A functional gene for enhancing plant resistance to gray mold infection and its application
Through genetic engineering technology, overexpressing the ATCHiC gene in Arabidopsis, the problem of insufficient resistance to Botrytis aurora is solved, tolerance to Botrytis aurora is achieved, and new disease-resistant gene resources are provided.
Patent Information
- Application Number
- CN202310335864.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-31
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2043-03-31
AI Technical Summary
The prior art is difficult to effectively improve the resistance of plants to Botrytis ale, resulting in huge losses to agricultural production by gray mold.
Through genetic engineering technology, the 35S:ATCHiC overexpression vector was constructed, and the ATCHiC gene was transferred into Arabidopsis thaliana to overexpress it under Botrytis stress, thereby improving the resistance of plants to Botrytis aurora.
The tolerance of Arabidopsis to Botrytis aurora is achieved, the colonization of Botrytis aurora and the accumulation of hydrogen peroxide is reduced, and new genetic resources and technical guarantees are provided for cultivating plant seeds with enhanced disease resistance and disease tolerance.
Smart Images

Figure CN116103322B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to the application of using this gene as a positive regulator to enhance the resistance of plants to Botrytis cinerea infection. Background Art
[0002] During the growth and development process, plants face various threats from the ecological environment, and many damages are caused by microorganisms such as pathogenic fungi, bacteria, and viruses. Severe damage to plants will affect the normal growth and maturity of plants, resulting in losses in the quality and yield of crops, and making agricultural production face severe dilemmas.
[0003] Gray mold is an important disease that can harm various plants such as vegetables, fruit trees, and flowers, caused by Botrytis cinerea (B. cinerea). Botrytis cinerea can infect more than 240 plants including Arabidopsis thaliana, and it is a very important model fungus for studying saprophytic fungi. The amount of spores produced by Botrytis cinerea is very large, and the problem of drug resistance caused by the long-term use of a single chemical agent is also very prominent. Therefore, chemical control is relatively difficult, often causing huge economic losses to fruits, vegetables, and melons, and it is an important pathogen that widely exists and harms agricultural production.
[0004] As a classic model plant, the whole genome of Arabidopsis thaliana has been sequenced and is widely used in research fields such as plant genetics, crop biology, developmental biology, and molecular biology. In addition, Arabidopsis thaliana has the characteristics of simple structure, short growth cycle, high reproduction coefficient, strong viability, self-pollination, and easy transformation. Using Arabidopsis thaliana as the research object can achieve the experimental expected goals faster and better, can greatly shorten the experimental time and simplify the experimental conditions, showing superiority that cannot be compared by other organisms. Studying the mechanism of plant response to Botrytis cinerea stress using the model organism Arabidopsis thaliana will provide new gene resources for the genetic improvement of crop stress resistance. Searching for and discovering new functional genes with independent intellectual property rights based on the Arabidopsis thaliana sequencing database (www.arabidopsis.org) is one of the hotspots in the international botanical research field and also the focus of scientific and technological competition among different countries. Arabidopsis thaliana has approximately 130 million base pairs and 29,000 genes. The functional research of most genes is still unclear. Currently, some functional genes that regulate the resistance to pathogen infection have been discovered, such as: MEB2, THE1, GLE1, RPS2, RPS5, RPS6, RPM1, RPP4, RPP7, RPW8, CPR30, BON1, EDS4 etc.
[0005] According to the genomic sequence published by the Arabidopsis thaliana database, ATCHiC (AT4G19810) is a member of the chitinase 18 family of Arabidopsis thaliana. According to the amino acid sequence characteristics, ATCHiCIt can also be attributed to type V chitinase. Plant chitinases are mainly distributed in seeds, stems and leaves. The molecular weight of their proteins is mostly between 20 - 40 kDa, and most of them exist in monomeric form, being heat-stable and resistant to protease hydrolysis. It has now been proven that chitinase is one of the main plant pathogenesis-related proteins. A large number of reports have shown that the expression of chitinase in plants is induced by biotic and abiotic stresses. For ATCHiC So far, only research has found that ATCHiC genes may play a role in defense and developmental regulation. However, the research on their specific roles in regulating the plant defense process is very limited.
[0006] Exploring new methods and ways for disease control, such as using molecular and genetic engineering means to discover genes related to resistance to Botrytis cinerea and study the disease resistance mechanism, and quickly cultivating disease-resistant vegetable varieties have important theoretical and practical significance for controlling Botrytis cinerea in production. Summary of the Invention
[0007] One of the purposes of the present invention is to provide a functional gene that enhances the ability of plants to resist infection by Botrytis cinerea. The second purpose of the present invention is to provide the application of the functional gene as a positive regulator in regulating the resistance of plants to Botrytis cinerea infection.
[0008] The DNA sequence of a functional gene that enhances the ability of plants to resist infection by Botrytis cinerea is shown in SEQ ID No.1.
[0009] Transfer the functional gene shown in the DNA sequence table SEQ ID No: 1 into plants, and the plant is Arabidopsis thaliana. The ATCHiC - OE in Arabidopsis thaliana is an overexpression vector.
[0010] Transfer the functional gene shown in the DNA sequence table SEQ ID No: 1 into wild-type plants by the floral dip method, so that it is overexpressed in wild-type plants, and the plants show tolerance to Botrytis cinerea.
[0011] In the present invention, the above-mentioned plant disease resistance-related protein coding gene in plants ATCHiC The method used for overexpression is to construct 35S: ATCHiC an overexpression vector by genetic engineering technology, transfer it into wild-type plants by the floral dip method, so that it is overexpressed in wild-type plants, and the plants show tolerance to Botrytis cinerea. ATCHiCWhen constructing a gene into a plant expression vector, an enhanced promoter or an inducible promoter can be added before its transcription start nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the used vector is processed to have a resistance antibiotic marker (such as kanamycin). The transformed plant host can be either a monocotyledon or a dicotyledon such as rice, wheat, corn, cucumber, tomato, turfgrass or alfalfa, etc. By using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc., the expression vector carrying ATCHiC the gene is transformed into plant cells or tissues, and the transformed plants are cultivated into plants through tissue culture.
[0012] The beneficial technical effects of the present invention are embodied in the following aspects:
[0013] 1. According to the genomic sequence published in the Arabidopsis database, ATCHiC is a member of the chitinase family of Arabidopsis. The applicant found that ATCHiC after the overexpression of the gene, the plants showed tolerance to Botrytis cinerea stress under Botrytis cinerea stress treatment, which indicates that the ATCHiC gene responds to the regulation of Botrytis cinerea stress.
[0014] The further research results on the function of this gene show that ATCHiC the colonization amount of Botrytis cinerea hyphae and hydrogen peroxide (H2O2) in the overexpressed gene plants are lower than those of the wild-type plants. This shows that overexpression of ATCHiC can improve the resistance of Arabidopsis to Botrytis cinerea, showing tolerance to Botrytis cinerea stress.
[0015] 2. After the overexpression of the ATCHiC gene described in the present invention, it can enhance the tolerance of plants to Botrytis cinerea stress. It provides new gene resources and technical guarantees for the genetic improvement of crop stress resistance. By applying it, plant seeds with enhanced disease resistance and disease tolerance can be cultivated. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 FIG. ATCHiC is the induced expression diagram of the gene in wild-type Arabidopsis under Botrytis cinerea stress.
[0017] Figure 2 FIG. ATCHiC is the screening of overexpressed plants and the diagram of its mRNA expression level.
[0018] Figure 3 FIG. ATCHiC is the comparison photo diagram of the rosette leaves of the gene overexpressed plants and wild-type plants (WT) after 24 hours of treatment with Botrytis cinerea discs in soil culture for 4 weeks.
[0019] Figure 4 It is a schematic diagram of the T-DNA insertion site.
[0020] Figure 5 It is atchic in the mutant ATCHiC Transcription level identification map of the gene.
[0021] Figure 6 It is atchic Comparison photo graph of rosette leaves of mutant and wild-type plants (WT) after 4 weeks of soil cultivation and treatment with Botrytis cinerea discs for 24 h.
[0022] Figure 7 It is a graph showing the gene expression of WT plants ATCHiC induced by salicylic acid (SA), jasmonic acid (JA), and ethylene precursor (ACC). In this experiment, water was used as the control group. Specific implementation manner
[0023] The present invention will be further described below in conjunction with the embodiments.
[0024] A DNA sequence of a functional gene enhancing a plant's resistance to Botrytis cinerea infection is shown in SEQ ID No.1.
[0025] Transfer the functional gene shown in the DNA sequence list SEQ ID No: 1 into a plant, which is Arabidopsis thaliana. The ATCHiC - OE in Arabidopsis thaliana is an overexpression vector.
[0026] Transfer the functional gene shown in the DNA sequence list SEQ ID No: 1 into wild-type plants by the floral dip method to overexpress it in wild-type plants, and the plants show tolerance traits to Botrytis cinerea.
[0027] Unless otherwise specified, the experimental methods in the following examples are all conventional methods.
[0028] Example 1 Cultivation of Arabidopsis thaliana Tolerant to Botrytis cinerea
[0029] 1. Determine ATCHiC whether the gene is involved in the plant's response to Botrytis cinerea stress
[0030] RNA of wild-type (WT) Arabidopsis thaliana treated with Botrytis cinerea stress at different time points was extracted and reverse transcribed into cDNA, and real-time quantitative PCR technology was used for ATCHiC analysis of the transcription level of the gene. It was found that ATCHiC the gene expression level was significantly induced by Botrytis cinerea stress compared with the control group. This result indicates that ATCHiC acts as a positive regulator to respond to Botrytis cinerea stress. See Figure 1 .
[0031] 2、 ATCHiC Obtaining Gene Overexpression Transgenic Lines ATCHiC - OE1 、 OE2 Obtaining
[0032] To verify the function of this gene in the stress regulation of Botrytis cinerea in plants, a ATCHiC gene overexpression vector ( 35S: ATCHiC ) was constructed. First, the target fragment was amplified. Wild-type Arabidopsis thaliana was normally cultured on MS medium for two weeks, and total RNA of the plants was extracted and reverse-transcribed into cDNA. Using the synthesized cDNA as a template, PCR was performed to amplify a sufficient amount of the target product, as shown in Figure 2 A. Then, using the PCR product as a template, a second amplification was performed to introduce restriction enzyme sites. The PCR product and the vector pCAMBIA1301 were digested and recovered. Then, the recovered and purified target DNA fragment and the vector were ligated overnight with T4 DNA ligase. The above ligation solution was transferred into DH5α, and positive clones were detected and screened for sequencing. After the sequencing results were confirmed to be correct, electrotransformation was used to transfer it into Agrobacterium tumefaciens GV3101. The electrotransformed Agrobacterium tumefaciens GV3101 was activated and then spread on an LB medium plate containing double antibiotics (kanamycin, gentamicin). Single colonies were randomly selected, cultured in an LB culture solution containing double antibiotics (kanamycin, gentamicin), and PCR identification was performed using vector primers, as shown in Figure 2 B. After the size of the PCR amplification fragment was consistent with the target gene, the wild-type Arabidopsis thaliana plants were transformed by the floral dip method to obtain ATCHiC gene overexpression transgenic lines, as shown in Figure 2 C. Among them,
[0033] Primer 1:
[0034] F 5' GAGAACACGGGGGACGGTACCATGTCTTCAACAAAACTCATATCGC 3';
[0035] Primer 2:
[0036] R 5' CCTAGGTGCGGCCGCCTCGAGTTAAACCTTCTGTATAGTTCTGGTGGTTG 3'.
[0037] 3、 ATCHiC Transcription Level Identification of Overexpression Transgenic Plants and Comparison of Disease Resistance with Wild-Type Plants
[0038] Quantitative PCR was used to identify the transcription level of ATCHiC overexpression transgenic plants, and finally OE1 and OE2 were selected for the next experiment, see Figure 2D in China. Sow wild type (WT) together with ATCHiC - OE1 and OE2 in the nutrient soil at the same time, and place them in a constant temperature light incubator at 22 °C (photoperiod: 16 hours of light and 8 hours of darkness) for 4 weeks. Disinfect the rosette leaves of the same growth size with 1% sodium hypochlorite and place them in a clean fresh-keeping box lined with appropriately moist filter paper. Use a punch to punch out fungal disks with a diameter of 0.5 cm and carefully place them on the leaves. After 24 hours, it was observed that compared with the wild type WT, the overexpressing plants ATCHiC - OE1 and OE2 showed a tolerant phenotype to Botrytis cinerea on the leaves, see Figure 3 in A. Use quantitative PCR to detect the content of Botrytis cinerea hyphae in the leaves, ATCHiC the colonization amount of Botrytis cinerea hyphae in the overexpressing leaves was less than that of WT, see Figure 3 in B. Use DAB staining method to stain the leaves and observe the accumulation of H2O2 in the leaves, ATCHiC the staining degree of the overexpressing leaves was lighter than that of WT, and the accumulation of H2O2 was less, see Figure 3 in C. The gray-scale analysis of DAB staining is shown in Figure 3 in D. These results indicate that ATCHiC the overexpressing plants are more tolerant to the infection of Botrytis cinerea than WT.
[0039] Example 2 ATCHiC Obtaining of mutants
[0040] 1. Determination of mutant bioinformation and transcriptional level identification
[0041] See Figure 4 , in order to further study the role of the gene in plant response to Botrytis cinerea stress, two ATCHiC gene knockout mutants were obtained from the Arabidopsis thaliana Germplasm Resources Bank in the United States, and were named atchic - 1 , atchic - 2 respectively, and their seed numbers are SALK_061610 and SALK_204213. See Figure 4 , since the seeds are T-DNA insertion mutants, PCR amplification and sequencing were performed with specific primers, and the sequencing results were compared by Blast in the NCBI database, and the T-DNA insertion site information was obtained through comprehensive analysis. See Figure 5 , using quantitative PCR, atchic - 1 and atchic - 2 the mutant materials were identified at the transcriptional level, and it was found that the expression levels of the ATCHiC gene in these two mutants were significantly lower than those of the wild type (WT).
[0042] 2. Comparison of disease resistance between mutant plants and wild type plants
[0043] The wild type (WT) was sown together with atchic - 1 and atchic - 2 in nutrient soil and cultured in a constant temperature light incubator at 22 °C (photoperiod: 16 h light, 8 h dark) for 4 weeks. The rosette leaves of the same size and growth vigor were disinfected with 1% sodium hypochlorite and placed in a clean fresh-keeping box lined with appropriately moist filter paper. A puncher was used to punch out disks with a diameter of 0.5 cm and carefully placed on the leaves. After 24 hours, it was observed that compared with the wild type WT, the mutant plants atchic - 1 and atchic - 2 showed a sensitive phenotype to Botrytis cinerea on the leaves, see Figure 6 A. The content of Botrytis cinerea hyphae in the leaves was detected by quantitative PCR, atchic and the colonization amount of Botrytis cinerea hyphae in the mutant leaves was more than that in the WT, see Figure 6 B. The leaves were stained by DAB staining method to observe the accumulation of H2O2 in the leaves, atchic and the staining degree of the mutant leaves was deeper than that of the WT, and more H2O2 was accumulated, see Figure 6 C. The gray scale analysis of DAB staining is shown in Figure 6 D. These results indicate that atchic the mutant plants are more sensitive to the infection of Botrytis cinerea than the WT.
[0044] 3. Analysis of the hormone signaling pathway of ATCHiC gene in wild type plants
[0045] Plant hormones play a crucial role in the plant disease resistance process, among which salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) play particularly prominent roles. In order to study ATCHiC the signaling pathway through which the Figure 7 gene passes during the disease resistance process, three hormones, SA, JA and ET, were selected to spray and induce the wild type WT respectively. See ATCHiC Samples were collected at time points of 0 h, 3 h, 6 h, 9 h and 12 h, RNA was extracted and reverse transcribed into cDNA, and real-time quantitative PCR technology was used for ATCHiC analysis of the transcriptional level of the ATCHiC gene. It was found that the expression level of the ATCHiC gene was significantly induced by SA compared with the control group, and these results indicate that ATCHiC might respond to Botrytis cinerea stress by participating in the SA signaling pathway.
Claims
1. Use of a functional gene for enhancing a plant's resistance to Botrytis cinerea infection, characterized in that: Overexpressing the gene shown in SEQ ID No: 1 in Arabidopsis thaliana to enhance the ability of Arabidopsis thaliana to resist infection by Botrytis cinerea.
2. The use of a functional gene for enhancing a plant's resistance to Botrytis cinerea infection according to claim 1, characterized in that: Overexpressing the functional gene shown in SEQ ID No: 1 in wild-type Arabidopsis thaliana plants by the floral dip method, and Arabidopsis thaliana can exhibit tolerance traits to Botrytis cinerea.