Tomato root-specific expression promoter pSlROOT2 and its application

By cloning and validating the tomato root-specific promoter pSlROOT2, the problem that constitutive promoters cannot meet the expression needs of specific tissues was solved, and the specific expression of exogenous genes in tomato roots was achieved, thereby improving the plant's resistance to diseases and pests and its stress resistance.

CN116103290BActive Publication Date: 2025-10-31LANGFANG NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211446224.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-18
Publication Date
2025-10-31
Estimated Expiration
2042-11-18

AI Technical Summary

Technical Problem

In existing technologies, constitutive promoters are continuously and stably expressed in plants, which cannot meet the gene expression needs of specific tissues and stages, and may cause damage to plants. There is a lack of efficient tomato root-specific promoters for transgenic research.

Method used

The tomato root-specific promoter pSlROOT2 was cloned and validated. Expression vectors containing this promoter were screened and constructed using transcriptome sequencing technology. Plant cells were then transformed using Agrobacterium-mediated transformation to achieve root-specific gene expression.

Benefits of technology

This study achieved the specific expression of exogenous genes in tomato roots, improved the plant's resistance to diseases and pests and its stress resistance, and laid the theoretical foundation for new disease-resistant or stress-resistant crop varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116103290B_ABST
    Figure CN116103290B_ABST
Patent Text Reader

Abstract

This invention discloses a tomato root-specific expression promoter pSlROOT2 and its applications. The promoter pSlROOT2 is one of the following nucleotide sequences: 1) the nucleotide sequence shown in SEQ ID NO.1 of the sequence listing; 2) a nucleotide sequence with more than 90% homology to the nucleotide sequence shown in SEQ ID NO.1 of the sequence listing and possessing the function of regulating the specific expression of the target gene in plant roots; 3) a nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO.1 of the sequence listing under highly stringent conditions. This promoter can drive the specific expression of the target gene in plant roots, laying a theoretical foundation for improving the expression and accumulation levels of exogenous genes in specific crop tissues through genetic engineering, and for obtaining new disease-resistant or stress-resistant crop varieties using transgenic methods.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a tomato root-specific expression promoter pSlROOT2 and its applications. Background Technology

[0002] Plant gene expression is regulated at the transcriptional, post-transcriptional, and translational levels. Transcriptional expression is regulated by promoters, which largely determine the site, mode, timing, and level of gene expression. Promoters are classified into three types: constitutive, tissue-specific, and inducible promoters. In recent years, some strong constitutive promoters, such as the tobacco mosaic virus which exhibits high expression efficiency in dicotyledonous plants, have been observed to contribute to gene expression. 35S ( CaMV 35S Promoters and commonly used maize in monocotyledonous plants Ubiquitin and rice Actin Promoters are widely used in plant genetic engineering (Battraw and Hall 1990; McElroy et al. 1990; Christensen et al. 1992). However, constitutive promoter expression is usually unaffected by the external environment, and the promoter gene is continuously, stably, and efficiently expressed in all organs or tissues. This cannot meet the expression requirements of specific genes in specific tissues, and the continuous high-level expression of some target genes in all tissues may harm the host plant (Anami et al. 2013). With the rapid development of science and technology, the expression of exogenous genes in organisms at specific times, in specific tissues, and at specific concentrations, making them more economical and effective, has become a hot topic in genetic engineering research.

[0003] Tissue-specific promoters drive the expression of exogenous genes only in specific tissues of the recipient plant, overcoming the limitations of constitutive promoters. Furthermore, gene expression at different developmental stages and in different tissues is also necessary for plant growth and development. Specific gene expression depends on the cis-acting elements present in the promoter. In addition to the TATA box, CAAT box, and GC box found in general promoters, tissue-specific promoters also contain elements essential for controlling tissue-specific expression. The type, number, and relative position of these elements determine their expression specificity. Tissue-specific promoters are found throughout various plant tissues, including promoters for vegetative organ-specific expression (green tissues, roots) and reproductive organ-specific expression (pistil, pollen, flower, seed, embryo and endosperm, fruit). In transgenic crop breeding research, utilizing efficient and tissue-specific expression promoters is the preferred method for cultivating efficient and safe transgenic crops.

[0004] Plant roots are the foundation of a plant, the sole pathway for absorbing water and inorganic salts, and vital organs for the synthesis and storage of nutrients. Furthermore, roots play a crucial role in protecting the above-ground parts of plants under conditions of drought, salinity, and heavy metal pollution. Therefore, roots play a pivotal role throughout the entire life cycle of a plant. As important nutrient organs, understanding root-specific expression genes, especially their promoters, is of significant value for crop improvement. Root-specific expression systems are primarily used to study the effects of transgenic plants on disease and pest resistance, enhancing plant resistance to soil-borne pathogens (Huang et al., 2006), salt and alkali tolerance, improving plant adaptability to harsh environments (Gao et al., 2011), and altering plant metabolic pathways to increase and improve plant yield and nutrient composition (Xu et al., 2010). It has been reported that... AtWRKY6 Root-specific expression promoter drives cytokinin oxidase 3 ( CKX3 ) is specifically expressed in the roots of tobacco and Arabidopsis thaliana, increasing root biomass by 60% and improving the plant's resistance to drought and heavy metal stress (Werner et al. 2010). Using chickpeas WRKY31 Root-specific expression gene promoters drive chickpeas CKX6 Genes specifically expressed in chickpeas lead to more developed root systems, enhanced drought resistance, and increased mineral content in seeds (Khandal et al. 2020). Zhang et al. (2016) utilized tobacco root-specific genes... NtREL1 Promoter drives soybean resveratrol synthase gene ( AhRS The promoters are specifically expressed in tobacco roots. This demonstrates that root-specific promoters can enhance plant resistance, increase yield, and improve quality, showing promising development potential. The above reports, utilizing transgenic technology to analyze promoter function in different plants, indicate that using model plants such as Arabidopsis thaliana and tobacco as vectors, heterologous transgenic analysis confirms that the function of promoters from other plants is widely recognized and accepted.

[0005] In recent years, multi-gene transformation systems that simultaneously construct several genes onto a single expression vector have gradually replaced traditional methods of repetitive transformation and hybridization for improving nutritional quality (Lin et al. 2003; Wakasa et al. 2006). In such multi-gene expression systems, each gene requires a specific promoter to drive expression, avoiding transgene silencing due to excessive homology of the introduced sequence (Naqvi et al. 2010). To date, most promoters isolated from tomatoes are specifically expressed in leaves and seeds; research on root-specific promoters is limited, and most are cloned from known root-specific genes. Therefore, isolating and identifying superior root-specific promoters is crucial. The inventors previously cloned… SlTIP , SlMT3Two root-specific promoters exist for tomato, but the number of usable root-specific promoters is still relatively small, especially those with high expression efficiency and small fragment size. Therefore, studying the impact of tomato root-specific promoters on the expression efficiency of exogenous genes has important theoretical significance and application value for the targeted expression of exogenous genes in tomatoes. Summary of the Invention

[0006] The purpose of this invention is to provide a tomato root-specific promoter pSlROOT2 and its application. This promoter can drive the specific expression of the target gene in plant roots, laying a theoretical foundation for improving the expression and accumulation level of exogenous genes in specific crop tissues through genetic engineering and obtaining new disease-resistant or stress-resistant crop varieties through transgenic methods.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The tomato root-specific promoter pSlROOT2 has any of the following nucleotide sequences:

[0009] 1) The nucleotide sequence shown in SEQ ID NO.1 of the sequence listing;

[0010] 2) A nucleotide sequence that has more than 90% homology with the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing and has the function of regulating the specific expression of the target gene in plant roots;

[0011] 3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing under highly stringent conditions.

[0012] The stringent conditions are hybridization and washing of the membrane at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0013] Primer pairs were used to amplify the tomato root-specific promoter pSlROOT2, and the nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0014] Gene expression cassettes containing the tomato root-specific promoter pSlROOT2.

[0015] Expression vectors containing the tomato root-specific promoter pSlROOT2.

[0016] Recombinant bacteria containing the tomato root-specific promoter pSlROOT2 mentioned above.

[0017] The application of the tomato root-specific promoter pSlROOT2 in initiating the expression of target genes.

[0018] Furthermore, the initiation of target gene expression refers to initiating target gene expression in plants.

[0019] Furthermore, the expression is root-specific.

[0020] Using the aforementioned plant expression vector, the promoter sequence of this invention can be constructed upstream of any target gene and introduced into plant cells to obtain root-specific transgenic plants. The plant expression vector carrying the promoter sequence of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, direct DNA transformation, microinjection, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant host being transformed is Arabidopsis thaliana.

[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0022] 1. This promoter is a tomato root-specific expression promoter screened by transcriptome sequencing technology. This method is fast, convenient, and highly accurate.

[0023] 2. This promoter can specifically drive the expression of downstream target genes in plant roots, but not in other tissues or organs, thus exhibiting tissue expression specificity.

[0024] 3. Plant roots are important nutrient organs, which breeding experts can utilize. SlROOT2 Promoter-specific expression of target genes in roots can enhance plant resistance to pests and diseases, salt and alkali tolerance, alter plant metabolic pathways, and improve plant yield and nutrient composition. SlROOT2 Promoters lay the theoretical foundation for improving the expression and accumulation of exogenous genes in specific tomato tissues through genetic engineering, and for obtaining new disease-resistant or stress-resistant crop varieties through transgenic methods. Attached Figure Description

[0025] Figure 1 Tomato root-specific genes SlROOT2 Transcriptome data analysis of the expression levels of (Solyc03g096540) in different organs of tomato.

[0026] Figure 2 For tomatoes SlROOT2 Electrophoretic pattern of promoter PCR amplification.

[0027] Figure 3 For tomatoes SlROOT2 Promoter fusion GUS A schematic diagram of the structure of the gene expression vector p1300GN-pSlROOT2.

[0028] Figure 4 The image shows the double enzyme digestion identification pattern of the p1300GN-pSlROOT2 vector.

[0029] Figure 5 Electrophoretic pattern of PCR amplification of T1 generation Arabidopsis thaliana plants transformed with p1300GN-pSlROOT2 vector.

[0030] Figure 6 The results of GUS staining of roots and aerial parts of Arabidopsis thaliana plants transfected with p1300GN-pSlROOT2 vector in generation T1. Detailed Implementation

[0031] Tomato is a typical model plant, and 'Micro-Tom' is a dwarfing mutant of tomato that possesses the basic characteristics of tomato, as well as the advantages of shorter plant size and shorter growth cycle, making it more suitable for functional genomics research. This invention screens for root-specific promoters in tomato based on transcriptome sequencing analysis of different tissues, clones the tomato root-specific expression gene promoter using PCR technology, and replaces the promoter in pCAMBIA1300GN (p1300GN). 35S promoter and GUS Reporter gene fusion was used to obtain Arabidopsis transgenic positive plants through Agrobacterium-mediated transgenic experiments. The promoter expression site and promoter activity were analyzed by GUS histochemical staining and GUS enzyme activity detection. Combined with promoter cis-acting element analysis, the tomato root-specific expression promoter pSlROOT2 with strong activity and stable function was screened out. This provides an effective way to find tomato root-specific expression promoters and lays a theoretical foundation for improving the expression and accumulation level of exogenous genes in specific crop tissues through genetic engineering and obtaining new disease-resistant or stress-resistant crop varieties by applying transgenic methods.

[0032] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the present invention shall fall within the scope of the present invention.

[0033] Unless otherwise specified, all methods used in the following examples are conventional methods. Primers and sequencing were performed by Beijing Meiji Sino Biotechnology Co., Ltd. Rapid endonuclease was purchased from Thermo Fisher Scientific. DNA gel extraction kits, DNA markers, etc. were purchased from Dalian Baosheng Biotechnology Co., Ltd. The tomato 'Micro-Tom', wild-type Arabidopsis thaliana Col-0, Escherichia coli competent strain TOP10, Agrobacterium tumefaciens competent strain GV3101, and the modified plant genetic expression vector p1300GN used in the experiment were all preserved in the inventor's laboratory.

[0034] Example 1

[0035] tomato SlROOT2 Obtaining the full-length sequence of the promoter

[0036] By analyzing the gene expression transcriptome data of the tomato variety Heinz from flower buds, flowers, roots, leaves, and fruits at different stages, a gene specifically expressed in the roots was screened. SlROOT2 (Solyc03g096540) (as shown) Figure 1 (As shown). Based on the predicted Solyc03g096540 sequence from the tomato whole genome sequence, a 2000bp fragment upstream of this locus (nucleotide sequence shown in SEQ ID NO. 1) was selected as the promoter sequence for this gene, and primers were designed. The upstream primer F used was acgacggccagtgcc. aagctt TTTGTGCTCTGCTGTAGAGG (SEQ ID NO.2), downstream primer R is GGACTGACCACCCGG GGATCC GGCTGGTTCTTTTGTTCTCC (SEQ ID NO.3). In upstream primer F, the first 15 bases acgacggccagtgcc form the homologous recombination arm of the p1300GN vector, followed by AAGCTT. Hin The dIII restriction site, the remaining sequence is SlROOT2 Upstream amplification primer sequence; in downstream primer R, the first 15 bases GGACTGACCACCCGG are the homologous recombination arm of the p1300GN vector, followed by GGATCC. Bam HI restriction site, the remaining sequence is SlROOT2 Downstream amplification primer sequences.

[0037] Genomic DNA was extracted from the tomato variety 'Micro-Tom' using the CTAB method. The reaction mixture was as follows: 5 µL 10× buffer, 2 µL dNTPs, 2 µL DNA template, 1 µL DMSO, 1.5 µL each of upstream primer F and downstream primer R, 0.5 µL Kod Plus-Neo polymerase, and 36.5 µL ddH2O. The reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 68℃ extension for 2 min, 35 cycles; and 68℃ incubation for 5 min. After PCR, 5 µL of the reaction mixture was subjected to agarose gel electrophoresis. The results showed that the PCR product contained only one DNA band of 2000 bp. Figure 2 As shown. Figure 2 Lane 1 is marked with a DL5000 marker, with bands from top to bottom of 5000 bp, 3000 bp, 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. Lane 2 is... SlROOT2 Promoter, recover and purify this fragment.

[0038] Example 2

[0039] SlROOT2 Construction of plant expression vectors for promoters

[0040] Using Thermo Fisher Scientific Hin d III and Bam p1300GN was double-digested with HI. The double digestion system was as follows: Hin d III 2 µL, Bam HI 2 µL, p1300GN plasmid 20 µL, FastDigest green buffer 4 µL, ddH2O 12 µL. Digestion was performed at 37℃ for 1 h. After agarose gel electrophoresis, the digestion products were purified using the Tiangen Universal DNA Purification and Recovery Kit (DP214) according to the instructions. The purified PCR fragment was ligated to the recovered empty vector via homologous recombination to construct a PCR product containing... GUS The plant expression vector p1300GN-pSlROOT2 ( Figure 3 The ligation system consisted of: 2.5 µL vector backbone, 2.5 µL purified PCR fragment, 5 µL 2×EasyGeno Assembly Mix, and incubation at 50 °C for 30 min. Then, 10 µL of the ligation product was added to a centrifuge tube containing 50 µL of competent TOP10 cells, gently mixed, incubated on ice for 30 min, heat-shocked at 42 °C for 90 s, incubated on ice for 2 min, and 800 µL of LB liquid medium was added. The mixture was incubated at 37 °C for 45 min, and 200 µL of the bacterial culture was spread onto LB medium plates containing 50 µg / L kanamycin. The plates were incubated upside down at 37 °C for 12–16 h, and the results were observed. The colony PCR amplification system consisted of: 1 µL primer F, 1 µL primer R, 10 µL 2×A8 Mixture, single colony, and 8 µL ddH2O. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 2 min, for 35 cycles; and incubation at 72℃ for 5 min. Plasmids were extracted from positive clones and used... Hin d III and Bam Recombinant DNA was digested with HI, and the recombinant whose digestion and sequencing results were completely correct was named p1300GN-pSlROOT2. The double digestion identification pattern is shown below. Figure 4 As shown, Figure 4 Lane 1 contains the DL5000 Marker, Lane 2 contains the p1300GN-pSlROOT2 plasmid, and Lane 3 contains the p1300GN-pSlROOT2 plasmid. Hin d III and Bam HI double digestion.

[0041] Example 3

[0042] Genetic transformation of Arabidopsis thaliana and detection of positive plants

[0043] The constructed binary expression vectors p1300GN-pSlROOT2 and the empty p1300GN vector were introduced into Agrobacterium GV3101 using the heat shock method. The Arabidopsis plants to be transformed were topped, and open flower buds were removed before transformation. Add 20 μL of Agrobacterium GV3101 bacterial suspension containing p1300GN-pSlROOT2 and p1300GN plasmids to 3 mL of LB (50 μg / mL Kan) liquid medium and incubate at 28℃ and 180 r / min for 36-48 h. Transfer the bacterial suspension to a centrifuge tube and centrifuge at 12000 r / min for 1 min at room temperature to collect the bacterial cells, discarding the supernatant. Resuspend the precipitate in 1 mL of 1 / 2 MS + 5% sucrose solution, centrifuge at 12000 r / min for 1 min, and discard the supernatant. Resuspend the precipitate again in 1 mL of 1 / 2 MS + 5% sucrose solution, then add 0.2 μL of 0.02% Silwet-L77 and mix thoroughly. Use a 200 μL pipette to transfer the bacterial cells to unopened flower buds, label them, and cover with plastic film overnight to improve the transformation rate. The seeds mature in about one month, are harvested, and then dried. T0 generation Arabidopsis seeds were sterilized with 10% NaClO for 10 min, washed 5 times with sterile water, and sown on the surface of MS medium containing 40 μg / mL hygromycin. They were vernalized at 4°C for 2 days and then cultured in a 23°C incubator.

[0044] Genomic DNA was extracted from wild-type Arabidopsis thaliana, transgenic p1300GN-pSlROOT2 plasmid, and p1300GN Arabidopsis thaliana, and selected... GUS Amplification of the target gene was performed. Positive transgenic plants were screened using plant expression vector primers GUS F: ATGTTACGTCCTGTAGAAACC (SEQ ID NO.4) and GUS R: CGGCAATAACATACGGCGTGACATC (SEQ ID NO.5). The PCR amplification reaction system was: 1 μL template, 0.5 μL GUS F, 0.5 μL GUS R, 10 μL 2×A8 Mixture, and 8 μL ddH2O. A 0.6 kb target band was considered positive for PCR amplification. The results showed that all 16 plants tested by PCR were positive (e.g., ...). Figure 5 (As shown). Figure 5 Lane 1 contains molecular weight standards, DL2000 Markers, with molecular weights of 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. Lanes 2-17 contain regenerated plants of some transgenic plant expression vectors.

[0045] The seeds produced by the T0 generation transgenic plant and the plants that grow from those seeds are the T1 generation, and so on. T2 and T3 represent the second and third generations of transgenic plants, respectively.

[0046] Example 4

[0047] GUS histochemical staining of transgenic plants

[0048] Detection using histochemical staining method GUS Gene expression in plant tissue cells. T1 generation transgenic Arabidopsis seedlings obtained in Example 3 were subjected to GUS histochemical staining, with wild-type and transgenic p1300GN (containing...) as the staining agents. 35s The promoter-controlled vector Arabidopsis thaliana served as both negative and positive controls. The Arabidopsis thaliana plants were rinsed with sterile water, surface moisture was removed, and each plant was placed in a 2 mL centrifuge tube. An appropriate amount of GUS staining solution (GUS staining kit SL7160-2 purchased from Coolaber) was added to each tube, and the tubes were incubated at 37°C for 1 h to overnight. After removing the staining solution, the plants were destained with 70% ethanol until the leaves of the negative control material turned white. SteREO Discovery V.12 was used for scanning and photography. The blue color against the white background represents the GUS expression site. Results showed that no blue color was observed in the roots and aerial parts of wild-type Arabidopsis thaliana, indicating the presence of GUS expression. 35S The roots and aerial parts of plants transformed with the promoter control vector were blue, while GUS expression was never detected in the aerial parts of plants transformed with the recombinant vector p1300GN-pSlROOT2, with strong specific expression only in the roots. Figure 6 Therefore, this startup driver GUS The gene is highly expressed only in Arabidopsis roots and not in other tissues and organs, meaning it is a root-specific promoter with significant application value in plant genetic engineering. For example, vectors containing this promoter can be constructed to enhance plant resistance to stress and lodging, transforming recipient plants to artificially create resistant, high-quality, and high-yielding materials for agricultural production.

Claims

1. Application of the tomato root-specific promoter pSlROOT2 in promoting the expression of a target gene in plant roots, wherein the nucleotide sequence of the tomato root-specific promoter pSlROOT2 is the nucleotide sequence shown in SEQ ID NO.1, and the plant is tomato or Arabidopsis thaliana.