Preparation of csde1 gene-deficient zebrafish mutants and construction of a zebrafish hematopoietic stem cell development defect model

Abstract

The present invention relates to the field of genetic engineering, and specifically discloses a method for preparing a zebrafish mutant with a csde1 gene deletion and a method for constructing a zebrafish hematopoietic stem cell development defect model. The present invention uses CRISPR / Cas9 technology to achieve the specific knockout of the zebrafish csde1 gene for the first time, establishes a zebrafish with a csde1 gene deletion, and forms a stably inherited zebrafish hematopoietic stem cell development defect model. The present invention also provides a method for constructing a zebrafish hematopoietic stem cell development defect model. The constructed zebrafish hematopoietic stem cell development defect model can be used for high-throughput drug screening more efficiently and accurately, and can more accurately evaluate drug effects and drug toxicity.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and relates to a method for preparing a csde1 gene-deficient zebrafish mutant and a method for constructing a zebrafish hematopoietic stem cell development defect model. Background Art

[0002] The protein encoded by the cold shock protein csde1 (cold shock domain containing E1) is an RNA binding protein containing 5 cold shock domains (CSD). The CSD domain is extremely conserved in evolution and highly homologous in humans, mice and zebrafish. The CSD domain can mediate csde1 binding to single-stranded RNA and regulate the translation and stability of mRNA. Studies have shown that csde1 is widely expressed in various tissues throughout the body of mice and is essential for embryonic development, especially neural development. The lack of csde1 can lead to neural differentiation defects in mice, abnormal neuronal morphology and function, and further lead to the occurrence of autism. In addition, studies have found that in red blood cells isolated and cultured from patients with congenital pure red blood cell aplasia (Diamond-Blackfan anemia, DBA), the expression of CSDE1 protein is significantly lower than that of normal people, indicating that csde1 is involved in red blood cell development and maturation. Unfortunately, however, the study found that csde1 homozygous knockout mice died in the pre-embryonic period, so it was impossible to construct a csde1 knockout mouse model to deeply study the molecular function of csde1, and it was impossible to construct a disease model of csde1 gene deletion.

[0003] With its unique advantages, zebrafish has become one of the classic animal models for studying embryonic development. Zebrafish has the characteristics of in vitro fertilization, transparent embryos, small size, fast development, high reproduction rate, easy breeding and low cost, which is convenient for in vitro operation. In addition, using various transgenic strains of zebrafish, we can achieve real-time observation and tracking of the development of various tissues and organs under high-resolution fluorescence confocal microscopy. In addition, the zebrafish genome is highly conserved with mammals, making many research results in zebrafish applicable to mammals. Moreover, zebrafish have a short reproduction cycle and a large number of eggs, which can achieve high-throughput drug screening in a short period of time. Therefore, zebrafish has been widely used in the study of disease pathogenesis, especially the mechanism research and model construction of nervous system diseases and blood system diseases.

[0004] The present invention successfully constructed a csde1 gene-deficient zebrafish mutant using CRISPR / Cas9 gene editing technology for the first time, and confirmed that the mutant had a hematopoietic stem cell defect phenotype, indicating that the mutant constructed by the present invention can not only be used to study the molecular function of csde1, but also can be used as a disease model to study the pathogenesis of blood diseases, and can also be used for high-throughput drug screening in the future. Summary of the invention

[0005] The main purpose of the present invention is to provide a method for preparing a csde1 gene-deficient zebrafish mutant and constructing a zebrafish hematopoietic stem cell development defect model. The present invention utilizes CRISPR / Cas9 technology to knock out the csde1 gene in zebrafish and establish a csde1 gene-deficient zebrafish.

[0006] In order to achieve the above object, according to one aspect of the present invention, a method for preparing a csde1 gene-deficient zebrafish mutant is provided, comprising the following steps:

[0007] 1) Design and synthesize gRNA target site sequences specific to the csde1 gene;

[0008] 2) The target site gRNA for knocking out the zebrafish csde1 gene and the Cas9 protein were co-injected into the one-cell stage embryos of the wild-type zebrafish, and a stably inherited zebrafish csde1 gene deletion mutant was obtained by identification, screening and cultivation; the gRNA for targeting the knockout of the zebrafish csde1 gene was located on the 5th exon of csde1, and the sequence was the nucleotide sequence shown in SEQ ID NO.1: GGGAGTGGTTTGTGCTACCAAGG.

[0009] In another aspect, the present invention provides a method for constructing a zebrafish csde1 gene deletion mutant model, comprising the following steps:

[0010] S1. According to the gRNA target site specific to the csde1 gene, the upstream primer T7-csde1-F was designed and synthesized, and the sequence was the nucleotide sequence shown in SEQ ID NO.2: TAATACGACTCACTATAGGGAGTGGTTTGTGCTACCAGTTTTAGAGCTAGAAATAGC, and the downstream primer T7-csde1-R was the nucleotide sequence shown in SEQ ID NO.3: AGCACCGACTCGGTGCCACTTTT;

[0011] S2. Using the pMD19-gRNA scaffold plasmid as a template, PCR amplification was performed using the upstream primer T7-csde1-F and the downstream primer T7-csde1-R to obtain the double-stranded DNA template required for synthesizing gRNA, followed by in vitro transcription and purification;

[0012] S3. The target site gRNA and Cas9 protein for knocking out the zebrafish csde1 gene were co-injected into wild-type zebrafish one-cell embryos. The genomic DNA of the embryos with normal phenotypes after injection was extracted for PCR amplification and sequencing. The identification primers used included the upstream primer csde1-target34-F having the nucleotide sequence shown in SEQ ID NO.4: GCAGTCAGTTGTATAGGTGCAA and the downstream primer csde1-target34-R having the nucleotide sequence shown in SEQ ID NO.5: CCACATCGTCTCCAGCTTGT;

[0013] S4. The chimeric F0 generation of zebrafish with csde1 gene knockout was crossed with wild-type zebrafish to detect heritability and effective mutations, and the "-1+11" type F1 generation zebrafish was obtained. PCR amplification and sequencing were performed using identification primers, and the sequencing sequence was the nucleotide sequence shown in SEQ ID NO.6:;

[0014] S5. The "-1+11" type adult F1 generation zebrafish female and male fish are inbred, and the F2 generation csde1 gene knockout homozygous mutants are identified and screened by gene sequencing;

[0015] S6. The csde1 gene knockout homozygous mutant was crossed with a transgenic line that marked hematopoietic stem cells to obtain a stable line with a transgenic background.

[0016] In a third aspect, the present invention provides a method for detecting a csde1 gene-deficient zebrafish, using the csde1 gene-deficient zebrafish prepared by the above-mentioned preparation method.

[0017] In a fourth aspect, the present invention provides an application of a csde1 gene in preparing a zebrafish hematopoietic stem cell developmental defect model.

[0018] In a fifth aspect, the present invention provides an application of a csde1 gene-deficient zebrafish mutant prepared by the above-mentioned preparation method in high-throughput drug screening.

[0019] The beneficial effects of the present invention are:

[0020] 1) The present invention uses CRISPR / Cas9 technology to achieve the first specific knockout of the zebrafish csde1 gene, forming a mutant strain that can be stably inherited;

[0021] 2) The present invention provides a method for constructing a zebrafish hematopoietic stem cell developmental defect model. The construction method is simple, and the constructed zebrafish hematopoietic stem cell developmental defect model can be used for high-throughput drug screening more efficiently and accurately, and can more accurately evaluate drug effects and drug toxicity. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0023] Figure 1 :The expression of csde1 gene in wild-type zebrafish embryos at different stages;

[0024] Figure 2 :gRNA gel run results of csde1 gene;

[0025] Figure 3 :Construction of csde1 gene deletion mutant. A. Sequence diagram of csde1 gene and CRISPR / Cas9 targeting in zebrafish; B. Sanger sequencing peak diagram of csde1 (-1+11) homozygous mutant, with the red arrow indicating the location of the mutation point; C. Protein expression of csde1 in wild type and mutant;

[0026] Figure 4: Phenotypic analysis of csde1 gene deletion mutants. A. Schematic diagram of the morphological development of wild-type and csde1 gene deletion mutant zebrafish; B. Knockout of csde1 leads to the blockage of hematopoietic stem cell generation, proliferation and differentiation. DETAILED DESCRIPTION

[0027] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. It is to be understood that the specific embodiments described herein are only used to explain the present invention, rather than to limit the present invention. It should also be noted that, for ease of description, only some, rather than all, test results related to the present invention are shown in the accompanying drawings.

[0028] Example 1. Expression profile of zebrafish csde1. Wild-type zebrafish embryos at different stages (one-cell, shiled, 5-somites, 24 hours after in vitro fertilization, and 36 hours) were fixed and collected, and the expression of csde1 during zebrafish development was detected using whole-mount in situ hybridization (WISH). The results showed that csde1 was widely expressed from the early embryonic stage, and the expression gradually decreased with the development ( Figure 1 ).

[0029] Example 2. Confirmation of CRISPR / Cas9 gene knockout target site. The design principle and synthesis method of csde1 target site (target gRNA) are as follows:

[0030] Design principles:

[0031] The Cas9 target site (target point) contains 20 bases, of which the 5' end should be GG (Note: the selection of GG at the 5' end is not a requirement of the Cas9 target itself, but because the gRNA (guide RNA) in vitro transcription vector used in this experiment adopts the T7 promoter. The T7 promoter requires that the first two digits of the transcription start site are GG); the three bases adjacent to the 3' end of the target site constitute the PAM region, and the sequence is required to be NGG (N is an arbitrary base).

[0032] The target site should be selected in the first 2 / 3 of the gene CDS and after the ATG, but not in the last exon; it is best to destroy important domains and / or all transcripts. At the same time, it is also necessary to avoid the presence of additional start codons with the same reading frame (in-frame) downstream of the first start codon. The target site can also be selected at the junction of introns and exons to disrupt gene splicing. In principle, do not select 5'-UTR and 3'-UTR.

[0033] The designed target site sequence was blasted on the Ensembl website to confirm the uniqueness of the target site in the zebrafish genome.

[0034] The sequence of the gRNA targeting the zebrafish csde1 gene is GGGAGTGGTTTGTGCTACCAAGG (SEQ ID NO: 1), and the underlined part is the PAM region; the location of the csde1 gene target site is the 5th exon region.

[0035] Synthesis method:

[0036] First, prepare the DNA template required for synthesizing the gRNA double strand.

[0037] The PCR system is as follows:

[0038]

[0039] PCR conditions:

[0040]

[0041] The pMD19-gRNA scaffold plasmid template sequence used in the synthesis of gRNA products is (SEQ ID NO.7):

[0042] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT.

[0043] For each sample, two 50 μl aliquots were prepared, totaling 100 μl, and 1 μl was taken for electrophoresis. The obtained PCR product was purified by gel excision and finally eluted with 28 μl of water.

[0044] 2. In vitro transcription:

[0045] gRNA in vitro transcription system:

[0046]

[0047] Two 20μl systems were prepared for each gRNA. The gRNA in vitro transcription conditions were: 37℃ water bath for 2 hours and 30 minutes. After the reaction, 1μl DNaseⅠ was added to each reaction system and the DNA template was digested in a 37℃ water bath. To ensure that the DNA template was thoroughly digested, the DNaseⅠ digestion time was 40-50 minutes. After the reaction, 0.5-1μl was taken for electrophoresis to detect whether the gRNA was successfully synthesized ( Figure 2 ).

[0048] 3. gRNA Purification

[0049] Use Ambion's mirVana™ miRNA Isolation Kit to recover small RNA fragments: dilute the gRNA transcription system (combine two 20μl systems for each gRNA) to 300 μl with RNase-free water, and add 330 μl of anhydrous ethanol; add the solution to the recovery column and centrifuge at 10,000 g for 15 seconds (too high a speed will damage the filter membrane); add 700 μl of miRNA Wash Solution I and centrifuge for 5 to 10 seconds; add 500 μl of Wash Solution II and centrifuge for 5 to 10 seconds; repeat once; discard the liquid in the collection tube, centrifuge for 1 minute, and remove the remaining liquid; add an appropriate amount of RNase-free water or Elution Solution preheated at 95°C, centrifuge at maximum speed for 20 to 30 seconds, and collect the gRNA solution; take 1μl of each gRNA to measure the concentration.

[0050] 4. Microinjection

[0051] Mix gRNA and Cas9 protein and microinject into zebrafish one-cell embryos (at least 200 embryos are recommended for each target site). At the same time, keep some uninjected embryos from the same batch as controls, where the final concentration of gRNA is 150ng / μL, and the final concentration of Cas9 protein is 200ng / μL; the total volume V = 1μL.

[0052] 5. Check whether gRNA is effective:

[0053] 1 dpi (day after injection) embryos with normal phenotypes after injection were selected (30 embryos, 5 embryos / tube), genomic DNA was extracted, and sent for sequencing after PCR. The peak position was used to determine whether the gRNA was effective.

[0054] Example 3. A method for constructing a zebrafish csde1 gene deletion homozygous mutant:

[0055] A method for constructing a zebrafish csde1 gene deletion homozygous mutant, the steps are as follows:

[0056] (1) The gRNA and Cas9 protein were co-injected into wild-type zebrafish one-cell embryos. After 2-4 days of in vitro fertilization, the genomes of zebrafish injected with gRNA and Cas9 protein and wild-type zebrafish embryos that were not injected were lysed and verified by PCR sequencing to obtain the F0 generation of zebrafish chimerics with csde1 gene knockout.

[0057] (2) Crossbreeding F0 generation adult fish with wild-type zebrafish to conduct heritability and effective mutation detection, and obtain "-1+11" type F1 generation zebrafish;

[0058] (3) The “-1+11” type adult F1 generation zebrafish females and males were inbred, and the F2 generation csde1 gene knockout homozygous mutants were identified and screened through gene sequencing ( Figure 3 Figure B in the middle), the sequencing peak graph shows overlapping peaks at the target site, proving that the knockout was successful ( Figure 3 (Figure B).

[0059] Example 4. Expression of csde1 gene in homozygous mutants:

[0060] By immunoblotting analysis, 80 wild-type and mutant embryos were taken after 2 days of in vitro fertilization, and their embryos were lysed, followed by electrophoresis, membrane transfer, antibody incubation, and development. The results showed that there was no expression signal of csde1 in the mutant, proving that csde1 was completely knocked out in the csde1 gene deletion mutant ( Figure 3 (Figure C).

[0061] Example 5. Phenotypic analysis of csde1 gene deletion mutants:

[0062] In order to analyze the phenotype of csde1 gene deletion mutant zebrafish, we observed the embryonic morphology of 3 days after in vitro fertilization. The results showed that the mutant embryos showed obvious developmental delay and deformity, such as upturned tails and pericardial edema ( Figure 4 Figure A in the middle), which shows that the loss of csde1 gene expression in zebrafish affects the development of the zebrafish nervous system and causes morphological abnormalities. We further used WISH to observe whether knocking out csde1 affects the hematopoietic development process. The results showed that knocking out csde1 would lead to a significant decrease in the expression of hematopoietic stem cell marker genes runx1 and cmyb, as well as hematopoietic differentiation-related genes rag1, ae.1, and lyz. This phenomenon occurs from the stage of hematopoietic stem cell generation and continues to the stages of expansion and differentiation ( Figure 4 This indicates that csde1 is essential for the hematopoietic development process and that this zebrafish hematopoietic stem cell development defect model can be used for high-throughput drug screening.

[0063] Those skilled in the art will understand that the present invention is not limited to the embodiments herein, and that various obvious changes, readjustments and substitutions can be made by those skilled in the art without departing from the scope of protection of the present invention. Therefore, although the present invention has been described in more detail through the above embodiments, the present invention is not limited to the above embodiments, and may include more other equivalent embodiments without departing from the concept of the present invention, and the scope of the present invention is determined by the scope of the appended claims.

Claims

1. A method for preparing a csde1 gene-deficient zebrafish mutant, characterized in that: The following steps are involved: 1) Design and synthesize gRNA target site sequences specific to the csde1 gene; 2) The target site gRNA for knocking out the zebrafish csde1 gene and the Cas9 protein were co-injected into the one-cell stage embryos of the wild-type zebrafish, and a stably inherited zebrafish csde1 gene deletion mutant was obtained by identification, screening and cultivation; the gRNA for targeting the knockout of the zebrafish csde1 gene was located on the 5th exon of csde1, and the sequence was the nucleotide sequence shown in SEQ ID NO.1: GGGAGTGGTTTGTGCTACCAAGG.

2. A method for constructing a zebrafish csde1 gene deletion mutant model, characterized in that: The following steps are involved: S1. According to the gRNA target site specific to the csde1 gene, the upstream primer T7-csde1-F was designed and synthesized, and the sequence was the nucleotide sequence shown in SEQ ID NO.2: TAATACGACTCACTATAGGGAGTGGTTTGTGCTACCAGTTTTAGAGCTAGAAATAGC, and the downstream primer T7-csde1-R was the nucleotide sequence shown in SEQ ID NO.3: AGCACCGACTCGGTGCCACTTTT; S2. Using the pMD19-gRNA scaffold plasmid as a template, PCR amplification was performed using the upstream primer T7-csde1-F and the downstream primer T7-csde1-R to obtain the double-stranded DNA template required for synthesizing gRNA, followed by in vitro transcription and purification; S3. The target site gRNA and Cas9 protein for knocking out the zebrafish csde1 gene were co-injected into wild-type zebrafish one-cell embryos. The genomic DNA of the embryos with normal phenotypes after injection was extracted for PCR amplification and sequencing. The identification primers used included the upstream primer csde1-target34-F having the nucleotide sequence shown in SEQ ID NO.4: GCAGTCAGTTGTATAGGTGCAA and the downstream primer csde1-target34-R having the nucleotide sequence shown in SEQ ID NO.5: CCACATCGTCTCCAGCTTGT; S4. The csde1 gene knockout zebrafish chimera F0 generation was crossed with wild-type zebrafish for heritability and effective mutation detection to obtain "-1+11" type F1 generation zebrafish, and PCR amplification and sequencing were performed using identification primers. The sequencing sequence was the nucleotide sequence shown in SEQ ID NO.6:; S5. The "-1+11" type adult F1 generation zebrafish female and male fish were inbred, and the F2 generation csde1 gene knockout homozygous mutants were identified and screened by gene sequencing; S6. The csde1 gene knockout homozygous mutant was crossed with a transgenic line that marked hematopoietic stem cells to obtain a stable line with a transgenic background.

3. Use of the csde1 gene-deficient zebrafish mutant prepared by the preparation method as claimed in claim 1 in high-throughput drug screening.

Images