Molecular motor, construct, nucleic acid, vector, host cell and use thereof

By designing molecular motors with tower, pin and hook domains, the loss of activity of existing molecular motors under solution environment changes is solved, efficient decoilization and nucleotide movement control in a wide temperature range and different ionic environments is achieved, and the accuracy of nanopore sequencing is improved.

CN116083395BActive Publication Date: 2025-08-08SOUTHERN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211024823.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-25
Publication Date
2025-08-08
Estimated Expiration
2042-08-25

AI Technical Summary

Technical Problem

Existing molecular motors are difficult to adapt to mutations in the solution environment, especially the changes in the type and concentration of solution ionics lead to loss of their activity, affecting the accuracy of nanopore sequencing.

Method used

A molecular motor is designed, including a tower structure, a pin structure and a hook domain, with a ratchet-like overall structure, which can move and unrotate on double-stranded DNA, has derotating activities in the 5’-3’ and 3’-5’ directions, and adapts to different environmental conditions.

Benefits of technology

It improves the adaptability of molecular motors in solutions of different temperatures, salt ions and metal ions, enhances the stability of nucleic acid binding, improves the ability to control nucleotide movement, and improves the accuracy of nanopore sequencing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116083395B_ABST
    Figure CN116083395B_ABST
Patent Text Reader

Abstract

The present application provides a molecular motor, a construct, a nucleic acid, a vector, a host cell and its application, relating to the field of biotechnology, the molecular motor provided by the present application is constructed by an amino acid sequence, and is structurally constructed to form a tower structure, a pin structure and a hook structure, wherein the tower structure is composed of a short double β-pleated region and a long double α-helical structure, and the pin structure and the hook structure are constructed by a double β-pleated sheet, wherein the pin structure is short. The special structure constructed is conducive to the combination of nucleic acid and molecular motor on the one hand; on the other hand, it also accelerates the unwinding speed of nucleic acid in the molecular motor and improves the unwinding activity of the molecular motor. The molecular motor can exercise DNA unwinding activity in a wide temperature range (10-50°C), salt ions (0-600mMNaCl) and a variety of heavy metal ion solutions, and has a wide adaptability to environmental solutions. The molecular motor can realize the speed control of nucleotide movement and can be applied to fields such as nanopore sequencing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a molecular motor, a construct, a nucleic acid encoding the same, a vector and a host cell expressing the same, and applications thereof. Background Art

[0002] The most significant feature of nanopore sequencing technology is that it eliminates the need for PCR amplification during the sequencing process, enabling the individual sequencing of each DNA molecule. It can also directly sequence RNA, identify RNA base modifications, and facilitate the assembly of large genomes, offering promising development prospects in disease research, particularly epigenetic studies. Furthermore, sequencers do not require complex, large optical imaging systems or intricate fluidics, allowing them to be extremely compact and portable. Operating costs are significantly lower than those of other sequencing instruments, making them highly adaptable to a variety of application scenarios, such as field microbial identification and future biological battlefields.

[0003] Nanopore sequencing technology relies on a nanoscale protein pore, or "nanopore," which acts as a biosensor embedded in a charge-resistant polymer membrane. In an electrolyte, a constant voltage is applied across the nanopore, generating an ionic current. Negatively charged single-stranded DNA or RNA molecules are translocated through the nanopore at a rate controlled by a molecular motor. Real-time sequencing of individual molecules is achieved by computationally decoding the changes in the ionic current generated by the translocation process with the nucleotide sequence in the sensing region. In this process, the speed of nucleotide translocation across the nanopore is crucial for resolving the current response.

[0004] In the prior art, patent document WOO2016055777A2 discloses a modified Dda helicase that can act as a molecular motor to control the movement of polynucleotides and facilitate nucleotide sequencing applications. Patent document WO2021 / 253410A1 discloses a modified pif1-like helicase that can also act as a molecular motor to effectively control the movement of polynucleotides through pores, helping to improve the accuracy of chain sequencing.

[0005] However, these helicases, when used as molecular motors, have difficulty adapting to changes in the solution environment, especially changes in the type and concentration of ions in the solution, which often lead to loss of their activity. Therefore, the development of molecular motors with broad adaptability is of great significance for improving the accuracy of nanopore sequencing. Summary of the Invention

[0006] The purpose of this application is to provide a molecular motor with broad-spectrum adaptability, aiming to solve the problem that existing molecular motors are difficult to adapt to sudden changes in the solution environment and changes in the types and concentrations of solution ions will lead to loss of their activity.

[0007] To achieve the above objectives, the present application provides a molecular motor in the first aspect, such asFigure 1A As shown, it includes a tower structure, a pin structure, a hook domain and a base. These structures are interconnected to form a ratchet-like whole, so that the molecular motor can move along the double-stranded DNA and has unwinding activity. After acting on the double-stranded DNA, it can cause the double-stranded DNA to unwind; in the tower domain, the double β-folding region is shortened to 0-40 amino acids, and the double α-helical domain is 28-65 amino acids; the base includes an A structure and a B structure.

[0008] The hook domain of the molecular motor is degenerated into 0-25 amino acids;

[0009] The molecular motor has DNA unwinding activity in the 5'-3' and 3'-5' directions.

[0010] The molecular motor may function as a monomer of the above structure, or as a complex homopolymer formed by a plurality of monomers of the above structure.

[0011] Preferably, the double β-pleated region is shortened to 0-30 amino acids, for example, it can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acids; the double α-helical domain is 40-65 amino acids, for example, it can be 40 , 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65 amino acids; the hook domain is 0-15 amino acids, for example, it can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acids.

[0012] This molecular motor can bind to nucleic acids, unwinding double-stranded DNA. It can also ratchet and shift after binding to nucleic acids, propelling them forward. The motor's tower, hook, and pin structures form the binding region, while the base's A and B structures support the motor's ratcheting.

[0013] The molecular motor can be a wild-type molecular motor or a natural molecular motor, or a modified molecular motor.

[0014] Optionally, the amino acid sequence of the molecular motor is as shown in SEQ ID NO.1, or the amino acid sequence of the molecular motor is a variant having at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.9% homology with the amino acid sequence shown in SEQ ID NO.1.

[0015] Preferably, the variant includes a natural amino acid sequence having the same conserved sequence as SEQ ID NO.1 obtained by bioinformatics analysis of the amino acid sequence shown in SEQ ID NO.1;

[0016] And, a mutant amino acid sequence obtained by mutating the amino acid sequence shown in SEQ ID NO.1 and the natural amino acid sequence having the same conservative sequence as SEQ ID NO.1.

[0017] The term "natural amino acid sequence" refers to a wild-type amino acid sequence or a natural amino acid sequence, which can be retrieved from a protein database. A mutant amino acid sequence is a molecular motor that is artificially constructed and is capable of mechanical work, formed by modifying a wild-type amino acid sequence or a natural amino acid sequence.

[0018] Preferably, the natural amino acid sequence having the same conserved sequence as SEQ ID NO.1 is shown in the following Table 1 in the UniProt protein database ID:

[0019] Table 1 UniProt protein database IDs of variant molecular motors

[0020]

[0021]

[0022]

[0023] Preferably, the mutant amino acid sequence comprises:

[0024] One or more amino acids are substituted in the amino acid sequence shown in SEQ ID NO. 1 and the natural amino acid sequence having the same conservative sequence as SEQ ID NO. 1, for example, one, two, three, four or more amino acids are substituted.

[0025] And / or, one or more amino acids are inserted into the amino acid sequence shown in SEQ ID NO.1 and the natural amino acid sequence with the same conservative sequence as SEQ ID NO.1, for example, one, two, three, four, five, six, ten, fifteen or more amino acids may be inserted.

[0026] And / or, one or more amino acids are deleted from the amino acid sequence shown in SEQ ID NO.1 and the natural amino acid sequence having the same conserved sequence as SEQ ID NO.1, for example, one, two, three, four, five, six, eight, ten, twelve, fifteen or more amino acids are deleted.

[0027] And / or, the amino acid sequence shown in SEQ ID NO.1 and the natural amino acid sequence having the same conservative sequence as SEQ ID NO.1 are side-chain modified.

[0028] Preferably, the side chain modification includes any one or more of the following:

[0029] Glycosylation, phosphorylation, ubiquitination, S-nitrosylation, N- and O-methylation, N-acetylation, lipidation.

[0030] Preferably, the molecular motor with the amino acid sequence shown in SEQ ID NO.1 and the molecular motor with the natural amino acid sequence having the same conserved sequence as SEQ ID NO.1, in their structures, at least one amino acid in the tower domain and the pin domain is mutated to cysteine.

[0031] Preferably, one or more amino acids in the amino acid sequence of SEQ ID NO.1 are substituted, including any one or a combination of the following mutations:

[0032] N67K, D128H, F338C, Q312R, N67R, V151K, G371C, S327W, E75G, V151W, H390K, S337M, G98 C. V151R, H390R, W344L, E99C, D286K, H390W, D361A, L103Y, S288E, D406A, Y397F, L103W , V333C, D406R, T399I, L46M, A93R, E227F, D414E, G47Y, S161W, R240T, I418L, S52I, A17 9P, Q267E, T421V, K59R, I181L, S274P, C214V, N67H, S184A, V304F, F307W, S71Y, L368C.

[0033] The mutation sites of the molecular motor having a non-natural amino acid sequence obtained by mutating the amino acid sequence of SEQ ID NO.1 may include one, two, three, four, five, six, seven, eight, nine, ten or more of the above.

[0034] Preferably, the amino acid sequence mutation site of SEQ ID NO. 1 may be G98C / L368C, or E99C / L368C, or G98C / S337C, or E99C / S337C, which can increase the stability of nucleic acid binding.

[0035] Insertion of one or more amino acids into the amino acid sequence of SEQ ID NO.1 includes any one or more of the following situations:

[0036] Add a cysteine between E97-T100;

[0037] A cysteine was added between L368-G371;

[0038] Add 1-15 positively charged amino acid sequences after R301, for example, SVLKCRNIDYQLV, TFVKARGVPGEYLIR or EYLTKTK;

[0039] Add 1-10 negatively charged amino acid sequences after S273, for example, DINYEGFQEI or DGKPSEII;

[0040] You can also add EDSKS or DSDKD after D278;

[0041] You can also add VR after V271.

[0042] The amino acid sequence of SEQ ID NO.1 may contain one or more amino acids missing from any of the following situations:

[0043] The amino acid sequence between T26 and N31 is deleted.

[0044] The second aspect of the present application also provides a construct comprising the above-mentioned molecular motor and an additional polynucleotide binding portion, such as continuous T, wherein the molecular motor is connected to the polynucleotide binding portion, and the construct has the ability to control the movement of the polynucleotide.

[0045] The construct is a useful tool for controlling the movement of polynucleotides during chain sequencing. The construct has a stronger ability to bind to the polynucleotide and is less likely to be detached from the polynucleotide being sequenced. The construct can also provide a greater read length for the polynucleotide.

[0046] The molecular motor and polynucleotide binding moiety can be prepared separately and then linked together. The two components can be linked in any configuration, either through terminal amino acids or through amino acids within the sequence.

[0047] The molecular motor and the polynucleotide binding portion can also be genetically fused, possibly via their terminal amino acids.

[0048] The third aspect of the present application further provides a nucleic acid, which encodes the above-mentioned molecular motor, or the nucleic acid encodes the above-mentioned construct.

[0049] The fourth aspect of the present application further provides an expression vector, which includes the above-mentioned nucleic acid.

[0050] Preferably, the nucleic acid is operably linked to a regulatory element in an expression vector, wherein the regulatory element is preferably a promoter.

[0051] In a specific embodiment of the present application, the promoter is selected from T7, trc, lac, ara or λ L .

[0052] Preferably, the expression vector includes but is not limited to plasmid, virus or phage.

[0053] The fifth aspect of the present application further provides a host cell, which comprises the above-mentioned nucleic acid or the above-mentioned expression vector.

[0054] Preferably, the host cell includes but is not limited to Escherichia coli.

[0055] The sixth aspect of the present application also provides applications of the above-mentioned molecular motor or the above-mentioned construct, including: translocation of ratchet chain RNA sequences, DNA sequences and amino acid sequences, nanopore sequencing, and isothermal polymerase chain reaction.

[0056] The molecular motor has the ability to control the movement of a polynucleotide, and the ability of the molecular motor to control the movement of a polynucleotide can be determined using any method known in the art. For example, the molecular motor can be brought into contact with the polynucleotide, and the location of the polynucleotide can be determined using standard methods. The ability of the molecular motor to control the movement of a polynucleotide is often applied in nanopore sequencing technology to improve the accuracy of nanopore sequencing.

[0057] The molecular motors described in this application are also useful tools for isothermal polymerase chain reactions. In this method, double-stranded DNA is typically first unwound into single strands by the molecular motors described in this application and then coated with single-stranded DNA-binding proteins. Specific primers and DNA polymerase are then added to promote DNA chain extension. In this application, the molecular motors described in this application can be fused with the polymerase to achieve simultaneous amplification of the target sequence.

[0058] The seventh aspect of the present application also provides a method for controlling the movement of a polynucleotide, wherein the polynucleotide is brought into contact with the above-mentioned molecular motor or the above-mentioned construct, thereby controlling the movement of the polynucleotide.

[0059] Preferably, the method is for controlling the movement of a polynucleotide through a transmembrane protein pore.

[0060] Preferably, the transmembrane protein pore is derived from a hemolysin, an interleukin, Mycobacterium smegmatis protein A (MspA), Mycobacterium smegmatis protein B (MspB), Mycobacterium smegmatis protein C (MspC), Mycobacterium smegmatis protein D (MspD), a lysin, outer membrane porin F (OmpF), outer membrane porin G (OmpG), outer membrane phospholipase A and Neisseria autotransporter (NalP).

[0061] The eighth aspect of the present application also provides a method for characterizing a target polynucleotide, comprising:

[0062] contacting the target polynucleotide with a transmembrane protein pore and the molecular motor or the construct, such that the molecular motor or the construct controls the movement of the target polynucleotide through the transmembrane protein pore;

[0063] As the target polynucleotide moves relative to the transmembrane protein pore, one or more measurements are taken, wherein the measurements represent one or more characteristics of the target polynucleotide and thereby characterize the target polynucleotide.

[0064] Preferably, the one or more characteristics are selected from (i) the length of the target polynucleotide; (ii) the identity of the target polynucleotide; (iii) the sequence of the target polynucleotide; (iv) the secondary structure of the target polynucleotide; and (v) whether the target polynucleotide is modified.

[0065] The one or more characteristics are measured by electrical measurement and / or optical measurement; the electrical measurement includes current measurement, impedance measurement, tunneling measurement or field effect transistor measurement.

[0066] The ninth aspect of the present application further provides an agonist for promoting the unwinding activity of the above-mentioned molecular motor, wherein the agonist comprises: 0.01-100 mM Co2+ , Ni 2+ , Cu 2+ , Mn 2+ , Zn 2+ At least one ion in.

[0067] Compared with the prior art, the advantages of this application include:

[0068] The molecular motor provided in the present application has a low degree of sequence homology with the molecular motor sequences disclosed in the prior art; the molecular motor structurally includes a tower domain, a pin domain and a hook domain, wherein the double β-folded region in the tower domain is short, the double α-helical domain is long, and the hook domain is degenerate, and this structure is conducive to the binding of nucleic acids to the molecular motor.

[0069] The molecular motor provided by the present invention has unwinding activity in both the 5'-3' and 3'-5' directions. When used in nanopore sequencing, the molecular motor binds to the DNA chain more efficiently. By recombining the amino acid sequences of the hook, tower and pin domains of the molecular motor, the switching regulation of the 5'-3' or 3'-5' unwinding direction can be achieved.

[0070] The activity of the molecular motor provided in the present application is significantly higher than that of existing molecular motors, which accelerates the speed of unwinding. The molecular motor can achieve speed control of nucleotide movement.

[0071] The molecular motor provided in the present application can tolerate low temperatures, salt ions, and metal ions, thereby improving the adaptability of the molecular motor to environmental solutions, and the speed of unwinding can be controlled by regulating the solution environment.

[0072] molecular motors

[0073] The present application also provides a method for screening variants of the molecular motor, by which molecular motors with more novel sequences but similar functional domains can be obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope of the present application.

[0075] Figure 1A This is a schematic diagram of the structure of the molecular motor in this application. Figure 1B A schematic diagram of the structure of a molecular motor in the prior art;

[0076] Figure 2 A schematic diagram of the conserved sites in the structure of the molecular motor of this application;

[0077] Figure 3 This is an evolutionary tree analysis diagram of the molecular motors used in this application;

[0078] Figure 4 This is a diagram showing the expression and purification results of the molecular motor of this application;

[0079] Figure 5 The results are the characterization of the 3'-5' unwinding activity and 5'-3' unwinding activity of the molecular motor of this application;

[0080] Figure 6 The figure shows the molecular motor activity results of the G98C / L368C mutation;

[0081] Figure 7 The figure shows the molecular motor activity results of the E99C / L368C mutation;

[0082] Figure 8 The figure shows the molecular motor activity results of the G98C / F338C mutation;

[0083] Figure 9 The figure shows the molecular motor activity results of E99C / F338C mutation;

[0084] Figure 10 Graph showing the enzyme activity results of the molecular motor of the present application and the molecular motor of the prior art;

[0085] Figure 11 This is a graph showing the unwinding activity of the molecular motor in this application at different temperatures;

[0086] Figure 12 This is a graph showing the unwinding activity of the molecular motor in this application at different pH values;

[0087] Figure 13 This is a graph showing the unwinding activity of the molecular motor in this application at different salt concentrations;

[0088] Figure 14 This is a graph showing the unwinding activity of the molecular motor in this application under different metal ions;

[0089] Figure 15 Results of molecular motors controlling the movement of DNA through a nanopore for this application. DETAILED DESCRIPTION

[0090] The embodiments of the present application will be described in detail below in conjunction with specific examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present application and should not be considered as limiting the scope of the present application. In the examples, if specific conditions are not specified, the conditions are carried out according to conventional conditions or manufacturer recommendations. The reagents or instruments used are not specified by the manufacturer and are conventional products that can be purchased commercially.

[0091] Example 1 Sequence and structure analysis of SEQ ID NO.1 molecular motor

[0092] The applicant analyzed proteins of microorganisms in acidic mine drainage and obtained an amino acid sequence (SEQ ID NO. 1) from Leptospirillum ferriphilum that may interact with nucleic acids.

[0093] The amino acid sequence SEQ ID NO.1 molecular motor discovered in this application was subjected to structural analysis using structure prediction software, and the following was obtained: Figure 1A The molecular motor structure shown, Figure 1B This is the structure of the T4 PhageDda molecular motor described in patent document WOO2016055777A2. Comparison revealed that the tower domain of the molecular motor in SEQ ID NO. 1 of the present application has a shortened double β-sheet region of 24 amino acids, smaller than the 34 in T4 Phage Dda. The double α-helical domain is significantly longer at 53 amino acids than the 36 in T4 Phage Dda, and the hook domain is also reduced to 11 amino acids (compared to 18 in T4 Phage Dda).

[0094] Further comparison of the molecular motor sequence with those disclosed in prior patents revealed sequence similarities below 50%, as shown in Table 2, where the sequence names are UniProt protein database IDs. Therefore, the molecular motor represented by SEQ ID NO. 1 in the present application is a novel molecular motor.

[0095] Table 2 Sequence similarity percentages between SEQ ID NO.1 and existing patent documents

[0096]

[0097] Example 2 Variant Analysis of SEQ ID NO.1 Molecular Motor

[0098] This example provides a method for screening variant sequences of the molecular motor of SEQ ID NO. 1, the screening method comprising the following steps:

[0099] (1) Using the sequence of SEQ ID NO.1 as a template, the conserved sites between the sequence and structure were analyzed by The ConSurf Server (https: / / consurf.tau.ac.il / ), such as Figure 2 As shown. Using a self-developed python script to extract sequences that are conserved in structure and sequence, the conserved sequence of SEQ ID NO.1 is as follows:

[0100] ..S...T..Q..A.....................L...AGTGKT.....APTNKA..VL...........TH.LG....E..E.....................DE.SM....L....VGDPAQLPPV....S..F.....L....RQ...NAI...IR..................... .....R..A..N..V...N.....F..Q.....SEE.....................A.......................................................................................T.HKAQGST...D..D.....YATRP...L....

[0101] (2) The hidden Markov model HMMER v3.3 was used to search for amino acid sequence information matching the conserved sequence in the uniprotkb database (version number 2021_04), and CD-hit (0.98) was used to remove redundant data information.

[0102] (3) Locate and screen the amino acid sequence obtained in step (2) to obtain a candidate sequence.

[0103] (4) The candidate sequences were aligned using a multiple sequence alignment algorithm (MMseq2), the relative mismatch with known molecular motors was calculated, and the structure of the candidate sequences was analyzed to obtain the final sequence. There are 524 molecular motors based on variants of SEQ ID NO. 1. As shown in Table 1, the similarity of these 524 amino acid sequences with existing molecular motor sequences in the literature is less than 75%, indicating that they are novel molecular motors. Selective structural analysis revealed that these 524 molecular motors all have degenerate hook domains, such as Figure 3 shown.

[0104] Example 3 Preparation method of molecular motor

[0105] A nucleotide sequence encoding the amino acid sequence of SEQ ID NO. 1 was obtained by chemical synthesis. A histidine tag and a peptide-cleaving protease sequence, such as thrombin, were added to the C-terminus of the sequence. The sequence was transformed into the E. coli BL21 expression strain and single colonies were obtained by screening on agar plates containing 100 μg / mL antibiotics.

[0106] Pick a single colony and culture it at 37°C at 200 rpm until the OD is greater than 1.2. Expand the culture at a ratio of 1:200 (seed solution / culture medium). When the OD600 is greater than 0.6, add IPTG and lower the temperature to below 20°C and continue to culture for more than 14 hours. Collect the bacteria at 5000 g and wash them once with phosphate buffer (pH 7.4).

[0107] 150 mM NaCl, 15 mM Tris-HCl, 1 mM imidazole, 0.5 mM PMSF, and 5 mM β-mercaptoethanol (pH 8.0) were added to the cell suspension at a weight-to-volume ratio of 1:10 and mixed thoroughly. Cells were then lysed by sonication (1 s on, 2 s off, 20 min). Cell debris was removed at 10,000 g, and the supernatant was filtered through a 0.22 μm filter and purified by injection onto a Ni agarose column.

[0108] The cell membrane was washed sequentially with solution A (500 mM NaCl, 15 mM Tris-HCl, 1 mM imidazole, 5 mM β-mercaptoethanol, pH 8.0), solution B (500 mM NaCl, 15 mM Tris-HCl, 20 mM imidazole, 5 mM β-mercaptoethanol, pH 8.0), and solution C (500 mM NaCl, 15 mM Tris-HCl, 50 mM imidazole, 5 mM β-mercaptoethanol, pH 8.0), and the protein was collected by adding eluent (500 mM NaCl, 15 mM Tris-HCl, 300 mM imidazole, 5 mM β-mercaptoethanol, pH 8.0).

[0109] The collected protein was exchanged in buffer D (15mM Tris-HCl, 150mM NaCl, 0.5mM EDTA, 5mM β-mercaptoethanol, pH 8.0) combined with a GE Superdex 200Increase SEC column. The results of each step of protein expression and purification are shown in Figure 2. Figure 4 Finally, the eluted protein was stored in 50% glycerol and frozen at -80°C.

[0110] Example 4: Activity Characterization Method of Molecular Motor

[0111] Characterization method of 3'-5' unwinding activity:

[0112] The molecular motor was chemically synthesized into three chains: a: 5'-FAM-GCGACATCAGCGGTACTAGTTAACTAGTACT8-3', b: 3'-BHQ1-CGCTGTAGTCGCCATGATCAATTGATCATG-5', and c: 5'-GTACTAGTTAACTAGTACCGCTGATGTCGC-3'. The 5' end of chain a has carboxyfluorescein, the 3' end of chain b has a black hole quencher BHQ-1, chain b is completely hybridized and complementary to chain a, and chain a also has a ssDNA protrusion. Chain c has the same sequence as chain b but does not have the black hole quencher BHQ-1.

[0113] Chains a and b are mixed in a 1:1 ratio and incubated at 95°C for 10 minutes, then gradually cooled to room temperature to allow hybridization. At this point, the fluorescence from carboxyfluorescein is quenched by the black hole quencher BHQ-1, rendering the substrate essentially luminescent. Annealed chains a and b are then added to the reaction system, followed by a 1.5-fold increase in chain c. A molecular motor is added to a buffer solution (300 mM NaCl, 15 mM Tris-HCl, 10 mM MgCl2, pH 7.5) to disentangle the hybridized chains a and b. Excess chain c preferentially anneals with the disentangled chain b, causing carboxyfluorescein to emit fluorescence, which can be detected using a fluorescence quantitative PCR instrument.

[0114] Characterization method of 5'-3' unwinding activity:

[0115] Three chains, D: 5'-T8GTACTAGTTAACTAGTACCGCTGATGTCGC-3'-FAM, E: 3'-CATGATCAATTGATCATGGCGACTACAGCG-5'-BHQ1 and F: 5'-GTACTAGTTAACTAGTACCGCTGATGTCGC-3', were chemically synthesized. The 3' end of the D chain contained carboxyfluorescein, and the 5' end of the E chain contained the black hole quencher BHQ-1. The E chain was completely hybridized and complementary to the D chain, and the D chain also had an ssDNA protrusion. The rest of the chain was the same as the 3'-5' end activity verification method.

[0116] The results are as follows Figure 5 As shown, Figure 5The Control is a control group without the addition of a molecular motor, Lf-WT-3'+ is the 3'-5' unwinding activity with the addition of TMAD, Lf-WT-3'- is the 3'-5' unwinding activity without the addition of TMAD, Lf-WT-5'+ is the 5'-3' unwinding activity with the addition of TMAD, and Lf-WT-5'- is the 5'-3' unwinding activity without the addition of TMAD. TMAD is azodicarbonamide. The molecular motors in the prior art can react with the cysteine of the molecular motor to form a disulfide bond by adding TMAD, thereby making the binding to DNA more stable. Figure 5 The results show that the molecular motor of SEQ ID NO.1 exhibits high unwinding activity at both the 5' to 3' and 3' to 5' ends. The molecular motor of the present application has no directional preference, and the unwinding activity of the molecular motor of the present application is almost unaffected regardless of whether TMAD is added during the unwinding process.

[0117] Example 5 Mutant modification of the molecular motor SEQ ID NO.1

[0118] Using the AMBER-99SB force field and the TIP3P water model, GROMACS 2021 software and NAMD3, the obtained SEQ ID NO.1 sequence was modified by the following method in Table 3 to design mutants, and the mutant molecular motor was expressed by the method of Example 3. The activity of the mutant molecular motor was investigated by the method of Example 4, and the unwinding buffer was a high salt buffer (600mM NaCl, 15mM Tris-HCl, 10mM MgCl2, 0.5mM EDTA). The results are shown in Figure 3. Figure 6 , 7, 8 and 9, where Figure 6 The molecular motor activity of the G98C / L368C mutation, Figure 7 The molecular motor activity of the E99C / L368C mutation, Figure 8 The molecular motor activity of the G98C / F338C mutation, Figure 9 The molecular motor activity of the E99C / F338C mutation, Figures 6 to 9 "+" indicates the addition of TMAD, and "-" indicates the absence of TMAD. The results show that the unwinding activity remains high in a 600 mM NaCl environment after mutation.

[0119] Table 3. Mutant modification methods of the molecular motor SEQ ID NO.1

[0120] Mutation method Structural changes effect G98C / L368C Cross-linking of tower and pin Increased nucleic acid binding stability E99C / L368C Cross-linking of tower and pin Increased nucleic acid binding stability G98C / F338C Cross-linking of tower and pin Increased nucleic acid binding stability E99C / F338C Cross-linking of tower and pin Increased nucleic acid binding stability R301In(EYLTKTK) Increase the length of the tower's beta sheet Improve tower stability V271In(VR) Increase the charge of the hook Enhanced binding to DNA D278In(EDSKS) Increase the length and charge of the hook Enhanced repulsion with DNA D278In(DSDKD) Increase the length and charge of the hook Enhanced repulsion with DNA

[0121] Example 6 Comparison of the Enzyme Activity of the Molecular Motor of SEQ ID NO.1 and the Molecular Motor of Existing Patents

[0122] The molecular motor of SEQ ID NO. 1 of the present application was purified by the method of Example 3 and compared with the activity of the T4 Phage Dda molecular motor in patent document WOO2016055777A2 and the Mph molecular motor in patent document WO2021 / 253410A1. Figure 10 As shown, after adding the SEQ ID NO.1 molecular motor (this patent group) of the present application scheme, the observed fluorescence value is significantly higher than the fluorescence value of the molecular motors in the existing patent documents WO2016055777A2 (T4 phageDda (WO2016055777A2) group) and WO2021 / 253410A1 (Mph (WO2021 / 253410A1) group), indicating that the molecular motor of SEQ ID NO.1 of the present application scheme has higher unwinding activity.

[0123] Example 7 Activity characteristics of SEQ ID NO.1 molecular motor

[0124] According to the method of Example 4, the unwinding activity of the molecular motor of the present application scheme under different conditions was characterized using SEQ ID NO.1 as a representative. The results are as follows Figures 11 to 14 As shown, Figures 11 to 14 They are the unwinding activity at different temperatures, the unwinding activity at different pH, the unwinding activity at different salt concentrations and the unwinding activity at different metal ions.

[0125] The results showed that the molecular motor of SEQ ID NO.1 can unwind in the temperature range of 10-40°C. Figure 11 ; Its most suitable pH range is pH7-9, such as Figure 12 ; The unwinding activity in 50-300mM NaCl solution is not much different, such as Figure 13 ; In different 10μm metal ion solutions, Co 2+ The activity is the highest, while copper and calcium have a strong inhibitory effect on unwinding, such as Figure 14 .

[0126] A single-channel electrophysiological device was used to conduct DNA unwinding experiments. The unwinding was performed using a single-channel MspA nanopore protein. The unwinding conditions were: 300 mM NaCl, 10 mM HEPES, 100 μM MgCl2, 5 mM ATP, pH 7, and 100 nM molecular motor. The molecular motor was the enzyme shown in SEQ ID NO.1. Figure 15 The process of DNA passing through the nanopore was recorded. As the DNA moved through the nanopore, a long characteristic block current was generated and the current level gradually changed.

[0127] The DNA sequence consists of a leading strand with a 3' cholesterol tag and a binding strand with eight Ts.

[0128] Binding strand: 5'-p-CCTTCCTGTTTGCGTGCCGGTCGGCTGGTTTTTTTT / iSpC18 / iSpC18 / iSpC18 / iSpC18 / TTGGCGGGTGGGGCCCATCAAAACACATAAGCATTCTCATGCAGGTCGTAGCC-3';

[0129] Leading strand: 5'-TTATGTGTTTTGATGGGCCCCACCCGCCAAAAAAATTTAAACCCAAA / iSpC3 / / cholesterol / -3'.

[0130] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some or all of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present application.

[0131] Furthermore, those skilled in the art will appreciate that although some embodiments herein include certain features included in other embodiments but not others, combinations of features from different embodiments are intended to be within the scope of this application and to form distinct embodiments. For example, in the claims above, any of the claimed embodiments may be used in any combination. The information disclosed in this background section is intended solely to enhance understanding of the overall background of this application and should not be construed as an admission or any implication that such information constitutes prior art known to those skilled in the art.

Claims

1. A molecular motor, characterized in that The molecular motor is selected from the following mutants of the amino acid sequence shown in SEQ ID NO.1: G98C / L368C, E99C / L368C, G98C / F338C, and E99C / F338C.

2. A construct, characterized in that The molecular motor according to claim 1 and an additional polynucleotide binding portion are connected to the molecular motor and the polynucleotide binding portion, and the construct has the ability to control the movement of the polynucleotide.

3. A nucleic acid, characterized in that The nucleic acid encodes the molecular motor according to claim 1, or the nucleic acid encodes the construct according to claim 2.

4. An expression vector, characterized in that The expression vector comprises the nucleic acid of claim 3.

5. A host cell, characterized in that The host cell comprises the nucleic acid according to claim 3 or the expression vector according to claim 4.

6. Use of the molecular motor according to claim 1 or the construct according to claim 2, characterized in that: The applications are: DNA sequence translocation, nanopore sequencing, and isothermal polymerase chain reaction.

7. A method for controlling the movement of a polynucleotide, characterized in that: The polynucleotide is brought into contact with the molecular motor according to claim 1 or the construct according to claim 2, thereby controlling the movement of the polynucleotide.

8. The method according to claim 7, characterized in that The method is used to control the movement of polynucleotides through transmembrane protein pores.

9. The method according to claim 8, characterized in that The transmembrane protein pore is derived from hemolysin, interleukin, Mycobacterium smegmatis protein A, Mycobacterium smegmatis protein B, Mycobacterium smegmatis protein C, Mycobacterium smegmatis protein D, lysin, outer membrane porin F, outer membrane porin G, outer membrane phospholipase A, and Neisseria autotransporter.

10. A method for characterizing a target polynucleotide, characterized in that include: contacting the target polynucleotide with a transmembrane protein pore and the molecular motor of claim 1 or the construct of claim 2, such that the molecular motor or the construct controls the movement of the target polynucleotide through the transmembrane protein pore; As the target polynucleotide moves relative to the transmembrane protein pore, one or more measurements are taken, wherein the measurements represent one or more characteristics of the target polynucleotide and thereby characterize the target polynucleotide.

11. The method according to claim 10, characterized in that The one or more characteristics are selected from (i) the length of the target polynucleotide; (ii) the identity of the target polynucleotide; (iii) the sequence of the target polynucleotide; (iv) the secondary structure of the target polynucleotide; and (v) whether the target polynucleotide is modified.

Citation Information

Patent Citations

  • Modified enzymes

    WO2016055777A2

  • Pif1-like helicase and application thereof

    WO2021253410A1

  • Pif1-like helicase and application thereof

    CN114599666A