Nitrogen regulation gene GDS1 derived from Arabidopsis thaliana and wheat and its uses

Abstract

The present invention discloses a nitrogen regulation gene GDS1 derived from Arabidopsis thaliana and wheat and its uses, belonging to the technical field of plant genetic engineering. The present invention for the first time discovers in Arabidopsis thaliana a new nitrogen regulation gene AtGDS1 that can delay leaf senescence under low-nitrogen and high-nitrogen conditions; this AtGDS1 gene can also simultaneously increase the plant height, pod length, grain size, thousand-grain weight, yield per plant, and nitrogen use efficiency of plants under low-nitrogen and high-nitrogen conditions. Based on the AtGDS1 gene, the present invention further discovers in wheat the TaGDS1 gene, which can increase the particle size, 100-grain weight, and yield per plant of wheat under low-nitrogen and high-nitrogen conditions. The present invention provides new ideas and directions for the cultivation of high-nitrogen-efficient crop varieties with high nitrogen use efficiency under both low-nitrogen and high-nitrogen conditions.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to the nitrogen regulation gene GDS1 derived from Arabidopsis thaliana and wheat and its uses. Background Art

[0002] Nitrogen is one of the macronutrients essential for plant growth and development, and can regulate many processes of plant metabolism and growth and development, such as nitrogen absorption and assimilation (Xu et al., 2016), secondary metabolism (such as anthocyanin synthesis) (Fritz et al., 2006), root architecture (Gan et al., 2012), seed germination (Alboresi et al., 2005) and leaf senescence (Aguera et al., 2010; Zhao et al., 2011; Meng et al., 2016; Liu et al., 2017; Park et al., 2014, 2018, 2019), etc. Leaf senescence is the final stage of leaf development, and is a developmental process caused by the degradation of chlorophyll and chloroplasts, the decomposition of macromolecules and the redistribution of nutrients (Sakuraba et al., 2014).

[0003] Currently, multiple gene families that regulate senescence have been identified, such as the NAC, WRKY, bHLH, MYB, C2H2 zinc finger, AP2-EREBP and bZIP families, etc. (Miao et al., 2004; Buchanan-Wollaston et al., 2005; Guo et al., 2006; Smykowski et al., 2010; Song et al., 2014; Guo et al., 2017; Wang et al., 2021; Yu et al., 2021; Zhang et al., 2021; Zhang et al., 2022). A variety of biotic and abiotic stresses in nature can cause plant leaf senescence, such as drought, high temperature, high salt, darkness, hormones, pathogen infection and nutrient deficiency, etc. (Lim et al., 2007; Aguera et al., 2010; Balazadeh et al., 2010; Song et al., 2014; Liebsch et al., 2016; Zhang et al., 2018; Yu et al., 2021; Li et al., 2021).

[0004] Previous studies have shown that low nitrogen induces leaf senescence to meet the nitrogen requirements of young and developing tissues (Aguera et al., 2010). In agricultural production, nitrogen deficiency often causes premature senescence of crops, leading to a decrease in yield; applying nitrogen fertilizer can inhibit the senescence caused by low nitrogen and ensure high and stable yields of crops. On the other hand, excessive nitrogen application reduces the nitrogen use efficiency of crops, causing a series of environmental problems, such as soil acidification and water eutrophication (Guo et al., 2010; Zhang et al., 2015; Shin et al., 2020; Wu et al., 2020; Liu et al., 2021). Therefore, breeding new varieties with low nitrogen and late senescence and high yield is crucial for improving the yield and nitrogen use efficiency of crops under low nitrogen supply conditions and promoting the green and high-quality development of modern agriculture. Summary of the Invention

[0005] In view of the above prior art, the object of the present invention is to provide a nitrogen regulation gene GDS1 derived from Arabidopsis thaliana and wheat and its uses.

[0006] In the first aspect of the present invention, there is provided the use of the GDS1 gene as a nitrogen regulation gene in at least one of the following (1)-(4):

[0007] (1) Delaying leaf senescence of plants under low nitrogen and high nitrogen;

[0008] (2) Increasing the plant height, pod length, grain size and grain weight of plants under low nitrogen and high nitrogen conditions;

[0009] (3) Increasing the yield per plant and nitrogen use efficiency of plants under low nitrogen and high nitrogen conditions;

[0010] (4) Cultivating high nitrogen efficiency crop varieties;

[0011] The nucleotide sequence of the GDS1 gene is as shown in any one of SEQ ID No.1, SEQ ID No.3-SEQ ID No.8.

[0012] In the above applications, the plant is preferably Arabidopsis thaliana or wheat.

[0013] In the above applications, the GDS1 gene is derived from Arabidopsis thaliana or wheat; preferably, the GDS1 gene is the AtGDS1 gene, and its nucleotide sequence is as shown in SEQ ID No.1; or, the GDS1 gene is the TaGDS1 gene, and its nucleotide sequence is as shown in SEQ ID No.3-SEQ ID No.8.

[0014] In the second aspect of the present invention, there is provided the use of the protein encoded by the GDS1 gene in at least one of the following (1)-(3):

[0015] (1) Delay leaf senescence of plants under low nitrogen and high nitrogen conditions;

[0016] (2) Increase the plant height, pod length, seed size and grain weight of plants under low nitrogen and high nitrogen conditions;

[0017] (3) Increase the yield per plant and nitrogen use efficiency of plants under low nitrogen and high nitrogen conditions.

[0018] In the above applications, the amino acid sequence of the protein encoded by the GDS1 gene is as shown in any one of SEQ ID No.2, SEQ ID No.9 - SEQ ID No.14.

[0019] In the third aspect of the present invention, there is provided the use of a recombinant expression vector or recombinant bacterium containing the GDS1 gene in at least one of the following (1)-(4):

[0020] (1) Delay leaf senescence of plants under low nitrogen and high nitrogen conditions;

[0021] (2) Increase the plant height, pod length, seed size and grain weight of plants under low nitrogen and high nitrogen conditions;

[0022] (3) Increase the yield per plant and nitrogen use efficiency of plants under low nitrogen and high nitrogen conditions;

[0023] (4) Cultivate high nitrogen - efficient crop varieties.

[0024] In the above applications, the recombinant expression vector is constructed using existing plant expression vectors. For example, pPZP211 - GFP, pCambia3301, pc186 or other derivative plant expression vectors.

[0025] The host cell of the recombinant bacterium can be Escherichia coli, Agrobacterium, etc.

[0026] In the fourth aspect of the present invention, there is provided a method for improving the nitrogen use efficiency of plants, including the step of overexpressing the GDS1 gene in plants.

[0027] In the above method, overexpressing the GDS1 gene in plants can be achieved by the method of exogenous transfer of the GDS1 gene; or by up - regulating the expression of the GDS1 gene or its homologous gene in the plant genome.

[0028] In the fifth aspect of the present invention, there is provided a method for cultivating high nitrogen - efficient crop varieties, including the following steps:

[0029] Transfer the GDS1 gene into a wild - type plant and overexpress it, and screen for plants with improved nitrogen use efficiency to obtain high nitrogen - efficient crops.

[0030] In the above method, the GDS1 gene is also derived from Arabidopsis thaliana or wheat; preferably, the GDS1 gene is the AtGDS1 gene, and its nucleotide sequence is as shown in SEQ ID No. 1; alternatively, the GDS1 gene is the TaGDS1 gene, and its nucleotide sequence is as shown in SEQ ID No. 3 - SEQ ID No. 8.

[0031] Advantages of the present invention:

[0032] The present invention for the first time discovers a new nitrogen regulation gene AtGDS1 in Arabidopsis thaliana that can delay leaf senescence under low-nitrogen and high-nitrogen conditions; this AtGDS1 gene can also increase the plant height, pod length, grain size, 1000-grain weight, yield per plant, and nitrogen use efficiency of plants under low-nitrogen and high-nitrogen conditions. Based on the AtGDS1 gene, the present invention further discovers the TaGDS1 gene in wheat, which can increase the grain size, 100-grain weight, and yield per plant of wheat under low-nitrogen and high-nitrogen conditions. The present invention provides new ideas and directions for the cultivation of high-nitrogen-efficient crop varieties with high nitrogen use efficiency under both low-nitrogen and high-nitrogen conditions. Description of the Drawings

[0033] Figure 1 : Vector map of the pPZP211-GFP overexpression vector.

[0034] Figure 2 : Research on the improvement of nitrogen use efficiency by AtGDS1 overexpression lines. WT, AtGDS1-OE-1, and AtGDS1-OE-2 were cultured in substrates containing 0.5 mM, 1 mM, and 5 mM KNO 3 medium, and the leaf senescence phenotype was observed at the mature stage ( Figure 2 A), and the plant height ( Figure 2 B, D), pod length ( Figure 2 C, E), grain size ( Figure 2 F), 1000-grain weight ( Figure 2 G), yield per plant ( Figure 2 H), and nitrogen use efficiency ( Figure 2 I) were statistically analyzed.

[0035] Both AtGDS1-OE-1 and AtGDS1-OE-2 are AtGDS1 overexpression lines, which are just different lines formed by different transformation events, and there are differences in the AtGDS1 overexpression multiples. The use of two different lines is mainly to exclude that the changes in nitrogen use indicators we observed are not caused by the insertion site.

[0036] Figure 3 : Phylogenetic tree analysis of wheat TaGDS1.

[0037] Figure 4: Map of the wheat CRISPR / Cas9 vector pBUE413.

[0038] Figure 5 : Map of the wheat pc186 overexpression vector.

[0039] Figure 6 : Study on the improvement of nitrogen use efficiency by TaGDS1 overexpression lines. Wild-type wheat Fielder, tagds1-3-9, tagds1-11-9, TaGDS1-OE-1, and TaGDS1-OE-2 were cultured in the substrate of high-nitrogen (5 mM KNO 3 ). After maturity, the grain size ( Figure 6 A), 1000-grain weight ( Figure 6 B), and yield per plant ( Figure 6 C) were counted.

[0040] tagds1-3-9 and tagds1-11-9 are knockout mutants obtained using the CRISPR / Cas9 technology, which are different mutants formed by different knockout forms; TaGDS1-OE-1 and TaGDS1-OE-2 are overexpression lines of TraesCS5D02G503700, which are different lines formed by different transformation events, and there are differences in the overexpression multiples of TaGDS1. Two different lines were used mainly to exclude that the changes in nitrogen use indicators we observed were not caused by the insertion sites. Detailed implementation

[0041] It should be noted that the following detailed description is illustrative and aims to provide further explanation for this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs.

[0042] As mentioned above, in agricultural production, nitrogen deficiency often causes premature senescence of crops, leading to a decrease in yield; applying nitrogen fertilizer can inhibit senescence caused by low nitrogen and ensure high and stable yields of crops. However, excessive application of nitrogen fertilizer will also lead to a decrease in the nitrogen use efficiency of crops and cause a series of environmental problems. Therefore, how to ensure high and stable yields of crops under both low-nitrogen and high-nitrogen conditions is an urgent problem to be solved at present.

[0043] Based on this, the present invention has conducted in-depth research on genes regulating plant nitrogen use and found that overexpressing the AtGDS1 gene in Arabidopsis can delay leaf senescence of plants under low-nitrogen and high-nitrogen conditions and improve the yield and nitrogen use efficiency of plants. The nucleotide sequence of the AtGDS1 gene is shown in SEQ ID No.1, and the amino acid sequence of its encoded protein is shown in SEQ ID No.2.

[0044] Furthermore, the present invention used bioinformatics methods to identify the TaGDS1 family in wheat and conducted an evolutionary analysis of the wheat TaGDS1 family. Two genes with high homology were found, containing 6 subgenomes, namely: TraesCS2A02G143700, TraesCS2B02G168700, TraesCS2D02G147300, TraesCS5A02G488700, TraesCS5B02G502600, and TraesCS5D02G503700; their nucleotide sequences are shown in SEQ ID No.3 - SEQ ID No.8 respectively, and the amino acid sequences of the encoded proteins are shown in SEQ ID No.9 - SEQ ID No.14 respectively. The present invention constructed overexpression lines and knockout mutants of the TaGDS1 gene respectively, and found that overexpressing the TaGDS1 gene in wheat could increase the grain size, 1000-grain weight, and yield per plant under low-nitrogen and high-nitrogen conditions.

[0045] Therefore, the GDS1 genes derived from Arabidopsis thaliana and wheat can be used as nitrogen regulation genes. Overexpressing the GDS1 gene can delay the premature senescence of plant leaves under low-nitrogen and high-nitrogen conditions, improve yield and nitrogen use efficiency, and thus the present invention is proposed.

[0046] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in conjunction with specific embodiments.

[0047] The test materials used in the embodiments of the present invention are all conventional test materials in the art and can be obtained through commercial channels. The experimental methods without specific conditions are carried out according to conventional test methods or the operation manuals recommended by the suppliers.

[0048] Example 1: Construction and performance investigation of overexpression lines of Arabidopsis thaliana AtGDS1 gene

[0049] 1. Construction of overexpression lines of Arabidopsis thaliana AtGDS1 gene:

[0050] The present invention cloned the coding region of the Arabidopsis thaliana AtGDS1 gene by PCR method and constructed a plant overexpression vector of this gene.

[0051] Using the cDNA of Arabidopsis thaliana leaves at the seedling stage growing normally as a template, the coding region of the AtGDS1 gene was amplified by PCR with the upstream primer 5’-atggtaccATGAATCCAT TGAC-3’ (SEQ ID No.15) and the downstream primer 5’-atgtcgacACGACGGCGATCTT-3’ (SEQ ID No.16).

[0052] The amplified products were recovered by gel cutting, and the fragments were digested with KpnI and SalI enzymes, and then ligated to the modified vector pPZP211-GFP. The ORF fragment of AtGDS1 was ligated between the KpnI and SalI sites of the vector to construct an overexpression Arabidopsis vector. The pPZP211-GFP vector has a kanamycin gene as a plant transformation selection marker (see Figure 1 ). After the AtGDS1 ORF fragment on the vector was sequenced correctly, it was transferred into Agrobacterium tumefaciens GV3101, and the wild-type Arabidopsis (Col) was infected by the floral dip method. The T0 generation seeds were treated with 2.5% sodium hypochlorite at room temperature for 10 min, washed 5 times with sterile water, and then evenly spread on MS plates (containing 50 mg / L kanamycin). After being treated at 4°C for 3 days, they were transferred to a 22°C incubator for growth. Germination occurred in about 7-10 days. The transgenic plants had dark green leaves and longer roots; the non-transformed plants had light green leaves and short roots and could not survive for a long time. The transformants were transplanted into nutrient soil to grow until the T1 generation seeds were harvested. The T1 generation seeds were screened by the above method, and the T2 generation seeds were harvested (multiple individual plants were harvested from each line). The seeds of each T2 generation individual plant were screened separately, planted, and the T3 generation seeds of each individual plant were collected. The T3 generation seeds of each individual plant were screened. Those without segregation in the offspring (all resistant to kanamycin) were homozygous overexpression lines. After identifying the overexpression multiple, 2 homozygous overexpression lines, AtGDS1-OE-1 and AtGDS1-OE-2, were selected for performance investigation.

[0053] 2. Performance investigation of Arabidopsis AtGDS1 gene overexpression lines:

[0054] The Arabidopsis seeds of the wild type (WT) and overexpression lines (AtGDS1-OE-1, AtGDS1-OE-2) were sown in a substrate containing low nitrogen (0.5 mM, 1 mM KNO 3 ) and high nitrogen (5 mM KNO 3 ) nutrient solution and cultured until maturity. Their senescence phenotypes (number and area of green leaves) were observed, and the plant height, pod length, seed size, 1000-seed weight, yield per plant, and nitrogen use efficiency (NUE, calculation method: yield / nitrogen application rate) were statistically analyzed.

[0055] The results are as Figure 2 shown. The results show that in Arabidopsis, the AtGDS1 overexpression lines can delay the leaf senescence of plants under low nitrogen and high nitrogen conditions, increase the plant height, pod length, seed size, and 1000-seed weight of the overexpression lines, thereby increasing the yield and nitrogen use efficiency.

[0056] Example 2: Construction and performance investigation of wheat TaGDS1 overexpression lines and knockout mutants

[0057] The present invention uses bioinformatics methods to find the TaGDS1 family in wheat and names it according to its chromosomal localization; evolutionary analysis of the wheat TaGDS1 family reveals two genes with high homology, containing six subgenomes (see Figure 3 ). Currently, the function of wheat TaGDS1 is still unclear, and there is no report on whether it plays a role in regulating yield and nitrogen use efficiency. To deeply study the function of the wheat TaGDS1 gene, we designed CRISPR knockout targets at conserved sites in six subgenomes for constructing tagds1 knockout mutants; and selected TraesCS5D02G503700 with the highest expression level for cloning and transformed the wild-type wheat variety Fielder to construct an overexpression line of TraesCS5D02G503700.

[0058] 1. Construction of wheat tagds1 CRISPR knockout mutants:

[0059] The double-target sequences are as follows:

[0060] Target 1: GCAGGTGATAAACCAGAAGGAGG (SEQ ID No.17)

[0061] Target 2: CCATGTGGAGAAGTACAAGAAGA (SEQ ID No.18)

[0062] Target 1 and Target 2 are designed for conserved sites in six subgenomes (the same sequences contained in the ABD subgenomes)

[0063] By designing the targets, all six subgenomes are knocked out.

[0064] The primers containing the double targets are as follows:

[0065] TaGDS1-MT1T2-F: AATAATGGTCTCAAGCGCAGGTGATAAACCAGAAGG (SEQ ID No.19)

[0066] TaGDS1-MT1T2-F0: GCAGGTGATAAACCAGAAGGGTTTTAGAGCTAGAAATAGC (SEQ IDNo.20)

[0067] TaGDS1-MT1T2-R0: CTTCTTGTACTTCTCCACACGCTTCTTGGTGCC (SEQ IDNo.21)

[0068] TaGDS1-MT1T2-R: ATTATTGGTCTCTAAACCTTCTTGTACTTCTCCACA (SEQ ID No. 22)

[0069] Using the above 4 pairs of primers, the dual targets were ligated into the pBUE413 vector (Xing et al., 2014) to construct a wheat CRISPR knockout vector. The pBUE413 vector has a plant transformation selection marker bar gene (see Figure 4 ). After the dual targets on the vector were correctly sequenced, they were transferred into Agrobacterium tumefaciens GV3101, which was used to infect the young embryos of the wheat wild-type variety Fielder. T0 generation resistant seedlings were obtained by tissue culture. Genomic DNA was extracted from the leaves of the T0 generation resistant seedlings, and PCR amplification was performed using specific primers for 6 subgenomes. The PCR stock solution was sent to the company for sequencing, and the sequences at the target sites were compared to obtain mutants with all 6 subgenomes knocked out. Two knockout mutant lines, tagds1-3-9 and tagds1-11-9, were selected for subsequent experiments.

[0070] The specific primers for 6 subgenomes are as follows:

[0071] TraesCS2A02G143700: Forward primer 5'-GAATCCAAGTGCTGATAGTCGTC-3' (SEQ ID No. 23), reverse primer 5'-TTCTATAGGTAGAGACGTGCGTTG-3' (SEQ ID No. 24)

[0072] TraesCS2B02G168700: Forward primer 5'-TTCGGCCTCGCTGGTTTCCTTTCTTG-3' (SEQ ID No. 25), reverse primer 5'-GTGTGTATTCCTAGCAAAAAAAATTG-3' (SEQ ID No. 26)

[0073] TraesCS2D021G147300: Forward primer 5'-GCGCTGCCGGCGTGTCGGACGTTC-3' (SEQ ID No. 27), reverse primer 5'-TTAGTCCAAATCACTACGAGCATG-3' (SEQ ID No. 28)

[0074] TraesCS5A02G488700: Forward primer 5'-GCCGGTTAGGCCGCAGTTCAAAAA-3' (SEQ ID No. 29), reverse primer 5'-TTGTGTGTATTGCTAGCAAAAAAAAA-3' (SEQ ID No. 30)

[0075] TraesCS5B02G502600: Forward primer 5'-CCTTCAGTAGCTGTAGAGCTAGCC-3' (SEQ ID No. 31), reverse primer 5'-ATATCAGACGCCACAGCCCTGGGC-3' (SEQ ID No. 32)

[0076] TraesCS5D02G503700: Forward primer 5'-ATATTATTCAGTACAGTACTCCTAT-3' (SEQ ID No. 33), reverse primer 5'-TACGAGCACAATGGTGAATAGGTTG-3' (SEQ ID No. 34)

[0077] 2. Construction of wheat TaGDS1 overexpression lines:

[0078] Using the cDNA of normal growing wheat leaves and pCambia3301-EGFP plasmid as templates, the coding region of TraesCS5D02G503700 gene and the EGFP sequence of pCambia3301-EGFP plasmid were amplified by PCR using the forward primer 5'-AGATCACAAGTTtgtacaATGAATCCCCTGACGCAGG-3' (SEQ ID No. 35) and reverse primer 5'-TCTCCGGGATTTCCTGTACC-3' (SEQ ID No. 36) of TraesCS5D02G503700, and the forward primer 5'-ACAGGAAATCCCGGAGAATGGTGAGCAAGGGCGAG-3' (SEQ ID No. 37) and reverse primer 5'-GATCACCACTTtgtacaTTACTTGTACAGCTCGTCCATGC-3' (SEQ ID No. 38) of EGFP respectively.

[0079] The amplified products were recovered by gel cutting. After digesting the vector pc186 with BsrGI, TraesCS5D02G503700-EGFP was ligated between the BsrGI sites on the pc186 vector using the one-step cloning method (Multi-fragment DNA seamless cloning kit, Vazyme) to construct an overexpression wheat vector. The pc186 vector has a plant transformation selection marker bar gene (see Figure 5) After the TraesCS5D02G503700 ORF fragment on the vector was correctly sequenced, it was transferred into Agrobacterium tumefaciens GV3101, which was used to infect the young embryos of the wild-type wheat variety Fielder. Resistant seedlings of the T0 generation were obtained through tissue culture. The leaves of the T0 generation resistant seedlings were taken to detect the overexpression fold of the TraesCS5D02G503700 gene. A small amount of herbicide was applied to the leaves of the T1 generation to screen for resistant seedlings, and the seeds of the T2 generation were harvested (multiple individual plants were harvested from each line). The seeds of each individual plant in the T2 generation were screened separately, planted, and the seeds of the T3 generation of each individual plant were collected. The T3 generation seeds of each individual plant were screened, and those without segregation in the offspring (all resistant to herbicide) were homozygous overexpression lines. After identifying their overexpression folds, two homozygous overexpression lines, TaGDS1-OE-1 and TaGDS1-OE-2, were selected for performance investigation.

[0080] 3. Performance investigation:

[0081] The seeds of wild-type wheat, tagds1 CRISPR knockout mutants, and TaGDS1 overexpression lines were planted in a substrate containing low-nitrogen (0.5 mM KNO 3 ) and high-nitrogen (5 mM KNO 3 ) nutrient solutions and cultured until maturity, and the grain size, 1000-grain weight, and yield per plant were statistically analyzed.

[0082] The present invention found that TaGDS1 can increase the grain size, 1000-grain weight, and yield per plant of wheat under high-nitrogen conditions ( Figure 6 ).

[0083] The above are only the preferred embodiments of the present application and are not intended to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the protection scope of the present application.

Claims

1. Use of the GDS1 gene as a nitrogen regulation gene in at least one of the following (1)-(4): (1) Delaying leaf senescence of plants under low nitrogen and high nitrogen conditions; (2) Increasing plant height, pod length, grain size, and grain weight of plants under low nitrogen and high nitrogen conditions; (3) Increasing the yield per plant and nitrogen use efficiency of plants under low nitrogen and high nitrogen conditions; (4) Cultivating high nitrogen-efficient crop varieties; The nucleotide sequence of the GDS1 gene is as shown in any one of SEQ ID No.1, SEQ ID No.3 - SEQ ID No.8; The plant or crop variety is Arabidopsis thaliana or wheat.

2. The use according to claim 1, characterized in that, the GDS1 gene is derived from Arabidopsis thaliana or wheat; the GDS1 gene is the AtGDS1 gene, and its nucleotide sequence is as shown in SEQ ID No.1; or, the GDS1 gene is the TaGDS1 gene, and its nucleotide sequence is as shown in SEQ ID No.3 - SEQ ID No.

8.

3. Use of the protein encoded by the GDS1 gene in at least one of the following (1)-(3): (1) Delaying leaf senescence of plants under low nitrogen and high nitrogen conditions; (2) Increasing plant height, pod length, grain size, and grain weight of plants under low nitrogen and high nitrogen conditions; (3) Increasing the yield per plant and nitrogen use efficiency of plants under low nitrogen and high nitrogen conditions; The amino acid sequence of the protein encoded by the GDS1 gene is as shown in any one of SEQ ID No.2, SEQ ID No.9 - SEQ ID No.14; the plant is Arabidopsis thaliana or wheat.

4. Use of a recombinant expression vector or recombinant bacterium containing the GDS1 gene in at least one of the following (1)-(4): (1) Delaying leaf senescence of plants under low nitrogen and high nitrogen conditions; (2) Increasing plant height, pod length, grain size, and grain weight of plants under low nitrogen and high nitrogen conditions; (3) Increasing the yield per plant and nitrogen use efficiency of plants under low nitrogen and high nitrogen conditions; (4) Cultivating high nitrogen-efficient crop varieties; The nucleotide sequence of the GDS1 gene is as shown in any one of SEQ ID No.1, SEQ ID No.3 - SEQ ID No.8; The plant or crop variety is Arabidopsis thaliana or wheat.

5. A method for improving the nitrogen use efficiency of plants, characterized in that, it includes: the step of overexpressing the GDS1 gene in the plant; The nucleotide sequence of the GDS1 gene is as shown in any one of SEQ ID No.1, SEQ ID No.3 - SEQ ID No.8; The plant is Arabidopsis thaliana or wheat.

6. The method according to claim 5, characterized in that, the method for overexpressing the GDS1 gene in the plant includes: exogenously transferring the GDS1 gene; or upregulating the expression of the GDS1 gene in the plant genome.

7. A method for cultivating high nitrogen-efficient crop varieties, characterized in that, it includes the following steps: Transferring the GDS1 gene into a wild-type plant and overexpressing it, screening for plants with improved nitrogen use efficiency, and obtaining high nitrogen-efficient crops; The nucleotide sequence of the GDS1 gene is shown as any one of SEQ ID No.1, SEQ ID No.3 - SEQ ID No.8; The plant is Arabidopsis thaliana or wheat.

Images