Function determination and application of a gene promoting ferroptosis

By detecting and regulating the expression level of NAALAD2, and utilizing NAALAD2 inhibitors or activators, the gap in the regulation of ferroptosis by NAALAD2 has been filled, enabling effective treatment and diagnosis of ferroptosis-related diseases, and improving the specificity of cancer treatment and prognostic assessment capabilities.

CN116064771BActive Publication Date: 2026-03-20SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-27
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

In the current technology, the relationship between NAALAD2 and ferroptosis has not been fully studied, and there is a lack of effective regulation methods, resulting in limited treatment strategies for ferroptosis-related diseases, especially in cancer and neurological diseases where there is a lack of specific targets and diagnostic biomarkers.

Method used

By detecting and regulating the expression level of NAALAD2, and using NAALAD2 inhibitors or activators, products can be prepared to regulate the sensitivity of tumor cells to ferroptosis and predict cancer prognosis, and to develop diagnostic reagents and therapeutic drugs, including gene chips, immunohistochemistry and other technologies.

Benefits of technology

It achieves effective regulation of ferroptosis, provides new targets and diagnostic biomarkers for the treatment of ferroptosis-related diseases, improves the specificity of cancer treatment and prognostic assessment capabilities, and has high application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064771B_ABST
    Figure CN116064771B_ABST
Patent Text Reader

Abstract

The application discloses a kind of gene of promoting cell iron death function determination and application.The application finds that NAALAD2 is a kind of gene promoting iron death, after knocking out NAALAD2, tumor cell has resistance to iron death induced by iron death inducer, after overexpressing NAALAD2, tumor cell has the promotion effect to iron death induced by iron death inducer.The effect of inhibiting or promoting iron death can be achieved by regulating the expression of NAALAD2, which can be used to prepare drugs for treating tumors, nervous system diseases and other common diseases related to iron death, and NAALAD2 gene can also be used as a new mechanism for studying the occurrence and development of iron death.Moreover, the application also finds that NAALAD2 can also be used as a prognostic marker for tumor patients, which can be used to develop a new tumor detection marker diagnostic kit for prognostic judgment, and has good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and particularly relates to function determination and application of a gene for promoting cell ferroptosis. BACKGROUND

[0002] Ferroptosis is a kind of cell death mode caused by iron-dependent lipid peroxide accumulation. Its action involves a wide range of biological processes such as development, aging, immunity and cancer. Four mechanisms for inducing ferroptosis have been determined: (1) inhibiting system Xc; (2) inhibiting, degrading or inactivating GPX4 protein; (3) reducing CoQ10; (4) inducing lipid peroxidation by peroxide, iron or polyunsaturated fatty acid overload. Although iron plays an important role in cell growth, excessive iron can produce reactive oxygen species (ROS), thereby producing toxic effects on cells and even leading to cell death. Ferroptosis is involved in iron-dependent oxidative cell death in neurons. The discovery and research of ferroptosis provide a new promising treatment direction for various neurological diseases and a new target for cancer treatment, such as various neurological diseases such as Alzheimer's disease (AD), Parkinson's disease (PD) and Huntington's disease (HD). In general, therapeutic strategies aimed at inhibiting ferroptosis signals and pathways also work on iron overload diseases. For example, removing iron by using chelators is a more effective method of targeting iron, because it deprives cancer cells of the iron needed for rapid growth, but this method also has strong killing power on normal cells and serious side effects on the human body.

[0003] In the current research, some proteins have been confirmed to be involved in the regulation of ferroptosis, including glutathione peroxidase 4 (GPX4), ferroptosis inhibitor protein (FSP1) and dihydroorotate dehydrogenase (DHODH). These proteins are concentrated in maintaining the balance of intracellular oxidation and reduction, thereby inhibiting cell ferroptosis. Although there are more and more in-depth studies on the regulation of ferroptosis, these studies are far from enough.

[0004] N-acetylated alpha-linked acidic dipeptidase 2 (NAALAD2), also known as glutamate carboxypeptidase III (GCP III), is a binuclear zinc metallopeptidase whose mRNA is highly expressed in the human central nervous system, adrenal glands, uterus, and testes. NAALAD2 is a type II transmembrane glycoprotein, composed of a short intracellular domain (1-8 aa), a transmembrane domain (9-31 aa), and an extracellular domain with carboxypeptidase activity. NAALAD2 can Zn 2+ ,Mn 2+ NAALAD2 hydrolyzes the neuropeptide N-acetylaspartylglutamate (NAAG) in a dependent manner, with a catalytic efficiency approximately one-tenth that of its highly homologous protein, glutamate carboxypeptidase II (GCP II). Increased NAAG hydrolytic activity of NAALAD2 was observed in the brains of GCP II knockout mice, leading to NAALAD2 being considered a potential complementary enzyme to GCP II. In 2011, Collard et al. discovered a high degree of similarity between β-citrylglutamate hydrolase and NAALAD2 in terms of enzymatic kinetics and tissue distribution, and NAALAD2 was found in purified β-citrylglutamate hydrolase. Therefore, the hydrolase of β-citrylglutamate (BCG) was identified as NAALAD2. Navrátil et al. modeled the NAALAD2 / BCG complex using quantum mechanical / molecular mechanical calculations (QM / MM calculations), suggesting that NAALAD2 binds to the citrate in BCG via coordination with Ser444, Arg524, and Arg526. The study also indicated that the hydrolysis of BCG by NAALAD2 is mediated by Ca... 2+ Mn 2+BCG is a pseudo-dipeptide, whose specific function is unknown, and may play a role in the central nervous system and the reproductive system. The iron chelate of BCG can promote the survival of neuronal cells through cis-aconitate. In addition, NAALAD2 can also be a characteristic gene of various diseases. In cancer, NAALAD2 promoter methylation is identified as one of the markers of prostate cancer, and NAALAD2 circRNA is significantly down-regulated in neuroblastoma and is related to the concentration of lactate dehydrogenase; in other diseases, NAALAD2 is also a susceptible gene of femoral head necrosis and a causal gene of diabetes-induced dementia. In white blood cell count, NAALAD2 is a characteristic gene locus of basophilic granulocytes; but so far there has been no report on the relationship between NAALAD2 and ferroptosis. SUMMARY

[0005] The purpose of the present application is to provide the application of NAALAD2 in promoting cell ferroptosis.

[0006] The technical solution adopted by the present application is:

[0007] In the first aspect of the present application, the application of a substance for detecting the expression amount of NAALAD2 in (a1) to (c1) is provided:

[0008] (a1) preparing a product for evaluating the sensitivity of tumor cells to ferroptosis;

[0009] (b1) preparing a product for predicting or assisting in predicting the prognosis of tumors;

[0010] (c1) preparing a product for predicting or assisting in predicting the overall survival of cancer patients.

[0011] In some embodiments of the present application, the product includes a kit, a diagnostic reagent, a detection reagent, a test paper, a gene chip or a protein chip.

[0012] In some embodiments of the present application, the substance includes a substance for quantitatively detecting NAALAD2 at the gene or protein level.

[0013] In some embodiments of the present application, the substance for quantitatively detecting NAALAD2 at the gene level includes a substance for detecting the expression level of a marker gene by a sequencing technology, a nucleic acid hybridization technology, a nucleic acid amplification technology or an immunoassay method.

[0014] In some embodiments of the present application, the substance for quantitatively detecting NAALAD2 at the protein level includes a substance for detecting the expression level of a protein by an immunohistochemical method, a protein immunoblotting method, an enzyme-linked immunosorbent (ELISA) method, a flow cytometry method, a chemiluminescence method, an electrochemistry method, an ultraviolet spectrophotometry-near infrared spectroscopy method, a liquid chip method, a high performance liquid chromatography method, a colorimetric method or a mass spectrometry method.

[0015] In some embodiments of the present application, the substance comprises a reagent and / or an instrument.

[0016] In some embodiments of the present application, the substance comprises an antibody, a primer, a probe.

[0017] In a second aspect of the present application, there is provided a use of NAALAD2 in at least one of (a2) to (e2):

[0018] (a2) modulating ferroptosis of tumor cells;

[0019] (b2) preparing a product for modulating ferroptosis of tumor cells

[0020] (c2) modulating the sensitivity of tumor cells to ferroptosis;

[0021] (d2) preparing a product for modulating the sensitivity of tumor cells to ferroptosis;

[0022] (e2) preparing a drug for treating a disease related to ferroptosis.

[0023] In some embodiments of the present application, the modulation is an increase or a decrease.

[0024] In some embodiments of the present application, the product comprises a drug or a reagent.

[0025] In some embodiments of the present application, the disease related to ferroptosis comprises a disease treatable by inhibiting ferroptosis or a disease treatable by inducing ferroptosis. Because ferroptosis plays different roles in different disease contexts, the present application can treat different diseases by modulating ferroptosis.

[0026] In some embodiments of the present application, the disease treatable by inducing ferroptosis comprises a tumor; and the disease treatable by inhibiting ferroptosis comprises a nervous system disease, ischemia-reperfusion injury, acute kidney failure, or a disease related to iron metabolism.

[0027] In some embodiments of the present application, the tumor comprises breast cancer, esophageal cancer, liver cancer, pancreatic cancer, renal cancer, diffuse large B-cell lymphoma, thyroid cancer, or low-grade glioma.

[0028] In some embodiments of the present application, the nervous system disease comprises Parkinson's disease, Alzheimer's disease, periventricular leukomalacia, Huntington's disease, epilepsy, motor neuron degeneration, or amyotrophic lateral sclerosis.

[0029] In some embodiments of the present application, the ischemia-reperfusion injury comprises myocardial ischemia-reperfusion injury, liver ischemia-reperfusion injury, or renal ischemia-reperfusion injury.

[0030] In some embodiments of the present application, the iron metabolism related disease comprises atherosclerosis or diabetes.

[0031] In some embodiments of the present application, the cardiovascular and cerebrovascular disease comprises stroke, cerebral hemorrhage, traumatic brain injury, heart disease.

[0032] But not limited to the above disease categories.

[0033] In a third aspect of the present application, the NAALAD2 inhibitor is used in at least one of (a3) to (e3):

[0034] (a3) inhibiting tumor cell ferroptosis;

[0035] (b3) preparing a product for inhibiting tumor cell ferroptosis;

[0036] (c3) reducing the sensitivity of tumor cells to ferroptosis;

[0037] (d3) preparing a product for reducing the sensitivity of tumor cells to ferroptosis;

[0038] (e3) preparing a drug for treating diseases related to ferroptosis induction.

[0039] In some embodiments of the present application, the NAALAD2 inhibitor comprises at least one of (a4) to (e4):

[0040] (a4) a substance for inhibiting the activity of NAALAD2;

[0041] (b4) a substance for reducing the content of NAALAD2;

[0042] (c4) a substance for silencing the NAALAD2 gene;

[0043] (d4) a substance for knocking down the NAALAD2 gene;

[0044] (e4) a substance for inhibiting the expression of the NAALAD2 gene.

[0045] In some preferred embodiments of the present application, the NAALAD2 inhibitor comprises at least one of the following: a compound, siRNA, sgRNA, shRNA, microRNA, antisense nucleic acid, antibody construct.

[0046] In some embodiments of the present application, the sequence of the sgRNA comprises sgRNA1 or sgRNA2:

[0047] The sequence of the sgRNA1 is:

[0048] sgRNA1-F: CACCGGAGATGGGCATCAACTGTAC;

[0049] sgRNA1-R: AAACGTACAGTTGATGCCCATCTCC;

[0050] The sequence of the sgRNA2 is:

[0051] sgRNA2-F: CACCGGTATCGGACCTGGCTTTACA;

[0052] sgRNA2-R: AAACTGTAAAGCCAGGTCCGATACC.

[0053] In some embodiments of the present application, the product comprises a drug or an agent.

[0054] In some embodiments of the present application, the tumor comprises breast cancer, esophageal cancer, liver cancer, pancreatic cancer, kidney cancer, diffuse large B-cell lymphoma, thyroid cancer, and low-grade glioma.

[0055] In a fifth aspect of the present application, a NAALAD2 activator is provided for use in at least one of (a5) to (e5):

[0056] (a5) promoting ferroptosis of tumor cells;

[0057] (b5) preparing a product for promoting ferroptosis of tumor cells;

[0058] (c5) increasing the sensitivity of tumor cells to ferroptosis;

[0059] (d5) preparing a product for increasing the sensitivity of tumor cells to ferroptosis;

[0060] (e5) preparing a drug for treating a disease related to inhibition of ferroptosis.

[0061] In some embodiments of the present application, the NAALAD2 activator comprises a NAALAD2 protein or a biological material related to NAALAD2, which is any one of (a6) to (d6) as follows:

[0062] (a6) a nucleic acid molecule encoding the NAALAD2;

[0063] (b6) an expression cassette containing the nucleic acid molecule of (a6);

[0064] (c6) a recombinant vector containing the nucleic acid molecule of (a6), or a recombinant vector containing the expression cassette of (b6);

[0065] (d6) a recombinant cell containing the nucleic acid molecule of (a6), or a recombinant cell containing the expression cassette of (b6), or a recombinant cell containing the recombinant vector of (c6).

[0066] In some embodiments of the present application, the tumor comprises: breast cancer, esophageal cancer, liver cancer, pancreatic cancer, kidney cancer, diffuse large B-cell lymphoma, thyroid cancer, low-grade glioma.

[0067] In a sixth aspect of the present application, a NAALAD2 inhibitor is provided, which comprises an sgRNA or a recombinant vector, a transgenic cell or a recombinant bacteria containing the sgRNA; the sequence of the sgRNA comprises sgRNA1 or sgRNA2:

[0068] The sequence of the sgRNA1 is:

[0069] sgRNA1-F: CACCGGAGATGGGCATCAACTGTAC;

[0070] sgRNA1-R: AAACGTACAGTTGATGCCCATCTCC;

[0071] The sequence of the sgRNA2 is:

[0072] sgRNA2-F: CACCGGTATCGGACCTGGCTTTACA;

[0073] sgRNA2-R: AAACTGTAAAGCCAGGTCCGATACC.

[0074] In a seventh aspect of the present application, a NAALAD2 activator is provided, which comprises a recombinant vector, a transgenic cell or a recombinant bacteria containing a DNA nucleotide sequence synthesized by a primer as shown in SEQ ID NO. 1 and a primer as shown in SEQ ID NO. 2.

[0075] In an eighth aspect of the present application, a product is provided, which comprises the NAALAD2 inhibitor of the sixth aspect of the present application or the NAALAD2 activator of the seventh aspect of the present application.

[0076] The beneficial effects of the present application are:

[0077] The present application finds that NAALAD2 is a gene promoting ferroptosis, experimental data show that after knocking out NAALAD2, human fibrosarcoma cells HT-1080 have resistance to ferroptosis induced by ferroptosis inducer Erastin, and after overexpressing NAALAD2, HT-1080 has promotion effect on ferroptosis induced by ferroptosis inducer. Therefore, the expression of NAALAD2 can be regulated to achieve the effect of inhibiting or promoting ferroptosis, and can be used for preparing drugs for treating common diseases related to ferroptosis such as tumors and nervous system diseases, and NAALAD2 gene can be used as a new mechanism for studying the occurrence and development of ferroptosis. Therefore, the present application provides a new possible mechanism for studying the occurrence and development of ferroptosis, and provides a new target and treatment basis for the development of drugs related to ferroptosis diseases, and has high application value.

[0078] Moreover, the present application also finds that the survival curves of patients with high expression and low expression of NAALAD2 in liver cancer, brain low-grade glioma and thyroid cancer are statistically different; therefore, NAALAD2 can also be used as a prognostic marker for tumor patients, and can be used for developing a new tumor detection marker diagnostic kit for prognostic judgment, and has good application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0079] Figure 1 NAALAD2 knockout effect of HT-1080 cells and cell death after Erastin treatment; Figure 1 A is the NAALAD2 gene knockout effect; Figure 1 B is the cell morphology after NAALAD2 gene knockout; Figure 1 C is the cell death rate statistics after NAALAD2 gene knockout.

[0080] Figure 2 NAALAD2 overexpression Flag-NAALAD2 effect in HT-1080 NAALAD2 knockout cells and cell death after adding Erastin; Figure 2 A is the NAALAD2 gene knockout effect; Figure 2 B is the cell morphology after NAALAD2 gene knockout; Figure 2 C is the cell death rate statistics after NAALAD2 gene knockout.

[0081] Figure 3 NAALAD2 knockout of HT-1080 cells and cell survival curve measured after different Erastin concentrations are used to treat HT-1080 NAALAD2 knockout cells after overexpressing Flag-NAALAD2; Figure 3A is the growth curve of cells after NAALAD2 gene knockout; Figure 3 B is the growth curve of cells after overexpression of Flag-NAALAD2; both are measured by CCK8 reagent and fitted with growth curve.

[0082] Figure 4 NAALAD2 and ferroptosis-related gene pan-cancer co-expression correlation analysis.

[0083] Figure 5 Kaplan-Meier curve: Figure 5 A is liver cancer, Figure 5 B is low-grade glioma of the brain, Figure 5 C is thyroid cancer, the samples are divided into high expression (red) and low expression (blue) according to the median value of NAALAD2 expression, and the Kaplan-Meier analysis of the overall survival data of patients is carried out.

[0084] Note: Two-group t-test comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 DETAILED DESCRIPTION

[0085] The concept and technical effects of the present application will be described below in conjunction with examples to fully understand the purpose, features and effects of the present application. Obviously, the described examples are only a part of the embodiments of the present application, not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0086] ACC: Adrenocortical carcinoma; BLCA: Bladder Urothelial Carcinoma; BRCA: Breast invasive carcinoma; CESC: Cervical squamous cell carcinoma and endocervical adenocarcinoma; CHOL: Cholangiocarcinoma; COAD: Colon adenocarcinoma; COADREAD: Colon adenocarcinoma / Rectum adenocarcinoma Esophageal carcinoma; DLBC: Lymphoid Neoplasm Diffuse Large B-cell Lymphoma; ESCA: Esophageal carcinoma; FPPP: FFPE Pilot Phase II; GBM: Glioblastoma multiforme; GBMLGG: Glioma; HNSC: Head and Neck squamous cell carcinoma; KICH: Kidney Chromophobe; KIPAN: Pan-kidney cohort (KICH+KIRC+KIRP); KIRC: Kidney renal clear cell carcinoma; KIRP: Kidney renal papillary cell carcinoma; LAML: Acute Myeloid Leukemia; LGG: Brain Lower Grade Glioma; LIHC: Liver hepatocellular carcinoma; LUAD: Lung adenocarcinoma; LUSC: Lung squamous cell carcinoma; MESO: Mesothelioma; OV: Ovarian serous cystadenocarcinoma; PAAD: Pancreatic adenocarcinoma;PCPG: Pheochromocytoma and Paraganglioma; PRAD: Prostate adenocarcinoma; READ: Rectum adenocarcinoma; SARC: Sarcoma; SKCM: Skin Cutaneous Melanoma; STAD: Stomach adenocarcinoma; STES: Stomach and Esophageal carcinoma; TGCT: Testicular Germ Cell Tumors; THCA: Thyroid carcinoma; THYM: Thymoma; UCEC: Uterine Corpus Endometrial Carcinoma; UCS: Uterine Carcinosarcoma; UVM: Uveal Melanoma.

[0087] Example 1 Construction of NAALAD2 knockout cells and detection of ferroptosis sensitivity

[0088] 1. Construction of knockout plasmid

[0089] 1) Design 2 pairs of sgNAALAD2 primers, see Table 1 for sequences, and cut the lentiCRISPR V2 vector with BsmB I enzyme for 2 h at 37°C. Perform agarose electrophoresis after enzyme digestion, and recover the large fragment from the gel.

[0090] Table 1 Primer sequences

[0091] Primer name Primer sequence NAALAD2-F taGTCGACGCGGAATCCAGGGGCCGTCT (SEQ ID NO. 1) NAALAD2-R taGCTAGCCTATAATACTTCTTTCAGAG (SEQ ID NO. 2) sg-NAALAD#1-F CACCGGAGATGGGCATCAACTGTAC (SEQ ID NO. 3) sg-NAALAD#1-R AAACGTACAGTTGATGCCCATCTCC (SEQ ID NO. 4) sg-NAALAD#2-F CACCGGTATCGGACCTGGCTTTACA (SEQ ID NO. 5) sg-NAALAD#2-R AAACTGTAAAGCCAGGTCCGATACC (SEQ ID NO. 6)

[0092] 2) Annealing and phosphorylation: The annealing system is 2ul of oligo upstream and downstream primers, 1ul of T4 polynucleotide Kinase, 1ul of 10X T4 ligation buffer (containing ATP), 4ul of ddH2O, and the program is 37°C for 30 min, 95°C for 5s, ramp to 25°C at 5°C / min.

[0093] 3) Ligation: Dilute the PCR product 200-fold, take 1ul and connect with the linear lentiCRISPR V2 after enzyme digestion. The connection time is 1h, and the connection temperature is 25°C. The recombinant plasmid containing the target fragment is obtained.

[0094] 4) Transformation: Mix the ligation reaction 20ul with stbl3 competent cells gently, let it stand on ice for 5min, then heat shock at 42C for 30 seconds. Let it stand on ice for 5min, add 200ul 37C preheated LB liquid medium without ampicillin resistance. Shake culture at 37C, 220rpm for 1h.

[0095] 5) Screening: Spread the product of the shake culture evenly on agarose plates containing ampicillin resistance with a glass rod, and place in a 37C incubator overnight. Pick the clones with a pipette gun head and add 5ml liquid medium containing ampicillin resistance, and then shake culture for 16-18h. Collect the bacterial liquid after culture and extract the plasmid with a kit. Sequence the plasmid to further verify whether it contains the target fragment.

[0096] 2. Construction of knockout cell lines

[0097] 1) Use HIV lentivirus particles as a medium, co-transfect 293T cells with the constructed sgRNA plasmid and packaging plasmid, collect virus liquid at 36h and 60h, and detect virus titer.

[0098] 2) Take 1ml of virus liquid, 1ml of medium, and 2ul of polybrene (10mg / ul) to infect HT-1080 cells, replace with fresh medium 12h later and continue to culture for 36h, and add puromycin for screening. Until the blank control without virus liquid is all dead, remove the puromycin and continue to culture. Digest the screened cells with trypsin, centrifuge to remove the supernatant, resuspend the cells with 1ml of fresh medium, take 20ul to culture in a 10cm cell culture dish, at this time the cells are single and dispersed on the cell culture dish. Place in a cell culture incubator for two weeks until visible cell colonies are formed.

[0099] 3) Remove the old medium, wash the remaining medium with PBS, add 1ml of trypsin and digest for 1min, at this time the single colony is slightly digested. Remove the trypsin with a small gun head, take a small amount of medium and suck the single colony into a twelve-hole plate with fresh medium, continue to culture for two weeks until the surface of the hole plate is covered with single clone cells.

[0100] 4) Collect the cells in the 12-hole plate and perform immunoblotting verification. Select single clones with complete knockout of NAALAD2 protein bands.

[0101] 3. Immunoblotting

[0102] 1) Lysis of cells

[0103] Using lysis buffer (Flag lysis buffer): protease inhibitor (PI) (500x) to collect cells, 4°C lysis for 45 min. Centrifugation: 14000 rpm, 10 min, 4°C, take 2ul supernatant for protein concentration determination, after quantification, add sample buffer to prepare protein sample.

[0104] 2) Protein separation

[0105] Prepare 10% SDS-PAGE protein gel in advance, take 10ul of the above protein sample, constant voltage 100V-120V, 2h. Transfer the sample on the SDS-PAGE gel to the NC membrane at a constant current of 350mA for 2h. After the transfer is completed, stain with ponceau red, and after the protein bands are developed, cut the NC membrane according to the protein size and put it into different slots.

[0106] 3) Milk blocking, antibody incubation

[0107] Add 5% skimmed milk powder prepared with TBST to block the NC membrane at room temperature for 1h. Remove the milk and add the corresponding primary antibody NAALAD2, Actin. Incubate on a shaking table at 4°C overnight. The next day, remove the primary antibody and wash three times with TBST, add the corresponding secondary antibody, and incubate on a shaking table at room temperature for 1h. Use ECL luminescent liquid to develop the NC membrane and detect the corresponding proteins NAALAD2, Actin. Organize the data to get Figure 1 A. In HT1080 cells, using CRISPR-CAS9 technology, NAALAD2 expression is deleted, indicating that the NAALAD2 gene is completely knocked out.

[0108] 4, Iron death inducer Erastin treatment of cells

[0109] 1) The obtained HT-1080 NAALAD2 WT, KO1, KO2 cells were inoculated in 12-well plates, two holes for each cell. Culture for 6-8h until the cells are completely adherent, then add drug treatment, one hole adds Erastin (10uM), the other hole adds corresponding volume of DMSO. Continue overnight culture for 16-18 hours until the cells start to appear iron death phenomenon. Under the optical microscope 40X, take pictures of the cells, organize the data to get Figure 1 B.

[0110] 2) The obtained HT-1080 NAALAD2 WT, KO1, KO2 cells were inoculated in 12-well plates, two holes for each cell. Culture for 6-8h until the cells are completely adherent, then add drug treatment, one hole adds Erastin (10uM), the other hole adds corresponding volume of DMSO. Continue overnight culture for 16-18 hours until the cells start to appear iron death phenomenon. Collect the cells, stain with trypan blue, count, and calculate the cell death rate, organize the data to getFigure 1 C.

[0111] By Figure 1 B and Figure 1 C can be seen, most of the wild-type cells after Erastin treatment cell death phenomenon, but NAALAD2 knockout cells with no significant difference from the control group without Erastin treatment. This shows that knocking out NAALAD2 will inhibit the occurrence of ferroptosis induced by Erastin.

[0112] Example 2 Construction of NAALAD2 overexpression cells and detection of ferroptosis sensitivity

[0113] 1. Construction of overexpression vector

[0114] 1) Division: Find the CDS sequence of NAALAD2 (NM_005467.4:97-2319) on the NCBI website, design primer fragments NAALAD2-F and NAALAD2-R according to the sequence, and the primer sequences are shown in Table 1. The target gene NAALAD2 is separated from the cDNA library by PCR technology. The primer contains two restriction enzyme sites Sal I and BamH I, and the amplification length is 2223bp.

[0115] 2) Cutting: The target fragment and the PRRL vector with Flag tag are purified by using the kit, and the restriction enzymes Sal I and BamH I are used for double digestion, the digestion time is 1h, and the digestion temperature is 37℃. The target dsDNA fragment and the pRRL plasmid with Flag tag containing Sal I and BamH I restriction enzyme sites at the end are obtained.

[0116] 3) Connection: The digested DNA fragments and the vector are connected using T4 ligase at a ratio of 3:1, the connection time is 1h, and the connection temperature is 25℃. The recombinant plasmid containing the target fragment is obtained.

[0117] 4) Transformation: Mix 20ul of the ligation reaction system with stbl3 competent cells, and incubate on ice for 5min, then heat shock at 42℃ for 30s. Incubate on ice for 5min, then add 200ul of 37℃ preheated ampicillin-free LB liquid medium. Shake culture at 37℃, 220rpm for 1h.

[0118] 5) Screening: The expanded culture product is evenly smeared on the agarose plate containing ampicillin resistance with a glass rod, and incubated in a 37℃ incubator overnight. The clones are picked up with a pipette gun head and added to 5ml of liquid medium containing ampicillin resistance, and then cultured in a shaker for 16-18h. The bacterial solution after culture is extracted with a kit to obtain the Flag-tagged NAALAD2 plasmid.

[0119] 6) Verification: The purified plasmid was subjected to Sal I and BamH I double enzyme digestion verification. If a band of about 2000 bp was obtained, it indicated that the plasmid construction was successful, and it was sent to the company for sequencing for further verification.

[0120] 2. Construction of overexpression cell lines

[0121] 1) HIV lentivirus particles were used as a medium, and the constructed Flag-vector plasmid and Flag-NAALAD2 plasmid were co-transfected with the packaging plasmid into 293T cells. Virus liquid was collected at 36 h and 60 h, respectively, and the virus titer was detected to prepare Flag-vector virus liquid and Flag-NAALAD2 virus liquid.

[0122] 2) Take 1 ml of Flag-vector virus liquid and Flag-NAALAD2 virus liquid, respectively, and infect HT-1080 NAALAD2 KO1 cells. After 12 h, replace with fresh culture medium and continue to culture for 36 h to obtain KO1 cell Vector and Flag-NAALAD2 overexpression cell lines.

[0123] 3) Part of the cells were collected for immunoblotting to detect protein expression levels.

[0124] 3. Immunoblotting

[0125] The operation process of immunoblotting in Example 1 was followed, and the data was arranged to obtain Figure 2 A. It can be seen that in HT1080 NAALAD2 KO1 cells, the content of NAALAD2 significantly increased after using overexpression technology.

[0126] 4. Iron death inducer Erastin treatment of cells

[0127] 1) The operation process of Example One was followed, and the data was arranged to obtain Figure 2 B.

[0128] 2) The operation process of Example One was followed, and the data was arranged to obtain Figure 2 C.

[0129] The results of treating HT-1080 cell NAALAD2 knockout and overexpression with DMSO and Erastin are as follows Figure 2 B and Figure 2C, it can be seen that most of the knockout cells do not have obvious ferroptosis phenomenon after Erastin treatment, which is consistent with the previous conclusion. Further found that after overexpression of NAALAD2, obvious cell death occurred. This shows that knocking out NAALAD2 can inhibit ferroptosis, and overexpression of NAALAD2 can promote ferroptosis, which further shows that NAALAD2 can promote the occurrence of ferroptosis.

[0130] Cell viability detection of example 3

[0131] 1, (1) HT-1080 NAALAD2 WT, KO1, KO2 cells were inoculated in 96-well plates, each cell was set with 8 drug concentrations, and three parallel duplicate wells. After 6-8h of culture, 0, 2, 4, 6, 8, 10, 15, 200uM Erastin 8 drug concentrations were prepared respectively, the old culture medium of the 96-well plate was removed, and the culture medium with different concentrations of Erastin was added. Continue overnight culture for 16-18h until all cells in the highest concentration die.

[0132] (2) HT-1080 NAALAD2 KO1 Vector and Flag-NAALAD2 cells were inoculated in 96-well plates, each cell was set with 8 drug concentrations, and three parallel duplicate wells. After 6-8h of culture, 0, 2, 4, 6, 8, 10, 15, 200uM Erastin 8 drug concentrations were prepared respectively, the old culture medium of the 96-well plate was removed, and the culture medium with different concentrations of Erastin was added. Continue overnight culture for 16-18h until all cells in the highest concentration die.

[0133] 2, remove the drug, add 10ul CCK-8 solution to each well, incubate at 37℃ for 2h, then measure the absorbance at 450nm, calculate the cell viability according to the formula: "cell viability (%) = [A(drug)-A(blank) / A(0 drug)-A(blank)]*100", and fit the survival curve. Organize the data to get Figure 3 A.

[0134] 3, HT-1080 NAALAD2 knockout cells and overexpression cells were inoculated in 96-well plates, and the operation was as above. Organize the data to get Figure 3 B.

[0135] It can be seen from Figure 3 A and Figure 3 B that compared with the wild type, the NAALAD2 knockout cells have stronger resistance to ferroptosis after treatment with Erastin, and the resistance of the cells to ferroptosis decreases after overexpression of NAALAD2. This also shows that NAALAD2 has the ability to promote the occurrence of ferroptosis.

[0136] Example 4

[0137] Figure 6. NAALAD2 pan-cancer co-expression and survival analysis results plot using TCGA dataset analysis

[0138] Figure 4 Figure 6. NAALAD2 pan-cancer co-expression and survival analysis results plot using TCGA dataset analysis Figure 5 A、 Figure 5 B and Figure 5 C are Kaplan-Meier analysis of overall survival of patients with high (red) and low (blue) expression of NAALAD2 based on median value of NAALAD2 expression in tumor patients with Liver hepatocellular carcinoma (LIHC) n=371, Brain Lower Grade Glioma (LGG) n=516, Thyroid carcinoma (THCA) n=509 based on TCGA dataset gene expression and clinical information. Survival curves of patients with high and low expression of NAALAD2 in the three cancer groups are statistically different, and the survival rate of patients with low expression of NAALAD2 is higher than that of patients with high expression of NAALAD2 (log-rank test LIHC: P=0.026; LGG: P=0.014; THCA: P=0.08). Cox proportional hazards regression analysis showed that the expression of NAALAD2 was associated with patient death (LIHC: hazard ratio, HR=1.5, P=0.027; LGG: hazard ratio, HR=1.6, P=0.015; THCA: hazard ratio, HR=2.5, P=0.091).

[0139] The above detailed description of the present application is made in the light of the embodiments, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the present application. Furthermore, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. The application of NAALAD2 activator in at least one of (b5) and (d5), (b5) Prepare products that promote ferroptosis in tumor cells; (d5) Prepare products that enhance the sensitivity of tumor cells to ferroptosis; The NAALAD2 activator comprises NAALAD2 protein or NAALAD2-related biological material, wherein the biological material is any one of (a6) to (d6) below: (a6) The nucleic acid molecule encoding NAALAD2; The CDS sequence of NAALAD2 is NCBI accession number NM_005467.4:97-2319; (b6) An expression cassette containing the nucleic acid molecule described in (a6); (c6) A recombinant vector containing the nucleic acid molecule described in (a6), or a recombinant vector containing the expression cassette described in (b6); (d6) A recombinant microorganism containing the nucleic acid molecule described in (a6), or a recombinant microorganism containing the expression cassette described in (b6), or a recombinant cell containing the recombinant vector described in (c6); The tumor is a fibrosarcoma.

Citation Information

Patent Citations

  • A universal platform for preparing an inhibitory chimeric antigen receptor (ICAR)

    CN111465693A

  • Effective sirna knock-down constructs

    WO2004094636A1