7β-Hydroxysteroid dehydrogenase mutants and their applications in the synthesis of ursodeoxycholic acid

Abstract

The present invention relates to a 7β-hydroxysteroid dehydrogenase mutant and its application in the synthesis of ursodeoxycholic acid. Specifically disclosed are a 7β-hydroxysteroid dehydrogenase derived from Roseococcus sp., its encoding gene and amino acid sequence, a recombinant vector and a recombinant expression transformant containing the gene, and the application of using the combination of the 7β-hydroxysteroid dehydrogenase and isopropanol dehydrogenase for immobilized preparation of ursodeoxycholic acid. The prepared immobilized enzyme was continuously used for 1 month, and no decrease in activity was observed. Compared with the prior art, the present invention has the advantages of good catalyst stability, low coenzyme application cost, simple operation, mild reaction conditions, environmental friendliness, high yield, etc., and has good application prospects in the enzymatic catalysis of the conversion of chenodeoxycholic acid to synthesize ursodeoxycholic acid.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and in particular relates to a highly stable mutant of 7β-hydroxysteroid dehydrogenase (7β-HSDH) derived from Roseococcus sp., its encoding gene, a recombinant expression vector and a recombinant expression transformant containing the gene sequence, a recombinant 7β-hydroxysteroid dehydrogenase catalyst, the application of 7β-hydroxysteroid dehydrogenase or the recombinant 7β-hydroxysteroid dehydrogenase catalyst in the synthesis of ursodeoxycholic acid, and a method for catalytically reducing 7-ketolithocholic acid to prepare ursodeoxycholic acid using a continuous flow packed bed reactor system. Background Art

[0002] Ursodeoxycholic acid (UDCA) is an epimer of chenodeoxycholic acid (CDCA), with the chemical name 3α,7β-dihydroxy-5β-cholestane-24-oic acid, chemical formula C 24 H 40 O 4 , and is a white powdery solid, insoluble in water and easily soluble in alkaline solutions. Its chemical structural formula is shown as follows:

[0003]

[0004] Chemical Structural Formula of Ursodeoxycholic Acid

[0005] Ursodeoxycholic acid is an active pharmaceutical ingredient (API) commonly used clinically to treat intrahepatic cholestasis and cholesterol stones. Currently, ursodeoxycholic acid is mainly extracted from the bile of live bears or synthesized chemically using cholic acid or chenodeoxycholic acid as raw materials. The method of extracting bile from live bears has low yield, long cycle, and causes double torture to the physiology and psychology of black bears, which is against humanism. The chemical synthesis method was proposed in 1954 and has been improved many times, but still cannot avoid the use of harmful reagents such as heavy metals. With the development of biotechnology, the synthesis of pharmaceutical active ingredients using biocatalysis technology has received great attention due to its mild reaction conditions, high selectivity, and environmental friendliness. In the past 30 years, the enzymatic synthesis of ursodeoxycholic acid has also been widely reported. Compared with the previous two methods, the enzymatic synthesis of ursodeoxycholic acid has attracted much attention due to its high stereo- and regioselectivity, mild reaction conditions, and green sustainability. The raw material for the whole-enzymatic synthesis of ursodeoxycholic acid is chenodeoxycholic acid, which is cheap and easily available compared to ursodeoxycholic acid. The whole-enzymatic synthesis of ursodeoxycholic acid involves two reactions: first, chenodeoxycholic acid is converted into the 7-ketolithocholic acid intermediate under the catalysis of 7α-hydroxysteroid dehydrogenase; then, the latter is reduced to ursodeoxycholic acid by 7β-hydroxysteroid dehydrogenase. Both enzymes belong to the short-chain dehydrogenase family and are nicotinamide coenzyme-dependent dehydrogenases. Compared with the cofactor NADP(H), NAD(H) is cheaper and more stable, making it the preferred cofactor for dehydrogenases in large-scale synthesis applications.

[0006] In actual industrial production, free enzyme biocatalysts often face problems such as low thermal stability, intolerance to organic solvents, susceptibility to extreme pH, and easy inactivation, which affect their production efficiency in actual production applications. With the continuous development of production processes, the demand for enzyme catalysts with high catalytic performance is also increasing day by day, and the requirements for the efficiency and economy of enzyme applications are getting higher and higher. Therefore, it is necessary not only to enhance enzyme activity, stability, and productivity, but also to improve the recyclability and reusability of enzymes. Immobilized enzymes not only maintain the unique catalytic performance of enzymes, but also have a series of advantages such as high stability, simple separation and recovery operations, and reusability. Compared with traditional stirred reactors, continuous flow packed bed reactor technology can effectively strengthen the biochemical reaction process catalyzed by enzymes. At the same time, the combination of continuous flow reactors and immobilized enzymes enables the enzymatic reaction and the recovery operation of enzymes to be completed in the same operation unit, simplifies the operation process, and can reduce the inhibitory effect of products on enzymes and improve the productivity of enzyme catalysts.

[0007] In 2018, Xu Jianhe et al. carried out coenzyme preference modification on Rt7β-HSDH from Ruminococcus torques. Through rational design, the cofactor specificity of Rt7β-HSDH was reversed from NADPH to NADH, and the NADH-dependent variant Rt7β-HSDH was obtained. G39D / T17A , breaking the current situation that all 7β-HSDHs reported so far are NADPH-dependent enzymes (ACS Catal., 2019, 9: 466–473). Subsequently, Arends et al. used a database mining strategy to clone a natural NADH-dependent 7β-HSDH (Ls7β-HSDH) from Lactobacillus spicheri (ChemSusChem, 2019, 12: 3192–3203). However, the specific activity of both Rt7β-HSDH G39D / T17A and Ls7β-HSDH is less than 6 U / mg, and it can only catalyze the conversion of 10 g / L 7-ketolithocholic acid to ursodeoxycholic acid, making it difficult to achieve industrial scale application. In 2019, the Monti group also discovered several other NADH-dependent 7β-HSDHs, but their applications in the enzymatic synthesis of ursodeoxycholic acid have not been explored (Adv. Synth. Catal., 2020, 362: 2474–2485).

[0008] In summary, the enzymatic synthesis of ursodeoxycholic acid using 7β-hydroxysteroid dehydrogenase has been widely reported and certain progress has been made. The enzymatic synthesis of ursodeoxycholic acid has advantages such as high selectivity and environmental friendliness, but there are also many deficiencies. Compared with NADPH-dependent 7β-hydroxysteroid dehydrogenases, the currently known NADH-dependent 7β-hydroxysteroid dehydrogenases have problems such as low catalytic activity, low substrate and product tolerance concentrations, poor stability, and low production efficiency. Therefore, it is still necessary to develop NADH-dependent 7β-hydroxysteroid dehydrogenases with better catalytic performance, and on this basis, prepare immobilized enzymes with high stability and catalytic performance, and then use engineering means to strengthen the biochemical reaction process catalyzed by 7β-hydroxysteroid dehydrogenases to achieve the efficient and economic synthesis of ursodeoxycholic acid, so as to meet the requirements of industrial application. Summary of the Invention

[0009] The problems to be solved by the present invention are aimed at the deficiencies of 7β-hydroxysteroid dehydrogenase in the prior art. By means of discovery and modification, a 7β-hydroxysteroid dehydrogenase mutant with excellent catalytic performance, its encoding gene, a recombinant expression vector and a recombinant expression transformant containing the gene sequence, a recombinant 7β-hydroxysteroid dehydrogenase catalyst, the application of 7β-hydroxysteroid dehydrogenase or the recombinant 7β-hydroxysteroid dehydrogenase catalyst in the synthesis of ursodeoxycholic acid, the preparation of a 7β-hydroxysteroid dehydrogenase / isopropanol dehydrogenase co-immobilized enzyme catalyst with high stability and catalytic efficiency, and the construction of a continuous flow packed bed reactor system for the efficient enzymatic synthesis of ursodeoxycholic acid, and a method for catalytically reducing 7-ketolithocholic acid to prepare ursodeoxycholic acid by applying the continuous flow packed bed reactor system. In the present invention, a cofactor NAD(H) recycling system is also combined to improve the economy and green sustainability of the biosynthesis process of ursodeoxycholic acid.

[0010] The object of the present invention can be achieved by the following technical solutions:

[0011] One of the technical solutions of the present invention:

[0012] A 7β-hydroxysteroid dehydrogenase mutant, which is a protein of the following (a) or (b):

[0013] (a): A protein consisting of the amino acid sequence shown in SEQ ID No. 2;

[0014] (b): A protein derived from (a) with 7β-hydroxysteroid dehydrogenase activity obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence shown in SEQ ID No. 2.

[0015] The protein (a) is derived from Roseococcus sp., its encoding gene is as shown in SEQ ID No. 1, the amino acid sequence is as shown in SEQ ID No. 2, and it is named Rs7β-HSDH. This enzyme has high stability, and its half-life reaches 15 h at 40 °C.

[0016] The nucleotide sequence of the encoding gene of the protein (a) was obtained by the total gene synthesis of GenScript Corporation, and NdeⅠ and HindⅢ restriction enzyme sites were added to both ends of the coding region. After the target gene fragment was double-digested with the restriction enzymes NdeⅠ and HindⅢ, it was ligated with the pET28a(+) vector that was also double-digested with the restriction enzymes NdeⅠ and HindⅢ under the action of T4 DNA ligase. Subsequently, transformation and screening were carried out to obtain the E. coli BL21(DE3) strain of the transformed positive plasmid pET28a(+)-Rs7β-HSDH, and the construction of the heterologous expression system of Rs7β-HSDH was completed.

[0017] The 7β-hydroxysteroid dehydrogenase mutant is obtained by means of directed evolution technology, that is, by using directed evolution technologies such as rational design, site-directed mutagenesis, and combinatorial mutagenesis to obtain 7β-hydroxysteroid dehydrogenase mutants with improved activity and stability. Specifically, the sequences of the highly active mutants are as follows:

[0018] (1) Replace glycine at position 28 in the amino acid sequence shown in SEQ ID No. 2 with alanine;

[0019] (2) Replace threonine at position 94 in the amino acid sequence shown in SEQ ID No. 2 with isoleucine;

[0020] (3) Replace threonine at position 114 in the amino acid sequence shown in SEQ ID No. 2 with glycine;

[0021] (4) Replace methionine at position 116 in the amino acid sequence shown in SEQ ID No. 2 with phenylalanine;

[0022] (5) Replace threonine at position 124 in the amino acid sequence shown in SEQ ID No. 2 with valine;

[0023] (6) Replace alanine at position 132 in the amino acid sequence shown in SEQ ID No. 2 with glutamine;

[0024] (7) Replace valine at position 135 in the amino acid sequence shown in SEQ ID No. 2 with leucine;

[0025] (8) Replace threonine at position 94 in the amino acid sequence shown in SEQ ID No. 2 with isoleucine, and replace threonine at position 124 with valine;

[0026] (9) Replace threonine at position 94 in the amino acid sequence shown in SEQ ID No. 2 with isoleucine, and replace valine at position 135 with leucine;

[0027] (10) Replace methionine at position 116 in the amino acid sequence shown in SEQ ID No. 2 with phenylalanine, and replace threonine at position 124 with valine;

[0028] (11) Replace threonine at position 124 in the amino acid sequence shown in SEQ ID No. 2 with valine, and replace valine at position 135 with leucine;

[0029] (12) Replace threonine at position 94 in the amino acid sequence shown in SEQ ID No. 2 with isoleucine, and replace methionine at position 116 with phenylalanine.

[0030] The second technical solution of the present invention:

[0031] A nucleic acid encoding the 7β-hydroxysteroid dehydrogenase or its mutant.

[0032] The nucleic acid of the present invention encodes and expresses the 7β-hydroxysteroid dehydrogenase or its mutant as described in the first technical solution, and its preparation method is a conventional preparation method in the art. The preferred preparation method includes:

[0033] Obtaining the coding DNA of the 7β-hydroxysteroid dehydrogenase as described in the first technical solution through gene cloning technology; or obtaining the coding DNA of the 7β-hydroxysteroid dehydrogenase through the method of artificial total sequence synthesis.

[0034] The method for obtaining a nucleic acid molecule encoding the 7β-hydroxysteroid dehydrogenase or its mutant by gene cloning technology in the present invention is:

[0035] Upstream primer sequence: 5’GGAATTC CATATG GCTTATGATCCCCTAGC 3’ (as shown in SEQ ID No.3)

[0036] Downstream primer sequence: 5’CCC AAGCTT AAGCTTTTAGTGGCCAAACA 3’ (as shown in SEQ ID No.4)

[0037] Obtaining the coding DNA encoding the Rs7β-HSDH through polymerase chain reaction (PCR), using it as a template, and using the primers shown in SEQ ID No.5-18, obtaining the coding DNA of the 7β-HSDH single point mutants (1)-(7) through PCR; and then using the coding DNA of the 7β-HSDH single point mutants (1)-(7) as a template, and using the primers shown in SEQ ID No. 5-18, obtaining the coding DNA of the 7β-HSDH two point mutants (8)-(11) through PCR.

[0038] PCR system (20μL): 2×PrimeSTAR HS (Beijing Baori Medical Biotechnology Co., Ltd.) 10μL, template plasmid 1μL (50-100ng), upstream primer 1μL, downstream primer 1μL, ddH 2 O is made up to 20μL.

[0039] PCR reaction procedure: (1) Denaturation at 98°C for 3 minutes; (2) Denaturation at 98°C for 10 seconds, (3) Annealing at 55°C for 15 seconds, (4) Extension at 72°C for 1 minute; (5) Steps 2-4 are carried out for 30 cycles in total, and finally extension at 72°C for 5 minutes and preservation at 4°C.

[0040] The third technical solution of the present invention:

[0041] A recombinant expression vector containing the nucleic acid sequence of the 7β-hydroxysteroid dehydrogenase or its mutant according to the present invention, specifically a recombinant expression plasmid containing the nucleic acid sequence of the 7β-hydroxysteroid dehydrogenase or its mutant according to the present invention. The recombinant expression plasmid can be constructed by conventional methods in the art, and the nucleic acid sequence encoding the 7β-hydroxysteroid dehydrogenase gene or the nucleic acid sequence of the mutant gene of the present invention is ligated to various commercially available empty plasmids. The plasmid can be any of the conventional plasmids in the art, including but not limited to any one of the pET expression vector, pRSF expression vector, pUC expression vector or pBR expression vector. For different expression hosts, the preferred plasmid vectors are different. The 7β-hydroxysteroid dehydrogenase gene can be operably cloned downstream of the expression regulatory sequence in the selected vector, so as to achieve constitutive or inducible expression of the 7β-hydroxysteroid dehydrogenase.

[0042] Preferably, as an example, for an E. coli host, the pET28a(+) plasmid is preferably used as the vector. The recombinant expression plasmid pET28a(+)-Rs7β-HSDH of the present invention can be obtained by the following method: by PCR amplification of the Rs7β-HSDH gene, double digestion of the obtained gene sequence DNA fragment with the restriction enzymes Nde I and Hind III, and at the same time double digestion of the empty plasmid pET-28a(+) with the restriction enzymes Nde I and Hind III, recovering the Rs7β-HSDH DNA fragment and the empty plasmid after the above digestion, and ligating the Rs7β-HSDH DNA fragment and the empty plasmid after digestion with T4 DNA ligase to obtain the recombinant expression plasmid pET28a(+)-Rs7β-HSDH containing the Rs7β-HSDH coding gene.

[0043] The fourth aspect of the technical solution of the present invention:

[0044] A recombinant expression transformant containing the recombinant expression vector of the third aspect of the technical solution of the present invention.

[0045] The recombinant expression transformant of the present invention can be obtained by transforming the recombinant expression plasmid of the present invention into a host cell. The host cell is various conventional host cells in the art, including but not limited to any one of E. coli, yeast, Bacillus, Lactobacillus or filamentous fungi. The host cell of the present invention is preferably E. coli, and more preferably E. coli BL21(DE3). Transforming the recombinant expression plasmid of the present invention into the host cell E. coli BL21(DE3) can obtain the target recombinant expression transformant.

[0046] As an example, the recombinant expression plasmid pET28a(+)-Rs7β-HSDH of the present invention was transformed into Escherichia coli E. coli BL21(DE3) to obtain the recombinant expression transformant pET28a(+)-Rs7β-HSDH / BL21(DE3).

[0047] The fifth technical solution of the present invention:

[0048] A preparation method of a recombinant 7β-hydroxysteroid dehydrogenase catalyst, wherein the recombinant 7β-hydroxysteroid dehydrogenase catalyst is any one of the following forms:

[0049] (1) Culturing the recombinant expression transformant of the present invention, and separating the transformed cells containing the 7β-hydroxysteroid dehydrogenase;

[0050] (2) Freeze-dried stem cells obtained by freeze-drying the transformed cells as described in (1);

[0051] (3) Crushing the transformed cells containing the 7β-hydroxysteroid dehydrogenase to obtain a crude enzyme solution;

[0052] (4) Freeze-drying the crude enzyme solution containing the 7β-hydroxysteroid dehydrogenase to obtain a crude enzyme powder.

[0053] Among them, the conditions and methods for culturing the recombinant expression transformant are conventional conditions and methods in the art, including the following steps: preparing a culture medium required for the growth of the recombinant expression transformant, culturing the recombinant expression transformant of the present invention to obtain 7β-hydroxysteroid dehydrogenase or its mutant catalyst. The culture medium can be selected from conventional culture media in the art, including but not limited to TB, LB or self-inducing culture media. For recombinant Escherichia coli, the preferred culture medium is TB medium: peptone 12 g / L, yeast extract 24 g / L, KH 2 PO 4 2.31 g / L, K 2 HPO 4 5 g / L. The preferred culture method is: inoculating the recombinant Escherichia coli constructed by the above technical solution into a TB medium containing 50 μg / mL kanamycin, culturing with shaking at 37°C and 200 rpm for 12 hours. Inoculating at an inoculation amount of 1% (v / v) into a 2 L shake flask containing 500 mL of TB medium, and culturing with shaking on a shaker at 37°C and 200 rpm. When the OD of the culture solution 600When it reaches 0.6, isopropyl-β-D-thiogalactoside (IPTG) with a final concentration of 0.2 mmol / L is added as an inducer. After inducing at 16 °C for 24 h, the culture solution is centrifuged to collect cells, which are then washed twice with physiological saline to obtain resting cells. The harvested resting cells are freeze-dried using a vacuum freeze dryer to obtain freeze-dried cells containing the 7β-hydroxysteroid dehydrogenase mutant. The harvested resting cells are suspended in 10-fold volume (v / w) of phosphate buffer (10 mM, pH 8.0), homogenized under high pressure, and centrifuged to collect the supernatant, thereby obtaining the crude enzyme solution of the recombinant 7β-hydroxysteroid dehydrogenase. The collected crude enzyme solution is frozen overnight at -80 °C and then freeze-dried in a vacuum freeze dryer to obtain the freeze-dried enzyme powder of the recombinant 7β-hydroxysteroid dehydrogenase. The obtained freeze-dried cells or freeze-dried enzyme powder are stored in a 4 °C refrigerator for later use.

[0054] Sixth technical solution of the present invention:

[0055] The present invention provides the use of the 7β-hydroxysteroid dehydrogenase Rs7β-HSDH or its mutant thereof as described, and the use includes the following steps:

[0056] The 7β-hydroxysteroid dehydrogenase or its mutant thereof as described in the present invention is added to a buffer solution containing the substrate 7-ketolithocholic acid, the co-substrate glucose, glucose dehydrogenase, and the coenzyme NAD + to catalyze the reduction of 7-ketolithocholic acid to ursodeoxycholic acid.

[0057] The buffer solution can be selected from conventional buffer solutions in the art, including but not limited to phosphate, HEPES, or Tris-HCl, as long as the pH range is 7.0 - 9.0; the preferred buffer solution system is phosphate, and the pH range is 8 - 9. The reaction temperature is 20 - 50 °C, preferably 25 - 35 °C.

[0058] The concentration of the substrate is 5 - 50 g / L, the dosage of glucose is 1.0 - 2 times the equivalent of the molar amount of the substrate, the dosage of the coenzyme NAD + is 0 - 0.5 mM, and the dosages of the 7β-hydroxysteroid dehydrogenase and glucose dehydrogenase catalysts are 5 - 20 g / L;

[0059] The reaction process can adopt conventional detection methods in the art, including but not limited to high performance liquid chromatography (HPLC), gas chromatography (GC), or thin layer chromatography (TLC); the preferred detection method is HPLC. Preferably, samples are taken intermittently during the reaction process, and the conversion rate is analyzed using liquid chromatography. The chromatographic column used is a C18 chromatographic column ( ) The analysis conditions are as follows: using methanol / water (containing 0.005% phosphoric acid) = 75 / 25 as the mobile phase, with a flow rate of 0.8 mL / min, a detection wavelength of 210 nm, and a column temperature of 30 °C. The time to end the reaction is determined by the time when the conversion rate no longer increases.

[0060] Seventh technical solution of the present invention:

[0061] Provide a highly stable co-immobilized enzyme catalyst of 7β-hydroxysteroid dehydrogenase / isopropanol dehydrogenase.

[0062] The co-immobilized enzyme of 7β-hydroxysteroid dehydrogenase / isopropanol dehydrogenase described in the present invention can be prepared by immobilizing 7β-hydroxysteroid dehydrogenase or its mutant and isopropanol dehydrogenase on an immobilization carrier by forming covalent bonds.

[0063] The immobilization carrier is a water-insoluble solid carrier with chemically active functional groups, including but not limited to any one of epoxy resin, amino resin, epoxy nano-ferroferric oxide particles, amino nano-ferroferric oxide, or nano-silica particles.

[0064] The immobilization carrier described in the present invention is preferably an immobilization carrier with epoxy functional groups, more preferably an epoxy resin ES-103 immobilization carrier. As an example, the crude enzyme powder of 7β-hydroxysteroid dehydrogenase or its mutant and the crude enzyme powder of isopropanol dehydrogenase prepared in the present invention are dissolved in a buffer solution, and after adding epoxy resin ES-103, they are incubated with shaking. The amino groups on the enzyme react with the epoxy groups on the epoxy resin ES-103 to form covalent bonds, thereby co-immobilizing 7β-hydroxysteroid dehydrogenase or its mutant and isopropanol dehydrogenase on the epoxy resin ES-103, and preparing a co-immobilized enzyme catalyst of 7β-hydroxysteroid dehydrogenase and isopropanol dehydrogenase with high stability and catalytic performance.

[0065] The buffer solution can be selected from conventional buffer solutions in the art, including but not limited to phosphates, HEPES, or TrisHCl; the preferred buffer solution system is phosphates. The pH range of the phosphate buffer salt is 5.0 to 10.0, preferably pH 7.0. The immobilization temperature is 15 to 40 °C, preferably 20 °C. The mass ratio of the lyophilized enzyme powder of 7β-hydroxysteroid dehydrogenase and isopropanol dehydrogenase is 5:1 to 1:5, preferably 2:1. The total addition amount of the lyophilized enzyme powder of 7β-hydroxysteroid dehydrogenase and isopropanol dehydrogenase is 20 to 120 mg of enzyme powder per gram of epoxy resin ES-103, preferably 60 mg of enzyme powder per gram of epoxy resin ES-103. The immobilization time is 1 to 25 hours, preferably 20 hours.

[0066] Eighth technical solution of the present invention:

[0067] Provided is a continuous flow packed bed reactor system for the efficient enzymatic synthesis of ursodeoxycholic acid.

[0068] The continuous flow packed bed reactor system described in the present invention is used for the efficient enzymatic synthesis of ursodeoxycholic acid. To achieve the above object, the present invention provides a packed bed continuous flow reactor reaction system, including a reaction raw material 7-ketolithocholic acid dissolution storage tank, a material conveying pipeline, a material conveying pump, an enzyme packed column, and a product collection tank. The outlet of the raw material storage tank is communicated with the inlet of the material conveying pump, the outlet of the material conveying pump is communicated with the inlet of the enzyme packed column, and the outlet of the enzyme packed column is communicated with the product storage tank. The enzyme packed column is placed in a temperature control system, and the temperature control system is set at a temperature of 20 to 35 °C, preferably 25 °C. Preferably, the inner diameter of the enzyme packed column is 0.46 cm, and the height of the enzyme packed column is 15 cm. The filler of the enzyme packed column is the 7β-hydroxysteroid dehydrogenase / isopropanol dehydrogenase co-immobilized enzyme catalyst as described in Technical Solution Seven of the present invention. The 7-ketolithocholic acid substrate solution in the reaction raw material storage tank is conveyed into the enzyme packed column through the material conveying pump. In the enzyme packed column, the substrate 7-ketolithocholic acid is reduced to form ursodeoxycholic acid and flows out of the enzyme packed column. The flowing solution enters the product storage tank through the material conveying pipeline. The enzyme packed column reactor is reused for 31 days, and the conversion rate is maintained at 95-98%, and no decrease in activity is observed, showing the high stability of the immobilized enzyme.

[0069] Technical Solution Nine of the present invention:

[0070] Provided is a method for recycling cofactor NAD + / NADH during the enzymatic synthesis of ursodeoxycholic acid. On the basis of Technical Solution Eight, the present invention provides a method for separating the product ursodeoxycholic acid and recycling the cofactor NAD + / NADH in a cycle. The specific operation steps are as follows:

[0071] The first step is to acidify the reaction solution in the product storage tank with 1 M hydrochloric acid to a pH of 2 to 5 of the reaction solution, preferably a pH of 3, to reduce the solubility of ursodeoxycholic acid in the reaction solution and precipitate the product ursodeoxycholic acid;

[0072] The second step is to filter and separate the acidified reaction solution, and the separated filter residue is the product ursodeoxycholic acid;

[0073] The third step is that the filtrate after filtration contains the cofactor NAD + / NADH. Adjust the pH of the filtrate to 7.5 to 8.5 with 1 M sodium hydroxide, preferably adjust the pH of the filtrate to 8.0, and the pH of the filtrate is detected by a pH analysis device.

[0074] Step 4: Supplement 7-ketolithocholic acid to the filtrate with a pH of 8.0 to obtain a reaction raw material substrate solution of 7-ketolithocholic acid, and return it to the 7-ketolithocholic acid raw material storage tank for a new reaction.

[0075] Compared with the prior art, the innovative improvement effect of the present invention lies in:

[0076] The present invention provides an NADH-dependent 7β-hydroxysteroid dehydrogenase and a co-immobilized enzyme of 7β-hydroxysteroid dehydrogenase / isopropanol dehydrogenase with high activity, good thermal stability and chemical stability. They can efficiently catalyze the reduction of 7-ketolithocholic acid to ursodeoxycholic acid. Constructing a continuous flow packed bed reactor system can catalyze the synthesis of ursodeoxycholic acid with high space-time yield. The cofactor recycling system improves the material cost of the effective biosynthesis of ursodeoxycholic acid, and improves the economy and sustainability of the biosynthesis of ursodeoxycholic acid. Compared with the previously reported 7β-hydroxysteroid dehydrogenase, enzymatic reaction systems and equipment, the 7β-hydroxysteroid dehydrogenase and the co-immobilized enzyme of 7β-hydroxysteroid dehydrogenase / isopropanol dehydrogenase of the present invention, as well as the continuous flow packed bed reactor system equipped with a cofactor recycling system, can use NAD(H) which is cheaper than NADP(H) as a cofactor to efficiently reduce 7-ketolithocholic acid under a high substrate loading. Therefore, the production cost is reduced, and it has good industrial application prospects. Description of the Drawings

[0077] Figure 1 Catalytic synthesis of ursodeoxycholic acid by a continuous flow packed bed reactor system Detailed Embodiments

[0078] The present invention will be further described in detail below in conjunction with specific embodiments. It is necessary to indicate here that the following specific embodiments are only used for a clearer description of the present invention and cannot be construed as a limitation on the protection scope of the present invention. Any non-essential improvements made to the present invention are included in the protection scope of the present invention.

[0079] The sources of the materials in the following examples are:

[0080] The recombinant plasmid pET28a(+)-Rs7β-HSDH, containing the nucleic acid sequence shown in SEQ ID No.1, was constructed by the inventor himself, and the construction method can adopt conventional technical means in the art.

[0081] The empty plasmid vector pET-28a(+) was purchased from Novagen.

[0082] 2×PrimeSTAR HS was purchased from Beijing Baori Biotechnology Co., Ltd.

[0083] The E. coli BL21(DE3) competent cells and the agarose gel DNA recovery kit were both purchased from Beijing Tiangen Biochemical Technology Co., Ltd.

[0084] The restriction enzymes Nde I, Hind III and T4 DNA ligase were all commercially available products from New England Biolabs (NEB).

[0085] Unless otherwise specified, the specific experiments in the following examples were carried out according to the conventional methods and conditions in the art, or in accordance with the product instructions of the kit.

[0086] Example 1 Construction of the 7β-hydroxysteroid dehydrogenase expression system

[0087] The coding gene fragment of 7β-hydroxysteroid dehydrogenase Rs7β-HSDH was synthesized by GenScript Corporation for the full gene, and Nde I and Hind III restriction enzyme sites were added to both ends of the coding region. After the target gene fragment and the empty vector pET28a(+) were double digested with restriction enzymes Nde I and Hind III at 37°C for 4 hours respectively, the agarose gel DNA recovery kit was used to recover the digested target gene fragment and vector by cutting the gel. Subsequently, at 16°C, the target gene and the vector were ligated overnight using T4 DNA ligase. The ligation solution was transformed into E. coli DH5α and spread on an LB medium plate containing 50 μg / mL kanamycin, and cultured at 37°C for 12 hours. Single colonies were picked and sequenced (Beijing Tsingke Biotechnology Co., Ltd.). After successful sequencing verification, the plasmid was extracted, and the extracted plasmid was transformed into E. coli BL21(DE3) competent cells to obtain the recombinant expression strain pET28a(+)-Rs7β-HSDH / BL21(DE3) containing the recombinant plasmid pET28a(+)-Rs7β-HSDH.

[0088] Example 2 Construction of single point mutants of 7β-hydroxysteroid dehydrogenase

[0089] The corresponding site-directed mutagenesis primers were designed and artificially synthesized respectively. Using the pET28a(+)-7β-HSDH recombinant plasmid as a template, the full-length mutant DNA fragment was obtained by PCR. The PCR product was transformed into E. coli DH5α and spread on an LB medium plate containing 50 μg / mL kanamycin, and cultured at 37°C for 12 hours, and sequenced (Beijing Tsingke Biotechnology Co., Ltd.). After successful sequencing verification, the plasmid was extracted, and the extracted plasmid was transformed into E. coli BL21(DE3) competent cells, thus obtaining the recombinant expression strain containing the single point mutant plasmid.

[0090] The primers used are as follows:

[0091] The upstream primer sequence for the G28A mutation (substituting glycine at position 28 with alanine):

[0092] 5’GCGCGCAGAACATTGGTGCTGCGATCGCACGCGCATTCGCCGG 3’ (as shown in SEQ ID No.5)

[0093] The downstream primer sequence for the G28A mutation (substituting glycine at position 28 with alanine):

[0094] 5’CCGGCGAATGCGCGTGCGATCGCAGCACCAATGTTCTGCGCGC 3’ (as shown in SEQ ID No.6);

[0095] The upstream primer sequence for the T94I mutation (substituting threonine at position 94 with isoleucine):

[0096] 5’CAGCGTTTGGTGGCCTGAGCATCCTGGTGAACAACGTGGGCTG 3’ (as shown in SEQ ID No.7)

[0097] The downstream primer sequence for the T94I mutation (substituting threonine at position 94 with isoleucine):

[0098] 5’CAGCCCACGTTGTTCACCAGGATGCTCAGGCCACCAAACGCTG 3’ (as shown in SEQ ID No.8)

[0099] The upstream primer sequence for the T114G mutation (substituting threonine at position 114 with glycine):

[0100] 5’ACCCGCTGGCGGTTACCGAAGGCCAAATGCTCGACAGCTATAA 3’ (as shown in SEQ ID No.9)

[0101] The downstream primer sequence for the T114G mutation (substituting threonine at position 114 with glycine):

[0102] 5’TTATAGCTGTCGAGCATTTGGCCTTCGGTAACCGCCAGCGGGT 3’ (as shown in SEQ ID No.10)

[0103] The upstream primer sequence for the M116F mutation (substituting methionine at position 116 with phenylalanine):

[0104] 5’GGCGGTTACCGAAACCCAATTTCTCGACAGCTATAAACTGAA 3’(as shown in SEQ ID No.11)

[0105] Downstream primer sequence for M116F mutation (methionine at position 116 is replaced by phenylalanine):

[0106] 5’TTCAGTTTATAGCTGTCGAGAAATTGGGTTTCGGTAACCGCC 3’(as shown in SEQ ID No.12)

[0107] Upstream primer sequence for T124V mutation (threonine at position 124 is replaced by valine):

[0108] 5’TCGACAGCTATAAACTGAATGTGATTTCTGCGTACCGCATGAC 3’(as shown in SEQ ID No.13)

[0109] Downstream primer sequence for T124V mutation (threonine at position 124 is replaced by valine):

[0110] 5’GTCATGCGGTACGCAGAAATCACATTCAGTTTATAGCTGTCGA 3’(as shown in SEQ ID No.14)

[0111] Upstream primer sequence for A132Q mutation (alanine at position 132 is replaced by glutamine):

[0112] 5’TTTCTGCGTACCGCATGACCCAAGCGTGTGTGCCGCATCTGCT 3’(as shown in SEQ ID No.15)

[0113] Downstream primer sequence for A132Q mutation (alanine at position 132 is replaced by glutamine):

[0114] 5’AGCAGATGCGGCACACACGCTTGGGTCATGCGGTACGCAGAAA 3’(as shown in SEQ ID No.16)

[0115] Upstream primer sequence for V135L mutation (valine at position 135 is replaced by leucine):

[0116] 5’ACCGCATGACCGCGGCGTGTCTGCCGCATCTGCTGCAGGCAAA 3’(as shown in SEQ ID No.17)

[0117] Downstream primer sequence for V135L mutation (replacement of valine at position 135 with leucine):

[0118] 5’TTTGCCTGCAGCAGATGCGGCAGACACGCCGCGGTCATGCGGT 3’ (as shown in SEQ ID No.18)

[0119] Inoculate the recombinant expression strain containing the mutant plasmid into LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl) containing 50 μg / mL kanamycin, and culture it overnight at 37°C with shaking. Then, inoculate it into a 250 mL Erlenmeyer flask containing 50 mL of TB medium at an inoculation amount of 1% (v / v), and culture it at 37°C and 200 rpm on a shaker. When the OD 600 of the culture reaches 0.6, add IPTG with a final concentration of 0.2 mmol / L as an inducer. After inducing for 24 h at 16°C, centrifuge the culture to collect the cells, resuspend the cells with phosphate buffer (100 mM, pH 8.0), and ultrasonically disrupt them. Centrifuge at 4°C and 12,000 rpm for 10 min, collect the supernatant, load the supernatant onto a nickel column, first elute the impurity proteins with solution A, and then elute the target protein 7β-hydroxysteroid dehydrogenase with solution B. Collect the purified target protein, add glycerol with a concentration of 20% (w / v), and obtain the pure enzyme of 7β-hydroxysteroid dehydrogenase, which is stored at -80°C for later use. Solution A is: PBS buffer (20 mM, pH 7.5) containing 500 mM NaCl, 10 mM imidazole, and 5 mM β-mercaptoethanol; solution B is: PBS buffer (20 mM, pH 7.5) containing 500 mM NaCl, 500 mM imidazole, and 5 mM β-mercaptoethanol.

[0120] The activity assay is carried out by detecting the change in absorbance at 340 nm caused by NADH using a UV-visible spectrophotometer. The assay system (total volume 1 mL): includes 970 μL of 100 mM, pH 8.0 phosphate buffer, 10 μL of NADH with a concentration of 20 mM, 10 μL of 7-ketolithocholic acid with a concentration of 100 mM, and 10 μL of enzyme solution (note: the enzyme solution should be appropriately diluted to ensure that the change in absorbance per minute is between 0.1 and 0.2). Under the above conditions, the enzyme activity unit (U) is defined as the amount of enzyme required to catalyze the oxidation of 1 μmol of NADH per minute.

[0121] Calculation formula for enzyme activity: Enzyme activity (U) = ΔA × V × dilution factor × 10 3 / (ε×l). Where ΔA is the change in absorbance at 340 nm within 1 min; V is the volume of the reaction solution (mL); molar extinction coefficient ε [L / (mol·cm)]: 6220; l is the optical path length (cm).

[0122] The calculation formula for specific enzyme activity: specific activity (U / mg) = enzyme activity (U) / protein concentration (mg).

[0123] The inactivation half-life of the mutant enzyme was measured under the condition of 40 °C.

[0124] The results of activity and stability measurements are listed in Table 1.

[0125] Table 1 Activity list of wild-type and single-point mutants of 7β-hydroxysteroid dehydrogenase

[0126]

[0127] In the fold increase in activity, + represents that the specific activity of the mutant enzyme is increased to 1.5 - 3 times that of the wild-type enzyme; ++ represents that the specific activity of the mutant enzyme is increased to 3 - 5 times that of the wild-type enzyme; in the fold increase in stability, + represents that the half-life of the mutant enzyme is extended by 1.2 - 3 times that of the wild-type enzyme; ++ represents that the half-life of the mutant enzyme is extended by 3 - 5 times that of the wild-type enzyme

[0128] Example 3 Construction of double-point mutants of 7β-hydroxysteroid dehydrogenase

[0129] On the basis of Example 2, the mutation sites and residues were combined pairwise by PCR. Using the corresponding single-point mutant recombinant plasmid as a template and using primers for overlapping mutations, the full-length mutant DNA fragment was obtained by PCR. The PCR product was transformed into E. coli DH5α and spread on an LB medium plate containing 50 μg / mL kanamycin, cultured at 37 °C for 12 hours, and sequenced and verified (Beijing Tsingke Biotechnology Co., Ltd.). After successful sequencing verification, the plasmid was extracted, and the extracted plasmid was transformed into E. coli BL21(DE3) competent cells, thereby obtaining a recombinant expression strain containing the double-point mutant plasmid. Through screening, the double-point mutants with increased activity are listed in Table 2.

[0130] Table 2 Activity list of two-point mutants of 7β-hydroxysteroid dehydrogenase

[0131]

[0132]

[0133] Among the multiples of increased activity, ++ indicates that the specific activity of the mutant enzyme is 3 - 5 times higher than that of the wild-type enzyme; among the multiples of increased stability, ++ indicates that the half-life of the mutant enzyme is 3 - 5 times longer than that of the wild-type enzyme; +++ indicates that the half-life of the mutant enzyme is 5 - 7 times longer than that of the wild-type enzyme

[0134] Example 4 7β-Hydroxysteroid Dehydrogenase Rs7β-HSDH M11 Preparation of the catalyst

[0135] Inoculate the expression strain Rs7β-HSDH as described in Example 3 M11 into TB medium containing 50 μg / mL kanamycin, and culture it overnight at 37°C with shaking. Then, inoculate it into 2 L Erlenmeyer flasks containing 500 mL of TB medium at an inoculation amount of 1% (v / v). A total of 10 flasks are inoculated and placed on a shaker at 37°C and 200 rpm for shaking culture. When the OD 600 of the culture broth reaches 1.2, add IPTG with a final concentration of 0.2 mmol / L as an inducer. After inducing for 24 hours at 16°C, centrifuge the culture broth to collect the cells, and wash them twice with physiological saline to obtain 80 g of resting cells. Place 40 g of the resting cells at -80°C and freeze them overnight, and then freeze-dry them to obtain 10 g of freeze-dried cells containing 7β-hydroxysteroid dehydrogenase. Suspend the remaining 40 g of resting cells in 400 mL of phosphate buffer (50 mM, pH 8.0), disrupt them by high-pressure homogenization, centrifuge at 4°C and 8000 rpm for 45 minutes, and collect the supernatant to obtain the crude enzyme solution of 7β-hydroxysteroid dehydrogenase. Place the crude enzyme solution at -80°C and freeze it overnight, and then perform freeze-drying to obtain 9 g of freeze-dried recombinant 7β-hydroxysteroid dehydrogenase. The freeze-dried cells and freeze-dried enzyme powder of 7β-hydroxysteroid dehydrogenase are stored in a 4°C refrigerator for subsequent use.

[0136] Example 5 Recombinant Rs7β-HSDH M11 Catalyze the synthesis of ursodeoxycholic acid from 7-ketolithocholic acid

[0137] The reaction is carried out in a 100 mL reaction flask. Add 10 mL of potassium phosphate buffer (100 mM, pH 8.0), 0.3 g of 7-ketolithocholic acid (7-oxo-LCA, 75 mM), 0.2 g of glucose, 4 kU / L of the resting cell catalyst of the recombinant Rs7β-HSDH as described in Example 4 M11 of the expressed transformant, 6 kU / L of glucose dehydrogenase, and coenzyme NAD +(0.2 mM), phosphate buffer (100 mM, pH 8.0), react under the conditions of 30 °C and 200 rpm. During the reaction, titrate with 1 M sodium hydroxide to control the pH of the reaction system at 8.0. At the same time, intermittently sample and detect the conversion rate of the reaction by liquid chromatography. After 6 hours of reaction, the conversion rate reaches 98%. After separation and purification, 0.23 g of the product ursodeoxycholic acid is obtained with a purity greater than 98%. The liquid chromatography analysis conditions are as follows: Use a C18 column ( ), the mobile phase is methanol: water (0.005% phosphoric acid) = 75:25, the column temperature is 30 °C, the flow rate is 0.8 mL / min, and the detection wavelength is 210 nm.

[0138] Example 6 Preparation of co-immobilized enzyme of 7β-hydroxysteroid dehydrogenase / isopropanol dehydrogenase

[0139] Dissolve 40 mg of the freeze-dried enzyme powder of Rs7β-HSDH prepared in Example 4 M11 and 20 mg of the freeze-dried enzyme powder of isopropanol dehydrogenase in 10 mL of potassium phosphate buffer (1 M, pH 8.0). Add 1 g of epoxy resin ES-103 and place it in a shaker at 20 °C and 200 rpm for shaking incubation for 20 h for immobilization. After the immobilization is completed, wash it repeatedly with deionized water 5 times to remove the free Rs7β-HSDH M11 and isopropanol dehydrogenase that are not immobilized on the resin, and filter and dry the water to obtain 1.65 g of co-immobilized enzyme of 7β-hydroxysteroid dehydrogenase / isopropanol dehydrogenase.

[0140] Example 7 Synthesis of ursodeoxycholic acid by continuous flow packed bed reactor system

[0141] Pack the co-immobilized enzyme prepared in Example 6 into a hollow stainless steel tube with an inner diameter of 0.46 cm and a length of 15 cm to construct an enzyme-packed column that can catalyze the reduction of 7-ketolithocholic acid to synthesize ursodeoxycholic acid (effective volume 0.84 mL). Then connect the outlet of the 7-ketolithocholic acid reaction raw material tank to the inlet of the peristaltic pump, the outlet of the peristaltic pump to the inlet of the enzyme-packed column, and the outlet of the enzyme-packed column and the inlet of the product storage tank with polytetrafluoroethylene tubes. Prepare a reaction solution containing 7-ketolithocholic acid (20 mM), coenzyme NAD + (0.5 mM), and isopropanol (5% v / v) with potassium phosphate buffer (100 mM, pH 8.0), and place it in the 7-ketolithocholic acid raw material tank for standby. Use a peristaltic pump to continuously inject the reaction solution in the raw material tank into the enzyme-packed column. 7-ketolithocholic acid is catalytically reduced to form ursodeoxycholic acid. The reaction temperature is controlled at 25 °C and the reaction time is 10 min. React continuously for 31 days, and intermittently sample and analyze the conversion rate at the outlet of the enzyme-packed column. The continuous flow packed bed reactor system is as Figure 1As shown. This continuous flow packed bed reactor exhibits very high operational stability, with the conversion rate remaining stable at 95 - 98% during 31 days of continuous reaction, and no decrease in activity was observed. Finally, the productivity of the co - immobilized enzyme of 7β - hydroxysteroid dehydrogenase / isopropanol dehydrogenase was such that 280 grams of ursodeoxycholic acid product could be produced per gram of crude enzyme powder, and the space - time yield STY could reach 1074g UDCA L -1 d -1 .

[0142] Example 8 Cofactor recycling in the biosynthesis of ursodeoxycholic acid.

[0143] 10 mL of the reaction solution as in Example 7 was injected into the enzyme - packed column as described in Example 7 using a peristaltic pump. The reaction time was 10 min, the reaction temperature was controlled at 25 °C, the reaction solution was collected, and 1 M hydrochloric acid was added to adjust its pH to 3.0. The product ursodeoxycholic acid was separated by filtration. The filtrate obtained after filtration contained the cofactors NAD + and NADH. The pH of the filtrate was adjusted to 8.0 with sodium hydroxide, and the substrate 7 - oxolithocholic acid was added to the filtrate to prepare a new reaction solution. The prepared reaction solution was again injected into the enzyme - packed column using a peristaltic pump for reaction. The operation was repeated 10 cycles in the same operation mode. Finally, the conversion rate of the substrate was analyzed by sampling at the end of each cycle. The conversion rate of each cycle reaction remained above 90%, and a total of 0.7 g of ursodeoxycholic acid was obtained. By using this cofactor recycling system, the environmental impact factor for the synthesis of ursodeoxycholic acid decreased from 20 to 8; the material cost was reduced by about 21% compared with the control group that did not use this cofactor recycling system. This cofactor recycling system effectively improved the economy and green sustainability of the biosynthesis of ursodeoxycholic acid.

[0144] In the present invention, SEQ ID No.1 is specifically:[[]]

[0145] <210>1

[0146] <211>801

[0147] <212>DNA

[0148] <213>Roseococcus sp.

[0149] <400>1

[0150]

[0151] SEQ ID No.2 is specifically:[[]]

[0152] <210>2

[0153] <211>264

[0154] <212>PRT

[0155] <213>Roseococcus sp.

[0156] <400>2

[0157]

[0158]

[0159] The above description of the embodiments is to enable those of ordinary skill in the art to understand and use the invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative efforts. Therefore, the present invention is not limited to the above embodiments, and all improvements and modifications made by those skilled in the art without departing from the scope of the present invention as disclosed should be within the protection scope of the present invention.

Claims

1. A 7β-hydroxysteroid dehydrogenase mutant with high stability, characterized in that, it is one of the proteins selected from the group consisting of the following amino acid sequences: (1) replacing glycine at position 28 in the amino acid sequence shown in SEQ ID No. 2 with alanine; (2) replacing threonine at position 94 in the amino acid sequence shown in SEQ ID No. 2 with isoleucine; (3) replacing threonine at position 114 in the amino acid sequence shown in SEQ ID No. 2 with glycine; (4) replacing methionine at position 116 in the amino acid sequence shown in SEQ ID No. 2 with phenylalanine; (5) replacing threonine at position 124 in the amino acid sequence shown in SEQ ID No. 2 with valine; (6) replacing alanine at position 132 in the amino acid sequence shown in SEQ ID No. 2 with glutamine; (7) replacing valine at position 135 in the amino acid sequence shown in SEQ ID No. 2 with leucine; (8) replacing threonine at position 94 in the amino acid sequence shown in SEQ ID No. 2 with isoleucine and replacing threonine at position 124 with valine; (9) replacing threonine at position 94 in the amino acid sequence shown in SEQ ID No. 2 with isoleucine and replacing valine at position 135 with leucine; (10) replacing methionine at position 116 in the amino acid sequence shown in SEQ ID No. 2 with phenylalanine and replacing threonine at position 124 with valine; (11) replacing threonine at position 124 in the amino acid sequence shown in SEQ ID No. 2 with valine and replacing valine at position 135 with leucine; (12) replacing threonine at position 94 in the amino acid sequence shown in SEQ ID No. 2 with isoleucine and replacing methionine at position 116 with phenylalanine.

2. An isolated nucleic acid, characterized in that, the nucleic acid encodes the 7β-hydroxysteroid dehydrogenase mutant as described in claim 1.

3. A recombinant expression vector, characterized in that, it contains the nucleic acid as described in claim 2.

4. A recombinant expression transformant, characterized in that, it contains the recombinant expression vector as described in claim 3.

5. A hydroxysteroid dehydrogenase catalyst, characterized in that, the hydroxysteroid dehydrogenase catalyst is any one of the following: (1) resting cells obtained by culturing the recombinant expression transformant as described in claim 4 or a recombinant expression transformant expressing 7β-hydroxysteroid dehydrogenase with the amino acid sequence shown in SEQ ID No. 2 and separating; (2) freeze-dried cells obtained by freeze-drying the resting cells as described in (1); (3) crude enzyme solution of 7β-hydroxysteroid dehydrogenase obtained by disrupting the resting cells as described in (1); (4) crude enzyme powder obtained by freeze-drying the crude enzyme solution of 7β-hydroxysteroid dehydrogenase as described in (3).

6. Use of a 7β-hydroxysteroid dehydrogenase in the synthesis of ursodeoxycholic acid, characterized in that, Catalyze the asymmetric reduction of 7-ketolithocholic acid using the hydroxysteroid dehydrogenase catalyst as described in claim 5, and then isolate and extract the product ursodeoxycholic acid from the reaction mixture.

7. The application as described in claim 6, wherein: the reaction of the asymmetric reduction requires coenzyme NADH, NADH in the reaction is oxidized to NAD+, and by coupling with other dehydrogenases, NAD+ is catalytically reduced and regenerated to NADH; the other dehydrogenases are glucose dehydrogenase or alcohol dehydrogenase.

8. A co-immobilized enzyme catalyst of 7β-hydroxysteroid dehydrogenase / alcohol dehydrogenase, wherein: co-immobilize the 7β-hydroxysteroid dehydrogenase mutant as described in claim 1 or the 7β-hydroxysteroid dehydrogenase and alcohol dehydrogenase with the amino acid sequence shown in SEQ ID No. 2 onto epoxy resin particles.

9. An application of 7β-hydroxysteroid dehydrogenase in the synthesis of ursodeoxycholic acid, wherein, use a continuous flow packed bed reactor to catalytically synthesize ursodeoxycholic acid by enzyme method, and the continuous flow packed bed reactor comprises the following components: (1) An enzyme-packed column constructed by packing the co-immobilized enzyme catalyst into an empty stainless steel column; (2) A reaction raw material storage tank, a material delivery pump, a material delivery pipeline, a temperature control system and a product storage tank; the outlet of the reaction raw material storage tank is communicated with the inlet of the material delivery pump, the outlet of the material delivery pump is communicated with the inlet of the enzyme-packed column, and the outlet of the enzyme-packed column is communicated with the product storage tank; the enzyme-packed column is placed in the temperature control system, and the 7-ketolithocholic acid substrate solution in the reaction raw material storage tank is transported into the enzyme-packed column through the material delivery pump, and in the enzyme-packed column, the substrate 7-ketolithocholic acid is reduced to generate ursodeoxycholic acid and flows out of the enzyme-packed column, and the outflowing solution enters the product storage tank through the material delivery pipeline; wherein, the co-immobilized enzyme catalyst refers to co-immobilizing the 7β-hydroxysteroid dehydrogenase mutant as described in claim 1 or the 7β-hydroxysteroid dehydrogenase and alcohol dehydrogenase with the amino acid sequence shown in SEQ ID No. 2 onto epoxy resin particles.

10. The application according to claim 9, wherein: it further includes the step of cofactor recycling, including the following steps: (1) Acidify the reaction solution in the product storage tank to pH 2-5 with hydrochloric acid; (2) Filter the acidified reaction solution to separate the product ursodeoxycholic acid; (3) Adjust the pH of the filtrate to 7.5-8.5 with sodium hydroxide; (4) Add 7-ketolithocholic acid to the above solution to obtain a 7-ketolithocholic acid reaction raw material substrate solution, and add it to the reaction raw material storage tank for a new reaction.

Images