Use of inhibitors of cdk14 in paclitaxel chemotherapy resistance in ovarian cancer

Abstract

The present application relates to the application of CDK14 inhibitor in paclitaxel chemotherapy resistance of ovarian cancer. The present application designs and screens a small interfering RNA targeting CDK14, and through qPCR, CCK8 method and IC50 and other experimental methods, it is confirmed that the mRNA level of CDK14 can be obviously knocked down in paclitaxel resistant cells by transfecting the targeted siRNA, and the proliferation of paclitaxel resistant cells is inhibited. Through the experiment of using inhibitor siRNA to knock down CDK14 combined with PTX drug intervention, it is verified that it has the effect of sensitizing paclitaxel chemotherapy of ovarian cancer, so as to prove that targeting CDK14 can be used as a therapeutic target for reversing paclitaxel chemotherapy resistance of ovarian cancer, which provides a reference for the treatment of paclitaxel chemotherapy resistance of ovarian cancer in clinic, and has a wide application prospect and great potential social benefits.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedical technology, in particular, to the application of CDK14 inhibitor in paclitaxel chemotherapy resistance of ovarian cancer. BACKGROUND

[0002] Ovarian cancer is one of the common malignant tumors of female reproductive organs, and its incidence rate is second only to cervical cancer and uterine body cancer, accounting for about 4% of female systemic malignant tumors. However, the death caused by ovarian cancer ranks first among all gynecological tumors, which poses a serious threat to women's lives. The cause of ovarian cancer is not clear, and its occurrence may be related to age, fertility, blood type, mental factors and environment. Most ovarian cancers occur when the ovarian function is in the transition from flourishing to decline, and are mostly seen in women in the menopausal and postmenopausal periods, with fewer cases under the age of 20. The age distribution of different types of ovarian cancer is also different. Ovarian epithelial cancer increases rapidly after the age of 40, with a peak age of 50-60 years old, and gradually decreases after the age of 70. Sex cord stromal tumors are similar to ovarian epithelial cancer, and increase with age. Germ cell tumors are mostly seen in young women under the age of 20, and the incidence rate of ovarian cancer is high in unmarried or childless women. Because ovarian cancer has no symptoms in the early stage of clinical diagnosis, it is quite difficult to distinguish its tissue type and benignity or malignancy. Most of the tumors have spread to the uterus, bilateral ovaries, greater omentum and pelvic organs, so ovarian cancer is indeed a big problem in diagnosis and treatment.

[0003] At present, paclitaxel (PTX) chemotherapy is the first-line treatment for clinical treatment of advanced ovarian cancer, but chemotherapy resistance leads to ovarian cancer recurrence, which is still a problem that needs to be solved in clinical practice.

[0004] Cyclin Dependent Kinase 14 (CDK14) is one of the Cyclin Dependent Kinase (CDK) family, which plays a key role in controlling cell cycle progression and cell proliferation. Current researches have mainly found that it is involved in the occurrence and development of tumors, but there is no report on tumor resistance. Through our previous research, we first found that it is closely related to PTX chemotherapy resistance of ovarian cancer, and that targeting knockdown of CDK14 protein by CDK inhibitor has potential application value in reversing PTX chemotherapy resistance of ovarian cancer. SUMMARY

[0005] The present application inventors designed and screened a small interfering RNA targeting CDK14, which was confirmed by qPCR, CCK8 method and IC50 and other experimental methods that transfection of the targeted siRNA in paclitaxel-resistant cells could significantly knock down the mRNA level of CDK14 and inhibit the proliferation of paclitaxel-resistant cells.

[0006] In a first aspect, the present application provides use of CDK14 protein or gene as a diagnostic marker in preparation of a diagnostic reagent or kit for paclitaxel chemotherapy resistance of ovarian cancer.

[0007] In a second aspect, the present application provides use of a reagent for detecting CDK14 protein or gene content in preparation of a diagnostic reagent or kit for paclitaxel chemotherapy resistance of ovarian cancer.

[0008] As a preferred embodiment of the present application, the reagent for detecting CDK14 protein content is selected from primers specific for amplifying CDK14; or probes specific for recognizing CDK14 or its transcript; or antibodies specific for CDK14 protein.

[0009] As another preferred embodiment of the present application, the kit comprises a primer pair for detecting CDK14 gene or protein, and the primer pair is shown as SEQ ID NO: 1 and SEQ ID NO: 2.

[0010] As another preferred embodiment of the present application, the diagnostic reagent or kit for paclitaxel chemotherapy resistance of ovarian cancer comprises: a nucleic acid extraction reagent; and / or a polymerase chain reaction reagent; and / or a protein immunoblotting reagent; and / or an enzyme-linked immunoassay reagent.

[0011] As another preferred embodiment of the present application, the diagnostic sample of the diagnostic reagent or kit for paclitaxel chemotherapy resistance of ovarian cancer is tissue, serum, plasma and urine.

[0012] In a third aspect, the present application provides use of CDK14 protein or its inhibitor in treatment of paclitaxel chemotherapy resistance of ovarian cancer.

[0013] As a preferred embodiment of the present application, the inhibitor is selected from small molecule compounds or biological macromolecules.

[0014] As another preferred embodiment of the present application, the biological macromolecule is selected from small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleic acid targeting CDK14 gene or its transcript and capable of promoting expression of CDK14 protein or transcription of the gene; or a construct capable of expressing or forming the small interfering RNA, dsRNA, microRNA, antisense nucleic acid.

[0015] As another preferred embodiment of the present application, the biological macromolecule is small interfering RNA of CDK14 gene, and the sequence is shown as SEQ ID NO: 3.

[0016] The "inhibitor" is a substance capable of reducing the expression amount or activity of CDK14 or its gene, so as to hinder the function of CDK14 or its gene. Generally, the inhibitor includes, but is not limited to, an antisense nucleic acid, siRNA, miRNA or shRNA against CDK14 or its gene, and also includes an expression vector of the above sequence with inhibitory effect, and some molecular compounds.

[0017] The primer upstream sequence is shown in SEQ ID NO: 1.

[0018] The primer downstream sequence is shown in SEQ ID NO: 2.

[0019] The small interfering RNA sequence is shown in SEQ ID NO: 3.

[0020] It should be noted that the T base in the siRNA sequence serves to improve stability and does not affect the binding to the template. In the sequence table, the U in the tenth, fifteenth, twentieth and twenty-first positions is replaced by T due to format problems, and the original sequence is: GGCAAAGAGUCACCUAAAGUUTT.

[0021] The present application has the advantages of:

[0022] After knocking down CDK14 in ovarian cancer paclitaxel-resistant cells, it is found that the sensitivity of the cells to PTX drugs is increased, which verifies that CDK14 is closely related to ovarian cancer cell paclitaxel resistance and is a potential target for reversing ovarian cancer paclitaxel chemotherapy resistance. Through this study, a new idea and method for the treatment of ovarian cancer paclitaxel chemotherapy can be provided, and the targeted drug (siRNA) of the CDK14 specific target point in the present application is expected to bring good news to clinical ovarian cancer patients. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 (a) The difference in the expression of CDK14 mRNA in SK3R-PTX and OV3R-PTX cells transfected with si-NC and si-CDK14 was detected at 48 hours (n=3, *: p value <0.05; **: p value <0.01). Figure 1 (b) The difference in the mRNA expression of CDK14 was detected after the SK3R-PTX cells were infected with lentivirus sh-NC and sh-CDK14 (n=3, *: p value <0.05; **: p value <0.01).

[0024] Figure 2 (a) The cell viability results were detected by CCK-8 method at 24 hours, 48 hours and 72 hours after the SK3R-PTX cells were transfected with si-NC and si-CDK14. Figure 2(b) Flow cytometry results of cell cycle after transfection of si-NC and si-CDK14 in SK3R-PTX cells at 48 hours. Figure 2 (c) Statistics of flow cytometry results of cell cycle of b experiment (n=3, *: p value <0.05; **: p value <0.01). Figure 2 (d) Cell viability results after transfection of si-NC and si-CDK14 in OV3R-PTX cells at 24 hours, 48 hours and 72 hours respectively using CCK-8 method. Figure 2 (e) Flow cytometry results of cell cycle after transfection of si-NC and si-CDK14 in OV3R-PTX cells at 48 hours. Figure 2 (f) Statistics of flow cytometry results of cell cycle of e experiment (n=3, *: p value <0.05; **: p value <0.01).

[0025] Figure 3 (a) After SK3R-PTX cells were infected with lentivirus sh-CDK14 and added with different concentrations of PTX for 48 hours, CCK-8 method was used to detect the OD values of cells in each group, and then a curve was drawn to calculate the IC50 value. Figure 3 (b) After SK3R-PTX cells were infected with lentivirus sh-CDK14 and added with 0.5 μM of PTX for treatment, CCK8 was added at three time points of 24 hours, 48 hours and 72 hours to determine the OD values, and then a curve was drawn. Figure 3 (c) After SK3R-PTX cells were infected with lentivirus sh-CDK14 and added with and without 0.5 μM of PTX for 24 hours, the apoptosis of cells in each group was detected. Figure 3 (d) Statistics of apoptosis of cells in each group of c (n=3, *: p value <0.05; **: p value <0.01). DETAILED DESCRIPTION

[0026] The specific embodiments of the present application are described in detail below with reference to the accompanying drawings. If not specifically indicated, the technical means adopted in the examples are conventional means familiar to those skilled in the art, which can be referred to "Molecular Cloning Experiment Guide" (3rd edition) or related products, and the reagents and products adopted are also commercially available. Various processes and methods not described in detail are conventional methods known in the art, and the source, trade name and composition of the reagents used are indicated at the first occurrence, and the same reagents used thereafter are the same as the first indication unless otherwise specified.

[0027] Example 1

[0028] 1. Design and synthesis of siRNA and shRNA

[0029] The mRNA sequence of the CDK14 protein was downloaded from the GENBNAK website (https: / / www.ncbi.nlm.nih.gov / nucleotide / ), sequence number NM_001287135, and siRNA targeting CDK14 was designed. The siRNA was synthesized by Shanghai Jimar Pharmaceutical Technology Co., Ltd., and the sterile DNA and RNA enzyme were dissolved in ultrapure water to prepare a working concentration of 20 uM for standby.

[0030] The siRNA sequence was inserted into the pLKO.1puro plasmid (catalog number: 8453, addgene company) by gene cloning method to construct shRNA targeting CDK14, named sh-CDK14, and the Shanghai Wenbei Biotechnology Co., Ltd. was entrusted to package it into lentivirus and control virus for standby (virus titer 10 8 virus / ml).

[0031] The siRNA sequence is as follows:

[0032]

[0033] # refers to the target sequence of NM_001287135

[0034] 2. Cell transfection

[0035] Two groups of paclitaxel-resistant cells OV3R-PTX (PTX-sensitive ovarian cancer cells OVCAR-3, catalog number: HTB-161, from ATCC company) and SK3R-PTX (PTX-sensitive ovarian cancer cells SK-OV-3, catalog number: HTB-77, from ATCC company) were constructed by the author, and were cultured in 1640 and DMEM medium containing 10% fetal bovine serum, respectively.

[0036] X-tremeGENE siRNA Transfection Reagent (catalog number 4476093001, sigma company) was used for siRNA cell transfection experiment, as follows:

[0037] The cells were plated in a 6-well plate the day before the experiment, and 3x10 5 cells were plated in each well for OV3R-PTX and SK3R-PTX.

[0038] According to the instructions, siRNA and transfection reagent were diluted in serum-free 1640 or DMEM medium, and 5 uL siRNA stock solution (20 uM) and 7 uL transfection reagent were dissolved in 100 uL serum-free medium per well and incubated at room temperature for 5 minutes. The control siRNA was set as si-NC group.

[0039] Mix the diluted transfection reagent and siRNA and incubate at room temperature for 15 minutes. Replace each well with 2 mL of serum-free medium. Add the siRNA and transfection reagent mixture to the cell supernatant in each well, gently shake, and incubate for 24 or 48 hours before proceeding with subsequent experiments.

[0040] 3. RNA Extraction

[0041] Plate cells in a 6-well plate. When cells reach 80%-90% confluency, discard the culture supernatant. Wash once with pre-chilled PBS, then remove as much PBS as possible. Add 1 mL of lysis buffer from the RNAiso Plus Total RNA Extraction Kit (Cat. No. 9109, Takara) to each well of the 6-well plate and gently shake to ensure even distribution of the lysis buffer over the cell surface. Transfer the lysate containing cells to a centrifuge tube, pipette to mix thoroughly, and continue lysis at room temperature for 5 minutes. Add chloroform at a ratio of 200 μL of chloroform / mL RNAiso lysis buffer to each tube, vortex to mix thoroughly, and incubate at room temperature for 15 minutes. Centrifuge at 12,000 g for 15 minutes at 4°C. Aspirate the upper aqueous phase and transfer it to a fresh RNase-free centrifuge tube. Add 0.5 mL of isopropanol / mL RNAiso lysis buffer (an equal volume to the aspirated liquid) to the isopropanol, mix thoroughly, and incubate at -80°C for 5-10 minutes. Centrifuge at 12,000 g for 10 minutes at 4°C. Discard the supernatant, and the RNA will settle to the bottom of the tube. Add pre-chilled 75% ethanol to 1 mL of 75% ethanol / mL RNAiso lysis buffer. Gently shake the tube to resuspend the pellet. Centrifuge at 8000g for 5 minutes at 4°C and discard the supernatant as much as possible. Air dry at room temperature or vacuum dry for 5-10 minutes. Add 30 μL of DEPC-treated ultrapure water to each tube and incubate at 55-60°C for 5-10 minutes to fully dissolve the RNA. Measure the OD value of each RNA tube on a nanodrop 2000 instrument and convert to RNA concentration.

[0042] 4. Reverse transcription to obtain cDNA

[0043] use Reverse transcription experiments were performed using 1st Strand cDNA Synthesis SuperMix for qPCR (gDNAdigesterplus) (Cat. No. 11141ES60, Yisheng Biotechnology (Shanghai) Co., Ltd.).

[0044] The experimental steps are as follows:

[0045] Measure the RNA concentration and pipette 500ng of total RNA into a 200μL PCR reaction tube. Add DEPC-treated ultrapure water to make up the total volume to 7.5μL. Add to the kit III

[0046] SuperMix plus reaction solution 2.5 μL. Cover the reaction tube cap, gently shake and mix, and place in a general PCR instrument for reaction. The transcription conditions are 25 °C for 10 minutes, 55 °C for 20 minutes, 85 °C for 5 minutes, and finally obtain cDNA and store at -20 °C for standby.

[0047] 5. Real-time fluorescent quantitative PCR (qPCR) experiment

[0048] The primers for amplifying the CDK14 gene are designed by self software, and the sequences are as follows:

[0049] F: AGATGACACCACCTTTGATG (SEQ ID NO: 1);

[0050] R: CCTCAGGAATTGTGTCCAG (SEQ ID NO: 2);

[0051] Then entrust Suzhou Jinyuzhi Biotechnology Co., Ltd. to synthesize, and after synthesis, configure into 10 μM working concentration for standby. The subsequent qPCR experiment uses BeyoFast SYBR Green qPCR Mix (item number: D7262-25ml, Haibiyuntian Biotechnology Co., Ltd.) kit for qPCR experiment. The specific experimental steps are as follows: TM

[0052] 1) Configure the PCR reaction system, DEPC treated water 5.4 μL, 2X SYBR Green qPCR ix in the kit 7.5 μL, 10 μM of the upstream and downstream primers each 0.3 μL, 13.5 μL of reaction solution in each amplification tube.

[0053] 2) Add 1.5 μL of obtained cDNA template to the amplification tube.

[0054] 3) Cover the reaction tube cap, gently shake and mix, centrifuge for 5 seconds, and place in a real-time fluorescent quantitative PCR amplification instrument for reaction. The reaction conditions are 95 °C for 2 minutes of pre-denaturation, 40 cycles of amplification for 95 °C for 10 seconds, 60 °C for 30 seconds (fluorescence collection), followed by a melting curve amplification program, and finally software analysis of the Ct value of each well.

[0055] 6. Lentivirus infection

[0056] One day before infection, SK3R-PTX cells were transferred into T25 bottles at 8x10 5 cells. After growing to 50%, 10 μL of control virus and 30 μL of sh-CDK14 lentivirus were added to 2 mL of fresh complete culture medium, and after 6 hours of culture in the cell incubator, the complete culture medium was supplemented to 4 ml. ​

[0057] After the cells were cultured for 48 hours, the complete medium containing 10 ng / mL puromycin was replaced and the cells were cultured continuously. The medium was replaced and the cells were passaged according to the SK3R-PTX cell culture method. The medium was complete medium containing 10 ng / mL puromycin. After the cells were stably grown in the complete medium containing puromycin for more than 2 passages, the cells were expanded and cryopreserved for later use.

[0058] 7. Cell proliferation experiment (CCK8 method)

[0059] The cells in the OV3R-PTX and SK3R-PTX in the 6-well plates were digested after being transfected with siRNA for 24 hours, and were added to the 96-well plates at a dose of 5000 cells per well, and were cultured for 24 hours, 48 hours and 72 hours. At each time point, the old medium in the control and si-CDK14 groups was discarded and was replaced with 100 μL of fresh medium containing 10 μL of CCK8 (product number C0041, Shanghai Biyun Tian Biotechnology Co., Ltd.). After the CCK8 reagent was added for 2 hours, the OD value of each well was detected on a spectrophotometer at a wavelength of 420 nm. The growth curve was drawn according to the OD value of each well, and the cell proliferation was analyzed.

[0060] 8. Cell cycle

[0061] After the OV3R-PTX and SK3R-PTX in the 6-well plates were transfected with siRNA for 48 hours, the cells were trypsinized and centrifuged at 1000 rpm for 5 minutes to discard the supernatant. The cells were washed twice with 2 mL of cold PBS, and the precipitate was collected by centrifugation at 1000 rpm for 5 minutes after each washing, and the supernatant was discarded. The cells were resuspended with pre-cooled 70% ethanol solution, and then were placed in a -20 degree refrigerator for fixation for more than 4 hours. The fixed cells were taken out and centrifuged at 2000 rpm for 5 minutes, and the supernatant was discarded. The cells were washed twice with 2 mL of cold PBS, and the precipitate was collected by centrifugation at 1000 rpm for 5 minutes after each washing, and the supernatant was discarded.

[0062] The cell precipitate was resuspended with 500 μL of PI / RNase Staining Buffer (product number 550825, BD Company), and was protected from light for 15 minutes. The cell cycle was detected on a flow cytometer.

[0063] 9. Determination of the half maximal inhibitory concentration (IC50) of the chemotherapeutic drug paclitaxel in cells with knocked down CDK14

[0064] One day before drug administration, SK3R-PTX+sh-NC (control virus) and SK3R-PTX+sh-CDK14 lentivirus cells were counted by digestion and plated into 96-well plates at 10,000 cells per well. The next day, a gradient of PTX drug concentrations was prepared using medium containing 10% FBS, and three cell replicates were set up for each drug concentration. The PTX concentrations used were 20 μM, 10 μM, 5 μM, 1 μM, 0.5 μM, 0.1 μM, 0.01 μM, 0.001 μM, 0.0001 μM, and 0 μM. The medium in the 96-well plates was discarded, and medium containing PTX was added to each well. The cells were incubated for 48 hours. After 48 hours of PTX treatment, 10 μL of CCK8 solution was added to each well, and the cells were incubated for 2 hours. The absorbance OD value was measured at 450 nm.

[0065] Based on the OD values at different concentrations, a drug inhibition and PTX concentration curve was plotted, and the IC50 value of each experimental group was calculated.

[0066] 10. Knockdown of CDK14 and addition of PTX drug treatment to detect cell apoptosis

[0067] One day before drug administration, SK3R-PTX+sh-NC (control virus) and SK3R-PTX+sh-CDK14 lentivirus cells were counted by digestion and plated into 6-well plates at 8x10 5 cells per well. The next day, medium containing 0.5 μM PTX was prepared. Four groups were set up: the SK3R-PTX+sh-NC (control virus) group, the SK3R-PTX+sh-CDK14 (lentivirus) group, the SK3R-PTX+sh-NC (control virus) group+PTX group, and the SK3R-PTX+sh-CDK14 (lentivirus) group+PTX group. The first two groups were replaced with medium containing 10% FBS (without PTX) in the corresponding cell wells, and the last two groups were replaced with medium containing 0.5 μM PTX in 10% FBS in the corresponding cell wells. After 48 hours of incubation, the cells were digested and centrifuged at 1000 rpm for 5 minutes, and the supernatant was discarded. Two milliliters of pre-cooled PBS were added, and the cells were washed twice by centrifugation at 1000 rpm for 5 minutes each time, and the supernatant was discarded. The cells were resuspended in 100 μL of binding buffer from the FITC Annexin V Apoptosis Detection Kit I (catalog number 556547, BD Biosciences), and 1 μL of FITC-labeled Annexin V and 3 μL of PI dye were added. The cells were stained in the dark for 15 minutes.

[0068] Four hundred microliters of binding buffer were added to each tube, and the cells were detected by flow cytometry. The proportion of apoptotic cells was analyzed by software.

[0069] II. Experimental results

[0070] 1. siRNA targeting CDK14 can significantly knock down the mRNA level of CDK14 in OV3R-PTX and SK3R-PTX paclitaxel-resistant cell lines Figure 1 ) The siRNA targeting CDK14 designed and synthesized in the experiment can effectively knock down the mRNA level of CDK14 in the ovarian cancer paclitaxel-resistant cell lines. The mRNA of CDK14 can be significantly knocked down by 80% in OV3R-PTX cells, and the mRNA of CDK14 can be significantly knocked down by 80% in SK3R-PTX cells using lentivirus.

[0071] 2. Knocking down CDK14 in OV3R-PTX and SK3R-PTX paclitaxel-resistant cells using siRNA can inhibit cell proliferation and arrest cells in the G2M phase Figure 2 ) In the ovarian cancer paclitaxel-resistant cell lines, after using small molecule siRNA to target and knock down CDK14, it was found that the proliferation function of the resistant tumor cells was significantly reduced. Further research found that the cells could be stopped in the G2M phase to inhibit tumor cell growth. This indicates that the small molecule has potential value for treating ovarian tumors.

[0072] 3. Knocking down CDK14 in SK3R-PTX paclitaxel-resistant cells using lentivirus can increase the sensitivity of the resistant cells to PTX Figure 3 ) The experiment found that the newly designed siRNA packaged lentivirus can significantly increase the resistance of ovarian cancer cells to the chemotherapeutic drug PTX by measuring the PTX resistance IC50 value and detecting the apoptosis level of the cells after drug addition.

[0073] The above only describes the preferred embodiments of the present application. It should be noted that for those skilled in the art, without departing from the method of the present application, several improvements and supplements can also be made, which should also be considered as the protection scope of the present application.

Claims

1. Use of a CDK14 protein inhibitor in the preparation of a drug for treating paclitaxel chemotherapy resistance in ovarian cancer, wherein the inhibitor is a small interfering RNA of the CDK14 gene, and the sequence is shown in SEQ ID NO: 3.

Images