Tomato TCP transcription factor SlTCP15 gene and its use

Abstract

This invention discloses the tomato TCP transcription factor SlTCP15 gene and its uses. This invention is the first to obtain the tomato TCP transcription factor SlTCP15 gene from tomato, and verifies its function by knocking out SlTCP15 from tomato MT (micro TOM) using Agrobacterium-mediated transformation. It shows that the deletion of the SlTCP15 gene can simultaneously induce male sterility and abnormal floral organs in tomatoes, demonstrating that SlTCP15 plays a key role in the process of plant development.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a tomato TCP transcription factor S1TCP15 gene and a use thereof. Background Art

[0002] The global tomato planting area is about 5 million hectares. China is the country with the largest tomato planting area and the highest output in the world, with an annual output of about 55 million tons, accounting for about 7% of the total vegetable output. Today, the tomato industry has become an important part of my country's vegetable industry and is the fourth most planted vegetable variety in my country. Therefore, accelerating the development of tomato breeding has become a top priority in my country's tomato research.

[0003] Simplified seed production usually uses male sterile lines to prepare hybrids, thereby reducing the production cost of hybrid seeds and improving the quality of hybrids. As a self-pollinating crop, the process of artificial emasculation during the breeding process of tomatoes greatly increases the breeding cost. Male sterile lines do not require emasculation, which effectively simplifies the seed production process, reduces breeding costs, and improves seed purity.

[0004] TCP transcription factors are a class of transcription factors unique to plants. They can participate in the entire growth and development process of plants. The TCPs family can not only participate in the development of different organs by regulating the cell cycle, but also regulate the adaptability of plants by integrating endogenous and environmental signals. For example, in rice, corn, and soybeans, the class II TCP transcription factor TB1 can participate in the development of lateral branches. Therefore, using TCP transcription factors to study the mechanism of floral organ development is of great significance to the development process of tomato male sterility and the study of the related mechanisms of tomato anther and pollen development regulation. Summary of the invention

[0005] The object of the present invention is to provide a tomato TCP transcription factor S1TCP15 and its use.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The nucleotide sequence of the tomato TCP transcription factor SlTCP15 gene is shown in SEQ ID NO.1.

[0008] The protein encoded by the tomato TCP transcription factor S1TCP15 gene is selected from:

[0009] (1) Its amino acid sequence is shown in SEQ ID NO.2;

[0010] (2) a protein derived from (1) which is obtained by replacing, deleting or adding one or more (e.g., 1-30; preferably 1-20; more preferably 1-10; such as 5, 3) amino acid residues of the amino acid sequence of SEQ ID NO: 2 and has the function of the protein of (1); or

[0011] (3) A protein derived from (1) that has 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology with the protein sequence defined in (1) and has the function of the protein of (1).

[0012] Among them, SEQ ID NO.1 in the sequence consists of 750 bases, the first base from the 5' end is the transcription start site, the 748th to 750th bases are the stop codons, the coding frame is 747 bases, and a total of 249 amino acids are encoded.

[0013] Furthermore, the expression vector, recombinant vector or transgenic cell line containing the above gene and the method for obtaining the host cell containing the vector also fall within the protection scope of the present invention.

[0014] The main purpose of the present invention is to clone and identify the tomato TCP transcription factor SlTCP15 at the molecular level, so as to provide a theoretical basis for the study of the regulation mechanism of tomato floral organs and pollen development.

[0015] The present invention also discloses the use of inhibiting the expression of the S1TCP15 gene to cause plants to form abnormal flower organs and male sterile phenotypes.

[0016] The above application obtains plants with abnormal floral organs and male sterility symptoms by knocking out the above gene, and the method of knocking out the SlTCP15 gene is to use gene editing technology.

[0017] Among them, male sterility phenotypes include reduced pollen viability and pollen deformity.

[0018] As an embodiment of the present invention, a polynucleotide is cloned into a CRISRP vector by a conventional method, and the recombinant vector with the exogenous gene is introduced into a plant cell that can express the SlTCP15 protein, so that the SlTCP15 protein in the plant cell is deleted. A mutant plant with a SlTCP15 gene deletion can be obtained by regenerating the plant cell into a plant. The recombinant plasmid is transferred into the plant by Agrobacterium transformation.

[0019] In the present invention, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants, or forestry plants, etc. The plants can be, for example (but not limited to): dicotyledons, monocotyledons or gymnosperms.

[0020] As a preferred method, the "plant" includes but is not limited to: tomatoes of the Solanaceae family, and any plant having the gene or a homologous gene thereof is applicable. It is particularly suitable for plants that need to form a male sterile phenotype, such as cultivating seedless tomato varieties and seedless pomegranates to improve the taste; male sterile plants can be obtained by knocking out the homologous gene of the SlTCP15 gene. The present invention has the following advantages:

[0021] (1) The inventors used the Agrobacterium-mediated method to knock out SlTCP15 from tomato MT for functional verification, which is conducive to clarifying the role of SlTCP15 in regulating flower morphology from a molecular mechanism perspective, and has a positive guiding role in further clarifying the pollen development mechanism and breeding new tomato male sterile varieties, and provides a theoretical basis for the research and development of tomato male sterile lines.

[0022] (3) The deletion of SlTCP15 gene can simultaneously induce abnormal development of various organs of the whole tomato plant, resulting in symptoms such as male sterility and abnormal floral organs, which also reflects the key role of SlTCP15 in the reproductive development process of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the phylogenetic tree of the TCPs family in tomato and Arabidopsis;

[0024] Figure 2 These are two SlTCP15 knockout lines with different editing types;

[0025] Figure 3 The phenotypes of wild-type tomato WT, empty-vector control WT cas9, and knockout lines sltcp15-1 and sltcp15-2 plants are shown;

[0026] Figure 4 The floral organ phenotypes of wild-type tomato WT, empty vector control WT cas9, and gene knockout lines sltcp15-1 and sltcp15-2;

[0027] Figure 5 These are the pollen observation pictures of wild-type tomato WT, empty-vector control WT cas9, and gene knockout lines sltcp15-1 and sltcp15-2. DETAILED DESCRIPTION

[0028] The present invention will be described in detail below through specific embodiments. These embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0029] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be purchased from the market.

[0030] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0031] The inventor obtained the SITCP15 gene sequence based on the tomato genome using bioinformatics technology. This gene is a tomato TCP transcription factor. The phylogenetic tree of the TCPs family in tomato and Arabidopsis is shown in Figure 1 The SlTCP15 gene belongs to the first class of TCP transcription factors (CLASS I) and is a homologous gene of Arabidopsis TCP7 and TCP21 (Parapunova et al., 2014). The present invention connects it with a plant editing vector and then introduces it into a wild-type tomato for phenotypic identification.

[0032] Example

[0033] 1. Isolation of SlTCP15 gene

[0034] Total RNA was extracted from MT tomato seedlings according to the instructions of Trizol extraction reagent (Takara), and the first-strand cDNA was synthesized according to the reverse transcription kit PrimerScript TM II 1st Strand cDNA Synthesis Kit (Takara) was used as the instruction. Tomato cDNA was used as the template and Primer STAR Max high-fidelity enzyme was used for amplification (Takara) with an annealing temperature of 58°C.

[0035] The full-length sequence of the SlTCP15 gene was obtained by PCR amplification using the following sequences as primers. The full-length sequence of the SlTCP15 gene is shown in SEQ ID NO.1 in the sequence list, totaling 750 bp, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2 in the sequence list, totaling 249.

[0036] The primer sequences are:

[0037] SlTCP15-F:

[0038] SlTCP15-R:

[0039] 2. Functional identification test of SlTCP15 gene

[0040] To study whether the SlTCP15 gene regulates pollen formation during pollen development, its function was identified through gene knockout lines of tomato.

[0041] 2.1 Construction of recombinant vector

[0042] The target site, CTCGATTCTACCACCGGCTCCGG, was selected at the front end of the exon of the SlTCP15 gene. The sgRNA-SlTCP15 fragment was recovered and purified and linked to the vector after enzyme digestion to obtain the S1TCP15-CRISPR recombinant plasmid. Tomato genetic transformation was carried out through Agrobacterium-mediated to obtain tomato SlTCP15-CRISPR transformed seedlings.

[0043] 2.2 Screening of transgenic positive strains

[0044] Take 100 mg of leaves from resistant plants and extract total genomic DNA using the CTAB method. Design specific primers based on the target gene sequence (the primer sequence is the same as the amplification sequence mentioned above), perform PCR amplification, and send samples for sequencing. The presence of double peaks at the mutation site is considered to be gene editing. After harvesting the transgenic positive plants with gene editing, homozygous transgenic lines are isolated from the T2 generation plants. After sequencing and identification, two SlTCP15 homozygous gene knockout lines with different editing types were obtained: sltcp15-1 (6bp deletion), sltcp15-2 (14bp insertion, 41bp deletion, and SNP changes) ( Figure 2 ).

[0045] 2.3 Phenotypic analysis of transgenic positive strains

[0046] The wild-type tomato WT, empty-load control WT cas9, and gene knockout lines sltcp15-1 and sltcp15-2 were germinated in moist nutrient soil for seven days and then transplanted. The seedlings were cultured under long-day conditions (16-hour light / 8-hour dark cycle) at 25°C during the day and 22°C at night, and their phenotypes were observed. Figure 3 The phenotypic observation diagram of five-week-old WT, WT cas9, sltcp15-1 and sltcp15-2 shows that the growth of SlTCP15 knockout lines sltcp15-1 and sltcp15-2 is inhibited, and some leaves develop abnormally, while no abnormality is observed in WT cas9. The mature flower organs of the mutants are also observed. Figure 4It can be seen that the floral organs of the SlTCP15 knockout lines sltcp15-1 and sltcp15-2 have obvious deformities.

[0047] The mature pollen of the SlTCP15 knockout line was observed by environmental scanning electron microscopy ( Figure 5 ), we found that the proportion of deformed pollen in the SlTCP15 knockout line was significantly increased compared with WT and WT cas9. At the same time, after staining the mature pollen of WT, WTcas9, sltcp15#1 and sltcp15#2 with TTC dye for 30 minutes, it was observed that the pollen viability of the SlTCP15 gene knockout lines sltcp15-1 and sltcp15-2 was significantly reduced. On the other hand, after the mature pollen of WT, WT cas9, sltcp15#1 and sltcp15#2 was placed in in vitro germination medium and cultured for 5 hours, the results of the pollen in vitro germination experiment showed that the pollen germination rate dropped below 20%. Overall, compared with the wild type and empty control WTcas9, the pollen development of the SlTCP15 gene knockout lines sltcp15-1 and sltcp15-2 plants was significantly abnormal, forming a male sterile phenotype.

[0048] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, other implementation methods can certainly be easily made by replacement or modification based on the technical contents disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. Inhibition of Tomato TCP Transcription Factor SlTCP15 Use of gene expression in causing floral organ abnormality and / or causing plants to form male sterile phenotypes, characterized in that: Said SlTCP15 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the plant is tomato.

2. The use according to claim 1, characterized in that Said SlTCP15 The amino acid sequence of the gene is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that Inhibition of tomato TCP transcription factor SlTCP15 Knockout SlTCP15 Gene.

4. The use according to claim 3, characterized in that Knockout SlTCP15 Genes through gene editing technology.

5. The use according to claim 1, characterized in that: The male sterile phenotype includes reduced pollen viability and pollen deformity.

Images