throughput sequencing platform to perform deep sequencing of certain genes associated with congenital metabolic diseases in newborn samples can sensitively detect newborns carrying congenital diseases before or when clinical symptoms appear. Through screening, early diagnosis and treatment can be achieved, preventing irreversible damage to body tissues and organs.

[0004] Polymerase chain reaction (PCR) is a widely used technique in molecular genetics and diagnostics, used to amplify specific DNA fragments; it can be viewed as a special form of DNA replication outside of a living organism. The most significant characteristic of PCR is its ability to dramatically increase trace amounts of DNA in a sample to a detectable level. Amplicon sequencing, on the other hand, sequences PCR products or captured fragments of a specific length. Due to its low cost and ease of operation, multiplex PCR is an important technique for enriching target regions. For capturing target regions in large quantities of complex genomic samples, multiplex PCR has become the preferred technique due to its high specificity, low cost, and good reproducibility.

[0005] Currently, amplicon library construction based on the Illumina sequencing platform mainly adopts the traditional two-step amplification library construction method, which involves two rounds of PCR using two pairs of primers. Although the two-step amplification method with two pairs of primers can be directly sequenced using Illumina's compatible reagents, it is cumbersome when the sample volume is large. Furthermore, the lack of sample tags during the first round of amplification makes subsequent operations cumbersome and prone to cross-contamination between samples. The commonly used two-round PCR amplicon library construction method has several drawbacks. First, it requires separate library construction for each sample, making it impossible to merge and process large batches of samples. This process is cumbersome, inefficient, and prone to cross-contamination. Second, in multiplex PCR, as the number of primer pairs increases, primer dimers and non-specific amplification products increase dramatically, leading to significant differences in copy numbers of different target fragments and making it impossible to obtain uniform products. Third, the library construction primers used include common sequences, requiring the synthesis of not only a large number of specific primers but also an equal amount of common sequences, resulting in high costs. Furthermore, the excessively long primer sequences reduce PCR amplification efficiency, affecting the coverage and uniformity of the library. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned shortcomings of the prior art and provide a method for constructing an amplicon sequencing library, as well as a primer set and kit, aiming to solve the technical problems of low efficiency, high cost, and poor coverage and uniformity of the library in the existing two-step amplicon library construction method.

[0007] To achieve the above-mentioned objectives, the technical solution adopted by the present invention is as follows:

[0008] This invention provides a method for constructing an amplicon sequencing library, comprising the following steps:

[0009] Obtain sample DNA;

[0010] The sample DNA was amplified by first PCR using the first primer, second primer, and third primer to obtain the amplification product;

[0011] The amplification product was amplified by a second PCR using the fourth and fifth primers to obtain an amplicon sequencing library;

[0012] in,

[0013] The first primer consists of a first sequencing tag sequence and an amplicon-specific forward primer, from the 5' end to the 3' end.

[0014] The second primer consists of a second sequencing tag sequence and an amplicon-specific reverse primer, from the 5' end to the 3' end.

[0015] The third primer consists of the second sequencing adapter sequence, the sample tag sequence, and the second sequencing tag sequence, from the 5' end to the 3' end, respectively.

[0016] The fourth primer consists of the first sequencing adapter sequence and the first sequencing tag sequence from the 5' end to the 3' end;

[0017] The fifth primer is the second sequencing adapter sequence.

[0018] The amplicon sequencing library construction method provided by this invention first extracts sample DNA, and then performs two rounds of PCR amplification using the primer set designed in this invention. In the two rounds of PCR amplification: a first round of PCR is performed using the first, second, and third primers to obtain all amplicon fragments. During this process, a first sequencing tag sequence is added to the 5' end of all amplicon fragments from different sample sources, and a second sequencing tag sequence, a sample tag sequence, and a second sequencing adapter sequence are sequentially added to the 3' end. Because the sample tag sequence can label different samples, the amplification products of all samples can be combined into one tube after the first round of PCR amplification. Then, using the purified product from the first round of PCR as a template, a second round of PCR is performed using the fourth and fifth primers, adding the first sequencing adapter sequence to the 5' end of the first round of PCR amplification product, thereby completing the construction of the amplicon sequencing library. This construction method can greatly save reagents and workload, reduce costs, and the amplification efficiency of both rounds of PCR is very high. The final constructed amplicon sequencing library has better coverage and uniformity.

[0019] Another aspect of the present invention provides a primer set for constructing an amplicon sequencing library, the primer set comprising: a first primer, a second primer, and a third primer for a first PCR amplification, and a fourth primer and a fifth primer for a second PCR amplification; wherein,

[0020] The first primer consists of a first sequencing tag sequence and an amplicon-specific forward primer, from the 5' end to the 3' end.

[0021] The second primer consists of a second sequencing tag sequence and an amplicon-specific reverse primer, from the 5' end to the 3' end.

[0022] The third primer consists of the second sequencing adapter sequence, the sample tag sequence, and the second sequencing tag sequence, from the 5' end to the 3' end, respectively.

[0023] The fourth primer consists of the first sequencing adapter sequence and the first sequencing tag sequence from the 5' end to the 3' end;

[0024] The fifth primer is the second sequencing adapter sequence.

[0025] The primer set provided by this invention for constructing amplicon sequencing libraries comprises a first primer, a second primer, and a third primer for first PCR amplification, and a fourth primer and a fifth primer for second PCR amplification. When used for amplicon sequencing library construction, during the first round of PCR amplification, the uniquely structured three primers (first primer, second primer, and third primer) add a first sequencing tag sequence to the 5' end of all amplicon target fragments, and sequentially add a second sequencing tag, a sample tag sequence, and a second sequencing adapter sequence to the 3' end. Because the sample tag sequence can label different samples, after the first PCR amplification, the amplification products of all samples can be combined into one tube, and then the fourth and fifth primers can be used directly for the second PCR amplification to complete the construction of the sequencing library. This method significantly saves reagents and reduces workload. Furthermore, the second sequencing adapter sequence, sample tag sequence, and second sequencing tag sequence in the third primer are separate from the amplicon primers (i.e., amplicon-specific forward primers and amplicon-specific reverse primers). This makes the use of the third primer more flexible. When detecting N amplicones in a sample, N pairs of specific primers (i.e., the first and second primers) are needed, but only one third primer is required, meaning only 2N+1 primers need to be synthesized. Therefore, when the number of amplicones and the sample size are large, the primer set used for library construction in this invention will greatly reduce the cost of primer synthesis. Moreover, the primers in this primer set can be shorter than existing primers, which can further improve PCR amplification efficiency and allow the construction of amplicon sequencing libraries with better coverage and uniformity.

[0026] Finally, the present invention also provides a kit for constructing amplicon sequencing libraries, the kit comprising the primer set described above.

[0027] The kit of this invention contains a primer set unique to this invention. When constructing amplicon sequencing libraries using this kit, reagents and workload can be saved, costs can be reduced, and PCR amplification efficiency can be further improved, resulting in the construction of amplicon sequencing libraries with better coverage and uniformity. Attached Figure Description

[0028] Figure 1 This is a schematic diagram of the construction process of the amplicon sequencing library of the present invention;

[0029] Figure 2 The graph shows the amplicon sequencing depth results of Example 1 of the present invention, where the horizontal axis represents the uniform sequencing depth (the median of the actual sequencing depth divided by the amplicon depth), and the vertical axis represents the proportion of amplicon sequencing depths greater than or equal to that sequencing depth. Detailed Implementation

[0030] To make the technical problem to be solved, the technical solution, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the present invention.

[0031] It should be noted that the terms "first" and "second" are used only to describe the purpose of the invention and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the invention, "a plurality of" means two or more, unless otherwise explicitly specified.

[0032] On one hand, embodiments of the present invention provide a method for constructing an amplicon sequencing library, comprising the following steps:

[0033] S01: Obtain sample DNA;

[0034] S02: The sample DNA is amplified by first PCR using the first primer, second primer and third primer to obtain the amplification product;

[0035] S03: The amplification product was amplified by a second PCR using the fourth and fifth primers to obtain an amplicon sequencing library;

[0036] in,

[0037] The first primer consists of a first sequencing tag sequence and an amplicon-specific forward primer, from the 5' end to the 3' end.

[0038] The second primer consists of a second sequencing tag sequence and an amplicon-specific reverse primer, from the 5' end to the 3' end.

[0039] The third primer consists of the second sequencing adapter sequence, the sample tag sequence, and the second sequencing tag sequence, from the 5' end to the 3' end, respectively.

[0040] The fourth primer consists of the first sequencing adapter sequence and the first sequencing tag sequence from the 5' end to the 3' end;

[0041] The fifth primer is the second sequencing adapter sequence.

[0042] In the amplicon sequencing library construction method provided in this embodiment of the invention, sample DNA is first extracted, and then two rounds of PCR amplification are performed using the primer set designed in this embodiment. In the two rounds of PCR amplification: a first round of PCR is performed using the first, second, and third primers to obtain all amplicon fragments. During this process, a first sequencing tag sequence is added to the 5' end of all amplicon fragments from different sample sources, and a second sequencing tag sequence, a sample tag sequence, and a second sequencing adapter sequence are sequentially added to the 3' end. Because the sample tag sequence can label different samples, the amplification products of all samples can be combined into one tube after the first PCR amplification. Then, using the purified product from the first round of PCR as a template, a second round of PCR is performed using the fourth and fifth primers, adding the first sequencing adapter sequence to the 5' end of the first round of PCR amplification product, thereby completing the amplicon sequencing library construction. This construction method can greatly save reagents and workload, reduce costs, and the amplification efficiency of both rounds of PCR is very high. The final constructed amplicon sequencing library has better coverage and uniformity.

[0043] Existing amplicon sequencing library construction uses two pairs of primers. The first round of PCR amplification uses primers consisting of a sequencing tag sequence and amplicon-specific primers. When multiple samples need to be tested simultaneously, such as 96 samples, each sample needs to be purified individually using magnetic beads after the first round of PCR. When the purified product is used for the second round of PCR, 96 reaction systems need to be prepared, and the template added one by one. This means that subsequent magnetic bead purification and the second round of PCR require processing multiple samples, essentially building a library for each sample separately. This requires a lot of repetitive work, is cumbersome, and consumes a lot of reagents. However, in the embodiment of this invention, during the first round of PCR, as shown... Figure 1 As shown, all samples were given the same first sequencing tag sequence, second sequencing tag sequence, and second sequencing adapter sequence. Different sample tag sequences were added to the 3' end of the target fragment in different samples. The identical first and second sequencing tag sequences facilitated the addition of the sequencing adapter in the second round of PCR using a pair of primers (fourth and fifth primers). After the first round of PCR amplification, the PCR products of all samples could be combined into one tube for purification. This avoided human error, differences in PCR instrument well positions, and potential cross-contamination between samples, resulting in a more accurate and effective reflection of the sample test results. Furthermore, it saved on the amount of magnetic beads used, simplifying the purification of 96 samples to just one, significantly reducing workload. Simultaneously, the purified product could be used as a single sample for the second round of PCR, meaning the second round of PCR could be completed with only one sample's reaction system, further saving reagents and reducing workload.

[0044] Furthermore, in step S01 above, the sample DNA can come from genomic DNA samples of various organisms, such as human blood, saliva and tissues, and the final weight of each sample DNA can be 200-300 ng.

[0045] Further, in step S03 above, the sample DNA is subjected to a first PCR amplification at a molar ratio of 3:1:3 for the first primer, the second primer, and the third primer. Under these conditions, the amplification efficiency can be improved. In this embodiment of the invention, the first PCR amplification is a multiplex PCR amplification. The purpose of using these three primers for the first round of PCR is to obtain a specific amplicon fragment with a first sequencing tag sequence at the 5' end and a second sequencing tag sequence, a sample tag sequence (Index), and a second sequencing adapter sequence at the 3' end. The amplification process is as follows: First, the first primer and the second primer amplify the sample DNA as a template to obtain a specific amplicon intermediate product with a first sequencing tag sequence at the 5' end and a second sequencing tag sequence at the 3' end (this intermediate product is not our target product); then, the first primer and the third primer amplify the target fragment using this specific amplicon intermediate product as a template. It is evident that the first primer is consumed the most during this reaction. Furthermore, due to the random nature of PCR amplification, intermediate products are generated that are only amplified by the first and second primers. Therefore, to ensure that as many intermediate products as possible are converted into the target fragment, the concentrations of the first and third primers need to be increased to promote the reaction. On the other hand, we verified and compared different primer concentration ratios (e.g., "2:1:2", "3:1:3", "5:1:5", and "10:1:10"), and the results showed that when the sample DNA was amplified using a molar ratio of 3:1:3 for the first primer, second primer, and third primer, the proportion of the amplified target fragment was the largest, and the amplification efficiency was the highest.

[0046] Furthermore, after the first PCR amplification step, a first magnetic bead purification step is included. Preferably, purification is performed twice using AMPure XP Beads. After the second PCR amplification step, a second magnetic bead purification step is included, preferably, purification is performed once using AMPure XP Beads.

[0047] Furthermore, in the first PCR amplification step, annealing and extension are combined into one step, and three annealing temperatures are set in each cycle, which can further improve the coverage of the amplicon sequencing library.

[0048] Depending on the number of amplicones, multiple pairs of amplicon-specific forward primers and amplicon-specific reverse primers can be designed. Therefore, the first PCR can be an ultra-high multiplex PCR reaction targeting multiple amplicones (up to hundreds, such as over six hundred amplicones), meaning the reaction system contains over six hundred pairs of specific primers. Different primers have different annealing temperatures. Setting three gradient annealing temperatures allows each primer to find the template at its optimal annealing temperature, thus increasing amplification efficiency. Simultaneously, combining annealing and extension in one step extends the annealing / extension time, allowing more primers to match the corresponding template and achieving effective extension. Preferably, in a preferred embodiment, three parallel gradient annealing temperatures can be selected within the range of 58-62℃. In this embodiment, annealing temperatures of 62℃, 60℃, and 58℃ are preferred, resulting in the best coverage of the final amplicon sequencing library.

[0049] On the other hand, embodiments of the present invention also provide a primer set for constructing an amplicon sequencing library, the primer set comprising: a first primer, a second primer, and a third primer for a first PCR amplification, and a fourth primer and a fifth primer for a second PCR amplification; wherein,

[0050] The first primer consists of a first sequencing tag sequence and an amplicon-specific forward primer, from the 5' end to the 3' end.

[0051] The second primer consists of a second sequencing tag sequence and an amplicon-specific reverse primer, from the 5' end to the 3' end.

[0052] The third primer consists of the second sequencing adapter sequence, the sample tag sequence, and the second sequencing tag sequence, from the 5' end to the 3' end, respectively.

[0053] The fourth primer consists of the first sequencing adapter sequence and the first sequencing tag sequence from the 5' end to the 3' end;

[0054] The fifth primer is the second sequencing adapter sequence.

[0055] The primer set for amplicon sequencing library construction provided in this embodiment of the invention comprises a first primer, a second primer, and a third primer for first PCR amplification, and a fourth primer and a fifth primer for second PCR amplification. When this primer set is used for amplicon sequencing library construction, during the first round of PCR amplification, the three primers (first primer, second primer, and third primer) with this unique structure add a first sequencing tag sequence to the 5' end of all amplicon target fragments, and add a second sequencing tag sequence, a sample tag sequence, and a second sequencing adapter sequence sequentially connected to the 3' end. Because the sample tag sequence can label different samples, after the first PCR amplification, the amplification products of all samples can be combined into one tube, and then the fourth primer and the fifth primer can be used directly for the second PCR amplification to complete the sequencing library construction. This method significantly saves reagents and reduces workload. Furthermore, the second sequencing adapter sequence, sample tag sequence, and second sequencing tag sequence in the third primer are separate from the amplicon primers (i.e., amplicon-specific forward primers and amplicon-specific reverse primers). This makes the use of the third primer more flexible. When detecting N amplicons in a sample, N pairs of specific primers (i.e., the first and second primers) are needed, but only one third primer is required, meaning only 2N+1 primers need to be synthesized. Therefore, when the number of amplicons and the sample size are large, the primer set used for library construction in this embodiment of the invention will greatly reduce the cost of primer synthesis. Moreover, the primers in this primer set can be shorter than existing primers, which can further improve PCR amplification efficiency and allow the construction of amplicon sequencing libraries with better coverage and uniformity.

[0056] Specifically, in the primer set of this embodiment, the amplicon-specific forward primer and the amplicon-specific reverse primer are specific primers designed based on the amplicon sequence and can specifically bind to the amplicon; the sample tag sequence (i.e., the index) is formed by different arrangements of bases, and different samples correspond to different sample tag sequences, that is, the sample tag sequence has a unique correspondence with the sample. The first sequencing tag sequence and the second sequencing tag sequence, the first sequencing adapter sequence and the second sequencing adapter sequence are the sequences used during sequencing.

[0057] Preferably, the first and second sequencing adapter sequences in this embodiment of the invention are Illumina sequencing platform adapter sequences P5 and P7, respectively. Specifically, the first sequencing adapter sequence (P5) is shown in SEQ ID NO.1, and the second sequencing adapter sequence (P7) is shown in SEQ ID NO.2. More preferably, due to the large amount of primers synthesized and the high synthesis cost, the first and second sequencing tag sequences introduced in this embodiment of the invention are not Illumina sequencing platform sequencing tags, but rather CS1 and CS2, which have fewer bases. Specifically, the first sequencing tag sequence (CS1) is shown in SEQ ID NO.3, and the second sequencing tag sequence (CS2) is shown in SEQ ID NO.4.

[0058] Furthermore, in the primer set of this embodiment of the invention, the molar ratio of the first primer, the first primer, and the third primer is 3:1:3. Under this molar ratio, the efficiency of the first PCR amplification performed by the first primer, the first primer, and the third primer is the highest.

[0059] Finally, this embodiment of the invention also provides a kit for constructing amplicon sequencing libraries, the kit comprising the primer set described above in this embodiment of the invention.

[0060] The kit in this embodiment of the invention contains a primer set unique to this embodiment. When constructing amplicon sequencing libraries using this kit, reagents and workload can be saved, costs can be reduced, and PCR amplification efficiency can be further improved, resulting in the construction of amplicon sequencing libraries with better coverage and uniformity.

[0061] Furthermore, the kit also includes PCR buffer and DNA polymerase.

[0062] This invention has undergone numerous experiments, and some of the experimental results are presented here for reference to further describe the invention in detail. The following is a detailed description in conjunction with specific embodiments.

[0063] Example 1

[0064] 1. Primer design and synthesis

[0065] Using Ion AmpliSeq™ Designer software, specific primers (i.e., amplicon-specific forward primers and amplicon-specific reverse primers) were designed based on the exon regions of the target genes PAH, PTS, SLC25A13, SLC22A5, MMACHC, MUT, PCCA, PCCB, MCCC1, MCCC2, IVD, and OTC. The first primer was formed by adding a first sequencing tag sequence (CS1) to the 5' end of the amplicon-specific forward primer; the second primer was formed by adding a second sequencing tag sequence (CS2) to the 5' end of the amplicon-specific reverse primer; the third primer was formed by combining the second sequencing adapter (P7), the sample tag sequence (Index), and the second sequencing tag sequence; the fourth primer was formed by combining the first sequencing adapter (P5) and the first sequencing tag sequence; and the fifth primer was the second sequencing adapter sequence. Because this embodiment has 275 amplicones, 275 first primers and 275 second primers need to be synthesized, 96 third primers are temporarily synthesized, and one fourth primer and one fifth primer are synthesized, along with one CS1 sequence, one CS1 reverse complementary sequence, one CS2 sequence, and one CS2 reverse complementary sequence. After the primers were designed, they were synthesized by Invitrogen.

[0066] In this invention, the first sequencing adapter sequence P5 and the second sequencing adapter sequence P7 are adapter sequences for the Illumina sequencing platform. Furthermore, due to the large amount of primers synthesized and the high synthesis cost, the sequencing tags introduced in this embodiment are not Illumina sequencing platform sequencing tags, but rather first sequencing tag sequence CS1 and second sequencing tag sequence CS2, which have fewer bases than the Illumina sequencing platform. The sequences are as follows:

[0067] P5 sequence (SEQ ID NO.1): AATGATACGGCGACCACCGAGATCT;

[0068] P7 sequence (SEQ ID NO. 2): CAAGCAGAAGACGGCATACGAGAT;

[0069] CS1 sequence (SEQ ID NO.3): ACACTGACGACATGGTTCTACA;

[0070] CS2 sequence (SEQ ID NO. 4): TACGGTAGCAGAGACTTGGTCT.

[0071] 2. Sample DNA extraction

[0072] DNA samples selected from human blood, saliva, and tissues can all be used for amplification. After extracting the sample DNA using an automated nucleic acid extractor, quantification is performed using a Qubit Flurometer 3.0. Approximately 200–300 ng of DNA template is required to detect each sample.

[0073] 3. First round of PCR reaction

[0074] Multiplex PCR amplification was performed on the DNA samples obtained from each genome using the PCR reaction systems shown in Tables 1 and 2 and the PCR program shown in Table 3. This round of multiplex PCR contained a total of 275 amplicons, divided into two tubes. Multiplex PCR reaction system 1 (Table 1: total reaction volume 25 μL) contained 139 amplicons, and multiplex PCR reaction system 2 (Table 2: total reaction volume 25 μL) contained 136 amplicons. Mixing pools for upstream primers (first primer) and downstream primers (second primer) were prepared for 96 samples, with each primer having a final concentration of 1 μM. The final concentration of the corresponding third primer for each of the 96 different sample tags was set at 50 μM. The concentration ratio of the three primers for each amplicon in the reaction system was 1:2:3. The third primer for the same sample tag was added to both multiplex PCR reaction systems for the same sample. The specific reaction systems are as follows:

[0075] Table 1

[0076]

[0077] Table 2

[0078]

[0079] Add the components of the above reaction system to the PCR tube, then place it in the PCR instrument and perform the PCR program as shown in Table 3 below:

[0080] Table 3

[0081]

[0082] 4. Purification of the first round of PCR products

[0083] After the first round of PCR reaction was completed, 10 μl of the PCR products from each of the 96 samples were combined into one tube, vortexed and mixed, and then 500 μl was purified twice with 0.8 times the volume of AMPure XP Beads, and then dissolved in 50 μl of TE.

[0084] 5. Second round of PCR reaction

[0085] Using the purified product from the first round of PCR, a second round of PCR was performed. This round of PCR required only two primers: the fourth and fifth primers. The PCR reaction volume was 50 μL, as shown in Table 4 below:

[0086] Table 4

[0087]

[0088] Add the components of the above reaction system to the PCR tube, then place it in the PCR instrument and perform the PCR program shown in Table 5 below.

[0089] Table 5

[0090]

[0091] 6. Purification of second-round PCR products

[0092] After the second round of PCR reaction, the PCR product was purified once with 0.8 times the volume of AMPure XP Beads, dissolved in 50 μl of TE, and the sequencing library was constructed.

[0093] 7. Library quantification and sequencing

[0094] Following the instructions for the Qubit Flurometer 3.0, accurate quantification was performed on the amplicon sequencing library established after the second round of PCR. After the product passed library testing, it was sequenced using the Illumina sequencing platform on a PE150, with the procedures strictly adhering to the supplier's requirements.

[0095] 8. Sequencing data information analysis

[0096] After filtering the sequencing data for low-quality sequences and adapter sequences, the data were aligned to the reference genome (GRCh37 / hg19) using the alignment software BWA. The performance and uniformity of multiplex PCR library construction were determined by analyzing the sequencing depth (reads) of different amplicon.

[0097] 9. Sequencing results

[0098] The library was constructed using the method described in this embodiment, and the sequencing analysis results are as follows:

[0099] Sequencing depths of different amplicon types, such as Figure 2 As shown, at least one read was determined in 275 amplicones from 96 samples, 95.3% of the amplicon sequencing depth was above 30×, the reproducibility was 100%, and the depth distribution of all amplicon detected in this embodiment was concentrated, with most of the read differences being within 1 to 2 orders of magnitude.

[0100] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for constructing a high-efficiency sequencing library, characterized in that, Includes the following steps: Obtain DNA from multiple samples; In different PCR tubes, the DNA of each sample was amplified by a first PCR using a first primer, a second primer, and a third primer to obtain amplification products of multiple samples; wherein, in the first PCR amplification, annealing and extension were combined into one step, and three annealing temperatures were set in the range of 58~62℃ in each cycle; the molar ratio of the first primer, the second primer, and the third primer was 3:1:3; The amplification products of the multiple samples are combined into one tube; In the same tube, the amplification products of the merged multiple samples were amplified by a second PCR using the fourth and fifth primers to obtain the sequencing library; The first primer consists of a first sequencing tag sequence and an amplicon-specific forward primer, from 5' to 3'. The second primer consists of a second sequencing tag sequence and an amplicon-specific reverse primer, from 5' to 3'. The third primer consists of a second sequencing adapter sequence, a sample tag sequence, and the second sequencing tag sequence, from 5' to 3'. The sample tag sequence is used to label different samples. The fourth primer consists of a first sequencing adapter sequence and the first sequencing tag sequence, from 5' to 3'. The fifth primer is the second sequencing adapter sequence. The amplicon-specific forward primer and the amplicon-specific reverse primer are designed from the target gene sequence. The DNA of the multiple samples comes from any one or more of human blood, saliva, and tissue samples, and the weight of the DNA in each of the multiple samples is 200-300 ng.

2. The construction method as described in claim 1, characterized in that, The first sequencing adapter sequence is the Illumina sequencing platform adapter sequence P5, and the second sequencing adapter sequence is the Illumina sequencing platform adapter sequence P7. The first sequencing adapter sequence is shown in SEQ ID NO.1, and the second sequencing adapter sequence is shown in SEQ ID NO.

2.

3. The construction method as described in claim 2, characterized in that, The first sequencing tag sequence and the second sequencing tag sequence are sequences with fewer bases than the sequencing tags of the Illumina sequencing platform, and the first sequencing tag sequence is shown in SEQ ID NO.3, and the second sequencing tag sequence is shown in SEQ ID NO.

4.

4. The construction method as described in claim 1, characterized in that, Following the first PCR amplification step, a first magnetic bead purification step is also included, which involves purification twice using AMPure XP Beads.

5. The construction method as described in claim 4, characterized in that, The purification of the first magnetic bead involves purifying the amplification product of the first PCR amplification twice with 0.8 times the volume of AMPure XP Beads, and then dissolving it in 50 μl of TE.

6. The construction method as described in claim 1, characterized in that, Following the second PCR amplification step, a second magnetic bead purification step is also included, which involves purification once using AMPure XP Beads.

7. The construction method as described in claim 6, characterized in that, The second magnetic bead purification involves purifying the amplification product of the second PCR amplification once with 0.8 times the volume of AMPure XP Beads, and then dissolving it in 50 μl of TE.

Citation Information

Patent Citations

  • Primer composition and uses thereof

    CN105506063A

  • Method for constructing high-throughput sequencing library and kit

    CN106555226A

  • High-level multiplex amplification

    US20170175170A1