A tobacco calcium ion receptor-related gene and its application

Abstract

The present invention discloses a tobacco calcium ion sensor-related gene and its application. The gene is named tobacco NtCBL4 gene, and its nucleotide sequence is: the nucleotide sequence shown in SEQ ID NO.1; a nucleotide sequence having the same function as the nucleotide sequence shown in SEQ ID NO.1 by substitution, deletion, and / or addition of one or more nucleotides; and a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions, wherein the stringent conditions are hybridization in 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS at 65°C, and the membrane is washed with the solution. The present invention can control the salt tolerance of tobacco by regulating the expression level of the NtCBL4 gene, and obtain transgenic crops with different NtCBL4 gene expression levels and different salt tolerances through genetic engineering. Overexpression of NtCBL4 can reduce tobacco's tolerance to high salt.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a tobacco calcium ion receptor-related gene and application thereof. Background Art

[0002] Soil salinization is a growing global resource and environmental problem. Salt stress severely impacts crop growth and development, leading to significant reductions in yield and quality. In my country, saline-alkali land accounts for 6.62% of the country's arable land and is increasing annually, yet it remains underutilized. The discovery and utilization of new salt-tolerant plants is essential. Tobacco, with its high salt-alkali tolerance and ability to complete its life cycle on saline-alkali soils, has significant development potential due to its high biomass, high protein content, and comprehensive economic value. It can be used for the extraction of high-value-added compounds and the production of pharmaceutical proteins and vaccines, making it a resource plant with significant potential. Despite this, research on tobacco's salt stress response and salt tolerance mechanisms is limited. Knowledge of tobacco's own salt-tolerance or salt-stress-responsive genes is extremely limited. Identifying genes associated with salt-alkali tolerance and improving tobacco varieties with salt-alkali tolerance through genetic engineering will facilitate research on tobacco's salt tolerance mechanisms and enhance its potential for use in saline-alkali soils. This is crucial for the development and utilization of saline-alkali soils, alleviating my country's arable land shortage, and ensuring food security.

[0003] Calcium ions (Ca 2+ ) is a second messenger commonly found in plant cells. When plants are stimulated by external stimuli, intracellular Ca 2+ The concentration of calcium undergoes spatiotemporal changes, forming a calcium signal. This calcium signal is sensed by calcium receptors, and the signal is transduced to downstream effector proteins, triggering physiological and biochemical reactions in plant cells, thereby participating in plant growth, development, and stress response processes. Calcineurin B-like protein (CBL) is a type of tobacco calcium ion sensor. Members of this family and its CBL-interacting kinase protein (CIPK) family members form a complex and sophisticated CBL-CIPK signal regulation network, which plays an important role in decoding abiotic stress-induced Ca2+ signals and subsequent signal transduction. The Arabidopsis thaliana AtCBL4-AtCIPK24-SOS1 (SOS pathway) is the first salt stress response regulatory pathway identified in plants. This pathway maintains intracellular ion balance by secreting Na+, reducing the damage of high salt stress to plants and improving plant salt tolerance. Similar pathways have also been identified in species such as rice, poplar, Brassica napus, and Populus euphratica. Studies have shown that overexpressing Arabidopsis thaliana AtCBL4 or other AtCBL4 Homologous genes all improved the salt tolerance of transgenic materials to a certain extent.

[0004] As a major cash crop in the Solanaceae family, tobacco exhibits strong salt tolerance and is a promising resource for saline-alkali land development. However, research on genes associated with salt tolerance in tobacco is limited. With the advancement of gene editing technology, identifying and uncovering genes that negatively regulate salt tolerance in tobacco is becoming a new strategy. Screening and identifying genes that negatively regulate salt tolerance through functional analysis and applying these genes has significant scientific significance and application value. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a gene related to tobacco calcium ion receptors and its application. In view of the current situation that tobacco is a potential salt-tolerant crop, the function of its CBL calcium ion receptor in salt tolerance has not been deeply explored. A tobacco-derived gene that negatively regulates tobacco salt tolerance has been discovered and its application has been expanded.

[0006] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0007] A tobacco calcium ion sensor-related gene, the gene is named tobacco NtCBL4 The nucleotide sequence of the gene is:

[0008] (1) The nucleotide sequence shown in SEQ ID NO. 1;

[0009] (2) A nucleotide sequence having the same function as the nucleotide sequence shown in SEQ ID NO. 1, wherein one or more nucleotides are replaced and / or deleted and / or added;

[0010] (3) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO. 1 under stringent conditions,

[0011] The stringent conditions are hybridization at 65°C in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS, and washing the membrane with the solution.

[0012] Preferably, the NtCBL4 The amino acid sequence of the gene-encoded protein is:

[0013] (1) the amino acid sequence shown in SEQ ID NO. 2;

[0014] (2) The amino acid sequence shown in SEQ ID NO. 2 has the same functional sequence after substitution and / or deletion and / or addition of one or more amino acids;

[0015] (3) an amino acid sequence that hybridizes with the sequence shown in SEQ ID NO. 2 under stringent conditions,

[0016] The stringent conditions are hybridization at 65°C in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS, and washing the membrane with the solution.

[0017] A biological material comprising an NtCBL4 gene, wherein the biological material is a recombinant expression vector, an expression cassette or a recombinant bacterium.

[0018] The invention discloses an application of a biological material in cultivating transgenic plants with different degrees of salt tolerance.

[0019] Preferably, the NtCBL4 gene can negatively regulate tobacco's response to Na + Overexpression of the NtCBL4 gene can reduce the tolerance of plant leaves to high salt; conversely, knocking out the NtCBL4 gene can increase the tolerance of plant leaves to high salt.

[0020] Preferably, the transgenic plant is tobacco.

[0021] A method for cultivating transgenic plants with different degrees of salt tolerance, comprising: introducing a recombinant expression vector of the NtCBL4 gene into a recipient plant to obtain transgenic plants; or constructing a CRISPR / Cas9 editing vector for knocking out the NtCBL4 gene through CRISPR / Cas9-mediated gene editing technology, and obtaining tobacco plants in which the NtCBL4 gene is edited after genetic transformation.

[0022] Preferably, the promoter for initiating transcription of the protein-encoding gene in the recombinant expression vector is a 35S promoter, and the recombinant expression vector includes a binary Agrobacterium vector and a vector suitable for plant microprojectile bombardment. The recombinant expression vector contains the 3' untranslated region of the exogenous gene, namely, a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3' end of the mRNA precursor.

[0023] Preferably, the plant expression vector is pCAMBIA-1300-221, pGreen0029, pCAMBIA3301, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN, pORE-Cas9, pYLCRISPR / cas9-MT, pCas9gRNA7, pCas9gRNA7-GFP or other derived plant expression vectors.

[0024] When using the gene to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific or inducible promoter can be added before its transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-inducible promoter rd29A, etc. They can be used alone or in combination with other plant promoters.

[0025] Furthermore, when constructing recombinant expression vectors using the genes of the present invention, enhancers, including translational enhancers and transcriptional enhancers, may also be used. These enhancer regions may be located within the ATG start codon or adjacent start codons, but must be in frame with the coding sequence to ensure proper translation of the entire sequence. The sources of translational control signals and start codons are diverse and may be natural or synthetic.

[0026] The translation initiation region can be derived from a transcription initiation region or a structural gene. To facilitate identification and screening of transgenic plant cells or plants, the recombinant expression vector can be modified, such as by adding a gene encoding a color-changing enzyme or luminescent compound that can be expressed in plants, an antibiotic resistance marker, or a chemical resistance marker gene. Alternatively, the transformed plants can be directly screened for stress without adding any selectable marker genes.

[0027] More specifically, the recombinant expression vector is a recombinant plasmid obtained by inserting the NtCBL4 gene between the multiple cloning sites KpnⅠ and XbaⅠ of the pCHF3 vector.

[0028] In the above method, the recombinant expression vector carrying the NtCBL4 gene is introduced into the recipient plant, specifically by transforming plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and cultivating the transformed plant tissues into plants.

[0029] A tobacco variety is cultivated by the above method.

[0030] The above technical solution of the present invention has the following beneficial effects:

[0031] The present invention can be adjusted NtCBL4 Gene expression levels control salt tolerance in tobacco, obtained through genetic engineering NtCBL4 Transgenic crops with different gene expression levels and different salt tolerance.

[0032] The invention meets the needs of modern agricultural development and has important practical value and market prospects for studying the salt tolerance mechanism of tobacco, increasing the new functional utilization of tobacco, and improving the utilization rate of saline-alkali land.

[0033] Overexpression NtCBL4 It can reduce the tolerance of tobacco to high salt. Conversely, knocking out NtCBL4 can increase the tolerance of tobacco to high salt. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0035] Figure 1 for NtCBL4 Protein sequence analysis. (a) NtCBL4 and AtCBL4 The same amino acids are shown in black background. (b) CBL4 Protein phylogenetic analysis.

[0036] Figure 2 To test the effect of salt stress (100 mM NaCl) on the wild type (WT) and NtCBL4 RT-qPCR analysis of endogenous (A) and exogenous (B) expression in leaves of overexpression lines (OE-2 and OE-9) NtCBL4 Relative expression analysis.

[0037] Figure 3 9 days after the start of treatment, the wild type (WT) and NtCBL4 Phenotypes of tobacco leaves from overexpressing strains (OE-2 and OE-9). Scale bar = 10 cm. (A-F) Phenotypes of WT and NtCBL4-overexpressing strains under control conditions (1 / 2 Hoagland nutrient solution), osmotic stress (1 / 2 Hoagland nutrient solution supplemented with 15% PEG6000), and ionic stress (1 / 2 Hoagland nutrient solution supplemented with 100 mM NaCl, 100 mM NaNO₃, 100 mM KCl, and 100 mM KNO₃, respectively). Scale bar = 10 cm.

[0038] Figure 4 9 days after the start of treatment, the wild type (WT) and NtCBL4 Evaluation of ionic and osmotic stress in tobacco leaves of overexpression lines (OE-2 and OE-9). (AD) WT and NtCBL4 The plant height, stem fresh weight, fifth leaf width, and fifth leaf length of the overexpressing lines (n=6) were analyzed for statistical significance using one-way ANOVA with LSD test (*p<0.05 and **p<0.01). DETAILED DESCRIPTION

[0039] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that unless otherwise specifically stated, the relative arrangement of components and steps, numerical expressions and numerical values ​​set forth in these embodiments do not limit the scope of the present invention.

[0040] Example 1, containing NtCBL4 Construction of gene expression vector

[0041] NtCBL4 Primers used in the construction of gene expression vectors

[0042] For cloning NtCBL4 CDS Sequence primers:

[0043] NtCBL4-F: ATGGGCTGCTTTCACTCC;

[0044] NtCBL4-R:TTAGACTTCCAAATCTTCAACC.

[0045] This study used the homology cloning method. AtCBL4 The CDS sequences of the 147 genes were compared with those of the 147 genes, and a CDS sequence with a full length of 686 bp was obtained from the NCBI (http: / / www.ncbi.nlm.nih.gov / ) database. CBL Family genes and AtCBL4 High homology (e.g. Figure 1 shown), named NtCBL4 (GenBank No.LOC107791794), and the corresponding primer pair NtCBL4-1F / NtCBL4-1R was designed.

[0046] In order to obtain NtCBL4 Overexpression vector, using Kpn Ⅰ / Xba Ⅰ digested the pMD19-T-NtCBL4 plasmid and ligated the target fragment after enzyme digestion Kpn Ⅰ / Xba I digested pCHF3.

[0047] NtCBL4-F- Kpn Ⅰ:GGGTACCATGGGCTTGCTTTCACTCC;

[0048] NtCBL4-R- Xba Ⅰ: CTCTAGATTAGACTTCCAAATCTTCAACC.

[0049] Example 2, containing NtCBL4 Gene transformation and screening of transgenic plants

[0050] NtCBL4 Primers used for gene transformation and screening of transgenic plants

[0051] Used for NtCBL4 Positive identification of overexpressing material:

[0052] pCHF3-62F: GCACAATCCCACTATCCTTCG;

[0053] NtCBL4-RTTAGACTTCCAAATCTTCAACC.

[0054] For RT-PCR and qPCR NtL25 Amplification:

[0055] NtL25-qF: CAAAAGTTACATTCCACCG;

[0056] NtL25-qR:TTTCTTCGTCCCCATCAGGC.

[0057] For detection of endogenous NtCBL4 Expression levels:

[0058] NtCBL4-qF:GCACTGCTGCATGAATC;

[0059] NtCBL4-qR: GCATCATCACTGTGGAATAT.

[0060] Used for detection of exogenous NtCBL4 Expression levels:

[0061] NtCBL4-qF:GCACTGCTGCATGAATC;

[0062] pCHF3-Allcheck:GATGATACGAACGAAAGCTCTGC.

[0063] In order to obtain NtCBL4 For overexpression lines, the pCHF3-NtCBL4 vector was transformed into Agrobacterium tumefaciens EHA105 and then introduced into the tobacco variety Zhongyan 100 (ZY100) via Agrobacterium-mediated transfection. Transgenic lines were confirmed by genomic PCR and RT-PCR. Transgenic lines were screened by seedling cultivation in 1 / 2 MS medium supplemented with 50 μg / ml kanamycin. Third-generation homozygous lines were obtained and used in experiments.

[0064] Example 3 NtCBL4 High salt tolerance experiment of overexpression lines

[0065] 1. To better understandNtCBL4 Two independent NtCBL4 Overexpression lines (OE-2, OE-9) were developed and their salt tolerance was evaluated. NtCBL4 Overexpression lines (OE-2, OE-9) NtCBL4 The expression of genes was significantly higher than that of the control group (e.g. Figure 2 shown).

[0066] 2. Using tobacco ZY100 (ZY100) and the T3 generation of the single-copy insertion obtained in Example 2 NtCBL4 Transgenic homozygous lines OE-2 and OE-9 were used as experimental materials. Culture conditions were 25°C and 70% relative humidity with a 24-hour light intensity (7500 lux). Tobacco seeds were first sown in soil. For salt treatment, 20 days after seed germination, tobacco plants were transplanted into floating rockwool trays and hydroponically cultured in 1 / 2 Hoagland's nutrient solution. Six days after treatment, the plants were treated with the following: A: control, continued culture in 1 / 2 Hoagland's nutrient solution; B: osmotic stress: culture in 1 / 2 Hoagland's nutrient solution supplemented with 15% PEG (osmotic pressure similar to 100 mM NaCl); CF: ionic treatment: culture in 1 / 2 Hoagland's nutrient solution containing 100 mM NaCl, 100 mM NaNO₃, 100 mM KNO₃, and 100 mM KCl, respectively. Samples were collected and photographed nine days after the start of treatment. The results showed that salt stress induced osmotic and ionic stress in the plants. To determine which factor (osmotic or ionic) of 100 mM NaCl caused this necrotic phenotype, 15% PEG6000 simulated osmotic treatment (osmotic pressure similar to 100 mM NaCl) and ionic treatment (100 mM NaCl, 100 mM NaNO3, 100 mM KNO3 and 100 mM KCl) were performed. NtCBL4 The overexpression lines showed necrotic phenotype and growth inhibition only under 100 mM NaCl and 100 mM NaNO3 treatments, but not under osmotic stress or 100 mM KNO3 and 100 mM KCl treatments (e.g. Figure 3 、 Figure 4 shown).

[0067] These results indicate that NtCBL4 The salt-sensitive leaf necrosis of the overexpression line is influenced by Na + Induction.

[0068] In summary, the calcium ion sensor gene cloned from tobacco in the present invention can negatively regulate tobacco's response to Na + By regulating the expression of this calcium sensor gene, it will help to cultivate highly salt-tolerant crops and improve saline soil.

[0069] Although the present invention has been disclosed above with reference to the embodiments, they are not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention is defined by the claims and their equivalents.

Claims

1. An application of tobacco NtCBL4 gene in preparing salt-sensitive transgenic tobacco, characterized in that: The application is to improve tobacco NtCBL4 Gene expression level, reducing tobacco's Na + Tolerance of the tobacco NtCBL4 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that NtCBL4 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The genetic engineering method comprises: NtCBL4 The gene is inserted between the multiple cloning sites KpnⅠ and XbaⅠ of the pCHF3 vector to construct a recombinant expression vector, and the plant cells or tissues are transformed through the Agrobacterium-mediated method, and the transformed plant tissues are cultivated into plants.

4. The use according to claim 3, characterized in that The recombinant expression vector contains a 35S promoter for driving NtCBL4 Gene expression.

5. A method of overexpression NtCBL4 A method for genetically creating salt-sensitive transgenic tobacco, characterized in that: The following steps are involved: (1) constructing the recombinant expression vector according to any one of claims 3 to 4; (2) Introducing the recombinant expression vector into tobacco cells and screening to obtain NtCBL4 Transgenic plants that overexpress a gene.

Images