Application of Rice OsMAPK5 Gene in Regulating Agronomic Traits of Rice

Abstract

The present invention provides an application of the rice OsMAPK5 gene in regulating rice agronomic traits, by knocking out the OsMAPK5 gene or reducing the expression level of the protein encoded by this gene in rice to improve the agronomic traits of rice. The present invention further provides a method for cultivating high-yield transgenic rice, by knocking out the OsMAPK5 gene or reducing the expression level of the protein encoded by this gene in rice to increase the yield of rice. Compared with the wild type, the OsMAPK5 gene mutant obtained in the present invention has increased plant height, increased tiller number, increased effective tillers, longer panicles, longer primary branches, increased number of secondary branches, longer grains, increased 1000-grain weight, increased yield per plant and theoretical yield, indicating that OsMAPK5 can increase the yield of rice by coordinating the relationship among plant height, panicle morphology and grain size, and has the potential for increasing rice yield and practical application significance.

Description

Technical Field

[0001] The present invention belongs to the technical field of botany, and particularly relates to the application of a rice OsMAPK5 gene in regulating the agronomic traits of rice. Background Art

[0002] Rice is an important cereal crop in the world, providing staple food for more than half of the world's population. To fill the huge food gap caused by population growth and arable land reduction, continuously increasing crop yields is an eternal theme. During the rice breeding process, yield and agronomic traits are one of the important traits that breeders have been concerned about. They are mostly complex quantitative traits, jointly controlled by the interaction of multiple genes and the environment. The effective panicle number per unit area, the number of grains per panicle, grain size, and 1000-grain weight are important factors contributing to rice yield and play an important role in increasing rice yield. In recent years, with the development of rice molecular genetics and genomics, many key genes regulating rice panicle morphology, the number of grains per panicle, and seed size have been successively cloned, and a good understanding of the molecular basis and genetic regulatory network of rice panicle formation has been achieved. However, in the actual breeding process, due to the differences in backgrounds between different rice varieties, some genes have limitations in the breeding process. Therefore, deeply exploring rice yield-related genes and clarifying their molecular mechanisms are of great significance for rice breeding and increasing rice yield.

[0003] The mitogen-activated protein kinase (MAPK) cascade is an important signaling module in eukaryotes. They act downstream of signal sensors / receptors to coordinate cellular responses, thus enabling the normal growth / development of organisms and their response to environmental changes. The MAPK signaling cascade includes MAPKKK, MAPKK, and MAPK, which are activated by sequential phosphorylation. The activated MAPKs can phosphorylate multiple downstream substrates, including transcription factors, protein kinases, other enzymes, and structural proteins, thereby leading to the activation of cellular responses. Existing studies have shown that loss-of-function mutants of OsMKK4 or OsMAPK6 form semi-dwarf plants and small grains in rice, but there are no reports in the prior art on how to improve the agronomic traits of rice and increase the rice yield per unit area through OsMAPK genes, especially how to regulate the OsMAPK5 gene. Therefore, exploring the function of this gene and the signal pathways it may participate in is of great significance for enriching the molecular mechanisms of rice yield-related genes and increasing rice yield.

[0004] Technical Solution

[0005] The object of the present invention is to provide the application of the rice OsMAPK5 gene in regulating rice agronomic traits. In particular, a method for obtaining a mutated OsMAPK5 gene is provided, which is further used in rice breeding to obtain transgenic rice with improved agronomic traits and increased rice yield. Specifically, the technical solution of the present invention includes the following three aspects.

[0006] The first aspect of the present invention is to provide the application of a rice OsMAPK5 gene in regulating rice agronomic traits, wherein the CDS region sequence of the OsMAPK5 gene is the gene shown in SEQ NO:1 or its complementary gene, and the protein expressed by the OsMAPK5 gene has the amino acid sequence shown in SEQ NO:2.

[0007] In the present invention, the agronomic traits of rice are improved by knocking out the OsMAPK5 gene or reducing the expression level of the protein encoded by this gene in rice. The improvement of the agronomic traits of rice includes at least one of the agronomic traits of increasing the grain length of rice seeds, increasing the grain weight, increasing the panicle length of rice, increasing the plant height, increasing the number of effective panicles and / or tiller number.

[0008] In the present invention, the method for reducing the expression level of the protein encoded by this gene in rice includes: selecting the OsMAPK5 knockout target, introducing the target by PCR amplification, constructing the CRISPR / Cas9 knockout vector of this gene by using the Golden Gate cloning method, and obtaining mutants through Agrobacterium-mediated transformation after correct sequencing.

[0009] Specifically, the selected OsMAPK5 knockout targets of the present invention are MAPK5-Cas9-T1 and MAPK5-Cas9-T2, wherein MAPK5-Cas9-T1 has the sequence shown in SEQ NO:3, and MAPK5-Cas9-T2 has the sequence shown in SEQ NO:4.

[0010] Among them, obtaining mutants through Agrobacterium-mediated transformation uses the rice variety MH86 as the background material to obtain transgenic materials through Agrobacterium-mediated rice genetic transformation.

[0011] The second aspect of the present invention is to provide a method for cultivating high-yield transgenic rice, which improves the rice yield by reducing the expression level of the protein encoded by the OsMAPK5 gene in rice.

[0012] For the above steps, a CRISPR / Cas9 knockout vector of this gene was constructed, and mutants were prepared through Agrobacterium-mediated transformation. Further, after extracting DNA from the obtained T0 transgenic plants, colony PCR identification was performed using primers OsU3-FD3 / TaU3-RD. Positive plants were selected and cultivated in the experimental field to obtain T1 transgenic plants, and the gene knockout situation was further detected by primers near the target site to obtain homozygous lines. In the specific embodiments of the present invention, 3 specific homozygous lines were obtained, and the three homozygous lines included the OsMAPK5 mutant gene sequences shown in SEQ NO:5 or SEQ NO:6 or SEQ NO:7.

[0013] The third aspect of the present invention lies in the effects of the OSMAPK5 mutation on the agronomic traits of rice, as well as on the panicle morphology and yield.

[0014] The present invention found that the mutation of OSMAPK5, or the deletion of bases or base sequences of different lengths, caused premature termination of protein translation during the expression of the OSMAPK5 gene, resulting in a decrease in the expression level of this protein in the plant. As a result, the plant height increased, the tiller number increased, the effective tiller number increased, the panicle length increased, the primary rachis branch length increased, the secondary rachis branch number increased, the grain length increased, the 1000-grain weight increased, and the yield per plant and the theoretical yield increased.

[0015] Specifically, in the present invention, three homozygous mutant plants mapk5-1, mapk5-2, and mapk5-3 were cultivated. After statistics, it was found that compared with the MH86 wild type, the panicle lengths of the mapk5 mutants mapk5-1, mapk5-2, and mapk5-3 were significantly increased, the primary rachis branches were significantly longer, the secondary rachis branch numbers were significantly increased, and the effective panicle numbers were significantly increased. Through the investigation of the plant height and tiller number of the wild type and mutants in the field, it was found that compared with the MH86 wild type, the plant heights and tiller numbers of the mapk5 mutants mapk5-1, mapk5-2, and mapk5-3 increased. After harvesting, the yield analysis showed that the mapk5 mutants could increase the yield of rice.

[0016] The inventors of the present invention further compared the rice OsMAPK5 gene cloned from indica rice Minghui 86 with japonica rice. Through sequence alignment analysis, it was found that there was a difference in a SNP site between indica rice and japonica rice. In addition, through the yeast two-hybrid technique, it was found that this gene could interact with the OsWRY72 transcription factor, and the interaction between them was further verified using BiFC and pull-down techniques. These results indicate that MAPK5 can increase the yield of rice by coordinating the relationship among plant height, panicle morphology, and grain size, and has the potential and practical significance for increasing rice yield. Brief Description of the Drawings

[0017] Figure 1 It is: Agarose gel electrophoresis analysis of MAPK5 CDS amplification products.

[0018] Figure 2 It is: There is a 1 SNP site difference in MAPK5 between indica and japonica;

[0019] Among them, A: CDS base sequence difference; B: Amino acid sequence difference.

[0020] Figure 3 It is: Schematic diagram of the MAPK5 mutation type in MH86;

[0021] Among them, A: Schematic diagram of the MAPK5 gene structure; B: Three mutation type diagrams; C: Schematic diagrams of three mutant proteins.

[0022] Figure 4 It is: Schematic diagram of the effect of MAPK5 mutation on increasing grain size;

[0023] Figure 5 It is: Histogram of the effect of MAPK5 mutation on increasing grain size;

[0024] Among them, A: Schematic diagram of grain length; B: Schematic diagram of grain width; C: Grain length; D: Grain width; E: Grain thickness; F: 1000-grain weight.

[0025] Figure 6 It is: Schematic diagram of the effect of MAPK5 on spike morphological structure;

[0026] Figure 7 It is: Histogram of the effect of MAPK5 on spike morphological structure;

[0027] Among them, A: Schematic diagram of spike morphology; B: Schematic diagram of young spike length; C: Schematic diagram of mature spike length; D: Schematic diagram of effective spike number per plant; E: Spike length; F: Number of primary rachis branches; G: Number of secondary rachis branches; H: Effective spike number.

[0028] Figure 8 It is: Schematic diagram of the effect of MAPK5 on plant height;

[0029] Among them, A: Schematic diagram of plant height; B: Plant height; C: Tillering number;

[0030] Figure 9 It is: Schematic diagram of the effect of MAPK5 on yield;

[0031] Among them, D: Schematic diagram of yield; E: Seed setting rate; F: Yield per plant; G: Theoretical yield per mu;

[0032] Figure 10 It is: Interaction analysis diagram of MAPK5 and rice WRKY72;

[0033] Among them, A: yeast two-hybrid map; B: BiFC map; C: pull-down map. Detailed implementation manners

[0034] The present invention provides the following specific embodiments for further illustrating the technical solutions of the present invention.

[0035] This embodiment first provides a cloning method for the rice MAPK5 gene.

[0036] After querying on the NCBI website, corresponding primers were designed, and using indica rice MH86 cDNA as a template, the OsMAPK5 gene was cloned. The amplification primers are as follows:

[0037] MAPK5-CDS-F: GGGCTTCGCTGGCTTTC

[0038] MAPK5-CDS-R: AGACGGGATCTCATTTCCATG

[0039] Amplification was carried out using the PCR amplification enzyme KOD FX DNA Polymerase provided by TOYOBO Company. The PCR amplification system: Primer Star 10 μL, ddH2O 7 μL, Primer-F 1.5 μL, Primer-R 1.5 μL, template DNA 1 μL. After adding the sample, mix well and centrifuge. The PCR amplification program is as follows: pre-denaturation at 98 °C for 2 min; denaturation at 98 °C for 10 s, annealing at 65 °C for 30 s, extension at 72 °C for 90 s, for a total of 35 cycles; extension at 72 °C for 5 min; keep at 4 °C constantly. That is, the CDS sequence of the MAPK5 gene was obtained from MH86. After amplification, the PCR product was detected by agarose gel electrophoresis, and the amplified product was sent to the company for sequencing after gel recovery, and thus the CDS sequence of the MAPK5 gene was obtained, as shown in SEQ NO:1, and the amino acid sequence of the protein expressed by the MAPK5 gene is as shown in SEQ NO:2.

[0040] Through sequencing analysis and comparison, it was found that there is a difference in 1 SNP site in the CDS region between indica rice MH86 and Nipponbare (NIP), and this site difference results in the amino acid changing from I to F. In addition, through the CDS alignment analysis of indica rice 9311, Minghui 63 (MH63), Shuhui 498 (R498), Zhenshan 97 (ZS97) and japonica rice Kitaake in the rice database, it was found that this SNP site is different between indica and japonica.

[0041] The second aspect of this embodiment is to provide a method for constructing a MAPK5 mutant material.

[0042] The accession number LOC_Os03g17700 of the MAPK5 gene was logged into the CRISPR-GE (http: / / skl.scau.edu.cn / home / ) website for the prediction of CRISPR / Cas9 knockout targets. At the same time, appropriate target sequences were selected as gRNA targets in the front section of the coding region and the conserved region of protein kinase. Then, the target sequences were logged into the CRISPRRGEN Tools (http: / / www.rgenome.net / cas-offinder / ) website for off-target analysis. Finally, the following targets were selected, as shown in SEQ NO:3 and SEQ NO:4.

[0043] MAPK5-Cas9-T1: AATAATGGTCTCTGGCGATCCCGCCGCCGATCCCTCGTTTTAGAGCTAGAAATAGC

[0044] MAPK5-Cas9-T2: ATTATTGGTCTCTAAACACGATGACGCACGGCGGCCGGCTTC TTGGTGCC

[0045] Then, PCR amplification was carried out to introduce the targets. Finally, the CRISPR / Cas9 knockout vector of this gene was constructed using the Golden Gate cloning method in pHUE411. After correct sequencing, the recombinant plasmid was transformed into competent cells of Agrobacterium tumefaciens (EHA105) by the freeze-thaw method. Using MH86 as the background material, transgenic materials were obtained through Agrobacterium-mediated rice genetic transformation. After extracting DNA from the obtained T0 generation transgenic plants, specific primers of the CRISPR / Cas9 vector were used to detect whether they were positive plants. The primer sequences are as follows:

[0046] OsU3-FD3: 5'-GACAGGCGTCTTCTACTGGTGCTAC-3'

[0047] TaU3-RD: 5'-CTCACAAATTATCAGCACGCTAGTC-3'

[0048] The positive plants were planted in the experimental field. After harvesting the seeds of each individual plant of the T1 generation seedlings and extracting DNA from the leaves, primers were designed near the two targets to detect the knockout situation. The primer sequences are as follows:

[0049] K5-Cas9-T1-F: CTTTGAGACGAGGGAGATGGT

[0050] K5-Cas9-T1-R: CGTTCGCCGAGTGGATG

[0051] K5-Cas9-T2-F: CCTCATCGCCTTGCTGTCT

[0052] K5-Cas9-T2-R: CTCCCTCGTCTCAAAGTTCATC

[0053] Three homozygous lines were obtained through detection. Meanwhile, it was found that the protein translation of three mutants was prematurely terminated due to mutations.

[0054] The third aspect of this example is the effect of MAPK5 mutation on the agronomic traits of rice and its effect on yield.

[0055] After the mature rice was harvested, the grain length, grain width, grain thickness and 1000-grain weight were measured and statistically analyzed. It was found that compared with the MH86 wild type, the grain lengths of the mapk5 mutants mapk5-1, mapk5-2, and mapk5-3 were significantly longer, while the grain width and grain thickness had no difference from those of the WT, and the 1000-grain weight of the mutants was also significantly higher than that of the wild type. The mutation positions of the base sequences of the mapk5-1, mapk5-2, and mapk5-3 mutants are as Figure 3 shown in B. Specifically, the mapk5-1 mutant includes the base sequence shown in SEQ NO:5, the mapk5-2 mutant includes the base sequence shown in SEQ NO:6, and the mapk5-3 mutant includes the base sequence shown in SEQ NO:7.

[0056] After observing and statistically analyzing the panicle length, panicle morphology, number of primary branches, number of secondary branches and number of effective panicles of the rice after filling and mature panicles respectively, it was found that referring to Table 1-3 of the present invention, the attached Figures 4 - 7 bar chart of the rice agronomic trait data shown, compared with the MH86 wild type, the panicle lengths of the mapk5 mutants mapk5-1, mapk5-2, and mapk5-3 were significantly increased, the primary branches were significantly longer, the number of secondary branches was significantly increased, and the number of effective panicles was significantly increased. After investigating the plant height and tiller number of the wild type and mutants in the field, it was found that referring to the attached Figures 8 - 9 bar chart shown, compared with the MH86 wild type, the plant heights of the mapk5 mutants mapk5-1, mapk5-2, and mapk5-3 were increased, the tiller number was increased, and after analyzing the yield after harvest, it was found that the mapk5 mutants could increase the yield of rice.

[0057] Table 1. Statistical table of rice seed traits after rice maturation

[0058] Variety MH86 mapk5 - 1 mapk5 - 2 mapk5 - 3 Grain length / mm 9.40 10.85 10.88 10.97 Grain width / mm 2.64 2.73 2.72 2.76 Grain thickness / mm 2.18 2.16 2.15 2.16 1000 - grain weight / g 30.27 34.79 33.35 33.54

[0059] Table 2. Statistical table of mature panicle traits of rice

[0060] Variety MH86 mapk5 - 1 mapk5 - 2 mapk5 - 3 Panicle length / cm 26.46 29.52 30.6 30.68 Number of primary branches 12 16 15 14 Number of secondary branches 61 85 78 77 Number of effective panicles 12 16 16 16

[0061] Table 3. Statistical Table of Rice Agronomic Traits after Rice Maturity

[0062]

[0063]

[0064] The fourth aspect of the present invention is the interaction analysis between MAPK5 and rice OsWRKY72

[0065] It was found by yeast two-hybrid technology that MAPK5 can interact with rice OsWRKY72. At the same time, we also proved that MAPK5 can interact with rice OsWRKY72 by BiFC and pull-down technologies.

[0066] Using MH86 as the background material, three homozygous mutant lines, osmapk5-1, osmapk5-2, and osmapk5-3, were obtained by CRISPR / Cas9 technology and Agrobacterium-mediated rice genetic transformation, respectively. Phenotypic analysis found that compared with the wild type, the mutant plants had increased plant height, increased tiller number, increased effective tillers, longer panicles, longer primary branches, increased secondary branch number, longer grains, increased 1000-grain weight, increased yield per plant and theoretical yield. In addition, it was found by yeast two-hybrid technology that this gene can interact with the OsWRY72 transcription factor, and the interaction between them was further verified by BiFC and pull-down technologies. These results indicate that MAPK5 can increase rice yield by coordinating the relationship among plant height, panicle morphology and grain size, and has the potential for increasing rice yield and practical application significance.

Claims

1. Use of a rice OsMAPK5 gene in regulating rice agronomic traits, characterized in that, The CDS region sequence of the OsMAPK5 gene is the gene shown in SEQ NO:1 or its complementary gene, and the protein expressed by the OsMAPK5 gene has the amino acid sequence shown in SEQ NO:2; the rice agronomic traits include rice grain length, 1000-grain weight, panicle length, primary branch length, secondary branch number, effective panicle number, plant height and / or tiller number.

2. Use of the rice OsMAPK5 gene according to claim 1 in regulating rice agronomic traits, characterized in that, By knocking out the OsMAPK5 gene or reducing the expression level of the protein encoded by this gene in rice to increase rice seed grain length, seed grain weight, panicle length, plant height, and increase the effective panicle number and / or tiller number.

3. Use of the rice OsMAPK5 gene according to claim 2 in regulating rice agronomic traits, wherein, The method for reducing the expression level of the protein encoded by this gene in rice includes: selecting the OsMAPK5 knockout target, introducing the target by PCR amplification, constructing the CRISPR / Cas9 knockout vector of this gene, and obtaining mutants through Agrobacterium-mediated transformation.

4. Use of the rice OsMAPK5 gene according to claim 3 in regulating rice agronomic traits, wherein, The OsMAPK5 knockout targets are MAPK5-Cas9-T1 and MAPK5-Cas9-T2, where MAPK5-Cas9-T1 has the sequence shown in SEQNO:3, and MAPK5-Cas9-T2 has the sequence shown in SEQ NO:

4.

5. Use of the rice OsMAPK5 gene according to claim 1 in regulating rice agronomic traits, characterized in that, The rice is indica rice Minghui 86.

6. A method for cultivating high-yield transgenic rice, characterized in that, By reducing the expression level of the protein encoded by the OsMAPK5 gene in rice to increase the yield of rice; the CDS region sequence of the OsMAPK5 gene is the gene shown in SEQ NO:1 or its complementary gene.

7. The cultivation method of high-yield transgenic rice according to claim 6, characterized in that, Reducing the expression level of the protein encoded by the OsMAPK5 gene in rice includes: selecting the OsMAPK5 knockout target, introducing the target by PCR amplification, constructing the CRISPR / Cas9 knockout vector of this gene, obtaining mutants through Agrobacterium-mediated transformation, and obtaining the homozygous transgenic rice lines through screening.

8. The cultivation method of the high-yield transgenic rice according to claim 7, wherein, The selected OsMAPK5 knockout targets are MAPK5-Cas9-T1 and MAPK5-Cas9-T2, where MAPK5-Cas9-T1 has the sequence shown in SEQNO:3, and MAPK5-Cas9-T2 has the sequence shown in SEQ NO:

4.

9. The cultivation method of high-yield transgenic rice according to any one of claims 6-8, wherein, The transgenic rice obtained by cultivation has an OsMAPK5 mutant gene sequence including the sequence shown in SEQ NO:5 or SEQ NO:6 or SEQ NO:7.

Images