Kit and application thereof in constructing col2a1 gene mutation type ii collagen disease model pig nuclear transfer donor cell
By applying CRISPR/Cas9 technology and electroporation transfection to porcine cells, the COL2A1 gene was efficiently knocked out, thus constructing a porcine model suitable for type II collagenopathy. This addresses the shortcomings of existing models and provides an efficient research and drug development platform.
Patent Information
- Application Number
- CN202211031148.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-26
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2042-08-26
AI Technical Summary
Existing mouse models cannot realistically simulate the physiological and pathological state of human type II collagen disease, resulting in poor drug development and disease research. Furthermore, primate models are costly and difficult to breed, while pigs, as animal models that are closer to humans, have not yet been widely used in this field.
Using CRISPR/Cas9 technology combined with COL2A1-gRNA3, COL2A1-gRNA4 and NCN protein, the COL2A1 gene was efficiently knocked out in porcine cells via electroporation to prepare recombinant porcine cells, and a type II collagenopathy model pig was constructed using somatic cell cloning technology.
A highly efficient pig model of type II collagen disease was successfully constructed, with a single-cell cloning rate of 97.1% after gene editing. This provides an effective experimental platform for drug screening, efficacy evaluation, and gene therapy, shortening the pig model production cycle and reducing costs.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically to a kit and its application in constructing a pig nuclear transplant donor cell for a type II collagen disease model with a COL2A1 gene mutation. Background Art
[0002] Collagen is the largest protein in the human body, with type II collagen being a key component of articular cartilage and hyaline cartilage. Mutations in the COL2A1 gene, which encodes the precursor to type II collagen, can alter the structure of type II collagen, leading to type II collagenopathies (also known as type II collagenopathies). Type II collagenopathies are autosomal dominant inherited diseases, with primary symptoms including various forms of chondrodysplasia and osteoarthritis.
[0003] The COL2A1 gene encodes the α chain of the type II collagen precursor protein. Three identical α chains fold together to form a homotrimer of the precursor protein, which then cross-links to form mature type II collagen. Within the α chain lies a unique triple helical region characterized by a repeating Gly-XY sequence (Gly represents glycine, and X and Y represent other amino acids). This triple helical structure plays a crucial role in the stability of the collagen molecule.
[0004] Research into the mechanisms of development and progression of type II collagen diseases, as well as the development of corresponding drugs, requires animal models. Currently, mice are the most commonly used animal model. However, mice differ significantly from humans in terms of body shape, organ size, physiology, and pathology, and cannot accurately simulate normal human physiological and pathological conditions. Pigs, as large animals, have similar body size and physiological functions to humans, making them easy to breed and raise on a large scale. Furthermore, they offer lower ethical and animal protection requirements, making them ideal animal models for human diseases.
[0005] Gene editing is a biotechnology that has made significant progress in recent years. It encompasses technologies ranging from homologous recombination-based gene editing to nuclease-based editing techniques such as ZFNs, TALENs, and CRISPR / Cas9. CRISPR / Cas9 is currently the most advanced gene editing technology. Currently, gene editing technology is increasingly being applied to the creation of animal models. Summary of the Invention
[0006] The purpose of the present invention is to provide a kit and its application in constructing a pig nuclear transplant donor cell for a type II collagen disease model with a COL2A1 gene mutation.
[0007] The present invention provides use of COL2A1-gRNA3, COL2A1-gRNA4 and NCN protein in preparing a kit.
[0008] The present invention also provides the use of COL2A1-gRNA3, COL2A1-gRNA4 and PRONCN protein in preparing a kit.
[0009] The present invention also provides use of COL2A1-gRNA3, COL2A1-gRNA4 and a specific plasmid in preparing a kit.
[0010] The present invention provides a kit comprising COL2A1-gRNA3, COL2A1-gRNA4 and NCN protein.
[0011] The present invention also provides a kit comprising COL2A1-gRNA3, COL2A1-gRNA4 and PRONCN protein.
[0012] The present invention also provides a kit comprising COL2A1-gRNA3, COL2A1-gRNA4 and a specific plasmid.
[0013] Any of the above kits further comprises pig cells.
[0014] The use of any of the above kits is as follows (a) or (b) or (c): (a) preparing recombinant pig cells; (b) preparing pigs with type II collagen disease model; (c) preparing a type II collagen disease cell model or a type II collagen disease tissue model or a type II collagen disease organ model.
[0015] The present invention provides a method for preparing recombinant pig cells, comprising the following steps: co-transfecting COL2A1-gRNA3, COL2A1-gRNA4 and NCN protein into pig cells to obtain recombinant pig cells.
[0016] The co-transfection specifically adopts the method of electric shock transfection.
[0017] The parameters for electroporation can be set as follows: 1450V, 10ms, 3 pulses.
[0018] The co-transfection can be specifically performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.
[0019] The ratios of COL2A1-gRNA3, COL2A1-gRNA4 and NCN protein are: 0.8-1.2 μg COL2A1-gRNA3: 0.8-1.2 μg COL2A1-gRNA4: 3-5 μg NCN protein.
[0020] The ratios of COL2A1-gRNA3, COL2A1-gRNA4 and NCN protein are: 1 μg COL2A1-gRNA3: 1 μg COL2A1-gRNA4: 4 μg NCN protein.
[0021] The ratios of pig cells, COL2A1-gRNA3, COL2A1-gRNA4 and NCN protein are as follows: 100,000 pig cells: 0.8-1.2μg COL2A1-gRNA3: 0.8-1.2μg COL2A1-gRNA4: 3-5μg NCN protein.
[0022] The ratios of pig cells, COL2A1-gRNA3, COL2A1-gRNA4 and NCN protein are as follows: 100,000 pig cells: 1 μg COL2A1-gRNA3: 1 μg COL2A1-gRNA4: 4 μg NCN protein.
[0023] Any of the above COL2A1-gRNA3 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16.
[0024] Specifically, the COL2A1-gRNA3 is shown in SEQ ID NO: 16.
[0025] Specifically, the COL2A1-gRNA3 is shown in SEQ ID NO: 12.
[0026] Any of the above COL2A1-gRNA4 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17.
[0027] Specifically, the COL2A1-gRNA4 is shown in SEQ ID NO: 17.
[0028] Specifically, the COL2A1-gRNA4 is shown in SEQ ID NO: 13.
[0029] Any of the above-mentioned NCN proteins is a Cas9 protein or a fusion protein with a Cas9 protein.
[0030] Specifically, the NCN protein is shown in SEQ ID NO: 3.
[0031] Any of the above pig cells is a pig fibroblast.
[0032] Any of the above pig cells is a primary pig fibroblast.
[0033] Any of the above pig cells is a primary pig fibroblast obtained from a newborn pig.
[0034] The preparation method of the NCN protein comprises the following steps:
[0035] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria;
[0036] (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria;
[0037] (3) crushing the collected bacteria and collecting the crude protein solution;
[0038] (4) purifying the His6-tagged fusion protein from the crude protein solution using affinity chromatography;
[0039] (5) The His6-tagged fusion protein was cleaved with enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein;
[0040] Plasmid pKG-GE4 contains the fusion gene represented by nucleotides 5209 to 9852 in SEQ ID NO: 1.
[0041] The preparation method of the NCN protein specifically comprises the following steps:
[0042] (1) The plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria.
[0043] (2) inoculating the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culturing with shaking;
[0044] (3) The bacterial solution obtained in step (2) was inoculated into liquid LB medium and cultured at 30°C and 230 rpm until the OD 600nm value = 1.0, then IPTG was added to make its concentration in the system 0.5 mM, and then cultured with shaking at 25°C and 230 rpm for 12 hours, and then the bacteria were collected by centrifugation;
[0045] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;
[0046] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then crush the bacterial cells, collect the supernatant by centrifugation, filter with a 0.22 μm pore size filter membrane, and collect the filtrate;
[0047] (6) Purifying the His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) from the filtrate obtained in step (5) by affinity chromatography;
[0048] (7) The column solution collected in step (6) was concentrated using an ultrafiltration tube and then diluted with 25 mM Tris-HCl (pH 8.0);
[0049] (8) adding recombinant bovine enterokinase with a His6 tag to the solution obtained in step (7) and performing enzymatic digestion;
[0050] (9) Mixing the solution obtained in step (8) with Ni-NTA resin, incubating, and then centrifuging to collect the supernatant;
[0051] (10) The supernatant obtained in step (9) was concentrated using an ultrafiltration tube and then added to the enzyme storage solution to obtain the NCN protein solution.
[0052] The specific method for purifying the fusion protein with the His6 tag from the filtrate obtained in step (5) by affinity chromatography is as follows:
[0053] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate of 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate of 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).
[0054] Any of the above PRONCN proteins includes the following elements from upstream to downstream: a signal peptide, a molecular chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.
[0055] The function of the signal peptide is to promote protein secretion and expression. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, the Staphylococcus aureus protein A signal peptide, the Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretion and expression of the target protein into the bacterial periplasm, thereby separating it from the bacterial intracellular proteins. The target protein secreted into the bacterial periplasm is expressed as a soluble protein and can be cleaved by the signal peptidase in the bacterial periplasm.
[0056] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably thioredoxin (TrxA protein). Thioredoxin can act as a molecular chaperone to help the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improve protein stability, correct folding, and increase the solubility and activity of the target protein.
[0057] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, more preferably a His tag. The His tag can bind to a Ni column, allowing the target protein to be purified by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein.
[0058] The function of the protease cleavage site is to be used to remove the non-functional segment after purification to release the natural form of Cas9 protein. The protease can be selected from enterokinase, Factor Xa, Thrombin, TEV protease, HRV 3C protease, WELQut protease or any other endoprotease, and enterokinase is further preferred. EK is an enterokinase cleavage site, which is convenient for using enterokinase to remove the fused TrxA-His segment to obtain the natural form of Cas9 protein. After the commercial enterokinase with a His tag is used to cut the fusion protein, the TrxA-His segment and the enterokinase with a His tag can be removed by one affinity chromatography to obtain the natural form of Cas9 protein, thereby avoiding the damage and loss of the target protein caused by multiple purification and dialysis.
[0059] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. NLS is a nuclear localization signal, and an NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, to enable Cas9 to more effectively enter the cell nucleus for gene editing.
[0060] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.
[0061] The PRONCN protein is specifically shown in SEQ ID NO: 2.
[0062] Any of the above-mentioned specific plasmids includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a gene encoding PRONCN protein, and a terminator.
[0063] The promoter may specifically be a T7 promoter, which is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.
[0064] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, IPTG can be used to induce expression of the target protein at low temperatures. This can prevent the impact of premature expression of the target protein on host bacterial growth. Inducing expression at low temperatures also significantly improves the solubility of the expressed target protein.
[0065] The ribosome binding site is a ribosome binding site during protein translation and is necessary for protein translation.
[0066] The terminator may specifically be a T7 terminator, which can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.
[0067] For the codons of the spCas9 protein, this application has optimized its codons to make it fully adapt to the codon preference of the Escherichia coli high-efficiency expression strain E. coli BL21 (DE3) selected in this application, thereby improving the expression level of the Cas9 protein.
[0068] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.
[0069] The Lac operon is shown in nucleotides 5140 to 5164 of SEQ ID NO: 1.
[0070] The ribosome binding site is shown in nucleotides 5178 to 5201 of SEQ ID NO: 1.
[0071] The coding sequence of the alkaline phosphatase signal peptide is shown in nucleotides 5209 to 5271 in SEQ ID NO: 1.
[0072] The coding sequence of the TrxA protein is shown in nucleotides 5272-5598 in SEQ ID NO: 1.
[0073] The coding sequence of His-Tag is shown in nucleotides 5620-5637 in SEQ ID NO: 1.
[0074] The coding sequence of the enterokinase cleavage site is shown in nucleotides 5638 to 5652 in SEQ ID NO: 1.
[0075] The coding sequence of the nuclear localization signal is shown in nucleotides 5656-5670 of SEQ ID NO: 1.
[0076] The coding sequence of the spCas9 protein is shown in nucleotides 5701-9801 in SEQ ID NO: 1.
[0077] The coding sequence of the nuclear localization signal is shown in nucleotides 9802-9849 of SEQ ID NO: 1.
[0078] The T7 terminator is represented by nucleotides 9902 to 9949 in SEQ ID NO: 1.
[0079] Specifically, the specific plasmid is plasmid pKG-GE4.
[0080] Plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121 to 9949 in SEQ ID NO: 1.
[0081] Specifically, any one of the above plasmids pKG-GE4 is shown as SEQ ID NO: 1.
[0082] The present invention also protects the recombinant pig cells prepared by any of the above methods.
[0083] The recombinant pig cell is a recombinant pig cell in which the COL2A1 gene is mutated.
[0084] The recombinant pig cell can specifically be a single cell clone having a genotype of heterozygous, bi-allelic identical mutation type or bi-allelic different mutation type as shown in Table 1.
[0085] The present invention also protects the use of the recombinant pig cells in preparing type II collagen disease model pigs.
[0086] The recombinant pig cells are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, which are type II collagen disease model pigs.
[0087] The present invention also protects the pig tissue of the model pig prepared by using the recombinant pig cells, that is, the type II collagen disease tissue model.
[0088] The present invention also protects a pig organ of a model pig prepared by using the recombinant pig cell, namely a type II collagen disease organ model.
[0089] The present invention also protects pig cells of a model pig prepared by using the recombinant pig cells, namely a type II collagen disease cell model.
[0090] The present invention also protects the use of the recombinant porcine cells, the type II collagen disease tissue model, the type II collagen disease organ model, the type II collagen disease cell model, or the type II collagen disease model pig, which is as follows (d1) or (d2) or (d3) or (d4):
[0091] (d1) Screening for drugs to treat type II collagen diseases;
[0092] (d2) Evaluate the efficacy of drugs for type II collagen diseases;
[0093] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for type II collagen diseases;
[0094] (d4) Study the pathogenesis of type II collagen disease.
[0095] Any of the above-mentioned pigs can specifically be Congjiang Xiang pigs.
[0096] Any of the above-mentioned pigs can specifically be newborn Congjiang fragrant pigs.
[0097] Any of the above-mentioned pigs can specifically be Bama Xiang pigs.
[0098] Any of the above-mentioned pigs can specifically be newborn Bama Xiang pigs.
[0099] Any of the above-mentioned type II collagen diseases is caused by a mutation in the COL2A1 gene.
[0100] Porcine COL2A1 gene information: Encodes type II collagen α1 chain; located on chromosome 5; Gene ID is 397323, Sus scrofa.
[0101] The protein encoded by the porcine COL2A1 gene is shown in NCBI as XP_020948270.1 (13-MAY-2017).
[0102] The protein encoded by the porcine COL2A1 gene has a protein segment shown in SEQ ID NO:8.
[0103] The porcine COL2A1 gene has the DNA segment shown in SEQ ID NO:9.
[0104] Any of the above mutations is a deletion and / or insertion and / or substitution of one or more nucleotides.
[0105] Any of the above mutations is a deletion of one or more nucleotides.
[0106] Any of the above mutations is an insertion of one or more nucleotides.
[0107] Any of the above mutations is a deletion or insertion of one or more nucleotides.
[0108] Compared with the prior art, the present invention has at least the following beneficial effects:
[0109] (1) The research object of the present invention (pig) has better applicability than other animals (rat, mouse, and primate).
[0110] Rodents such as mice and rats differ significantly from humans in terms of body shape, organ size, physiology, and pathology, making them unable to truly simulate normal human physiological and pathological conditions. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but their small size, late sexual maturity (mating begins at 6-7 years old), and single-birth primates make population expansion extremely slow and their breeding costs very high. Furthermore, primate cloning is inefficient, difficult, and costly.
[0111] Pigs, however, do not have these drawbacks as model animals. They are the closest relative to humans besides primates, with body shape, weight, and organ size similar to humans. Their anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis are highly similar to humans. Furthermore, pigs reach sexual maturity early (4-6 months), have high fertility, and can produce many offspring per litter, allowing them to form a large population within 2-3 years. Furthermore, pig cloning technology is highly mature, and the costs of cloning and rearing pigs are much lower than those of primates. Therefore, pigs are highly suitable as models for human diseases.
[0112] (2) The vector constructed by the present invention uses a strong promoter T7-lac that can efficiently express the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic protein alkaline phosphatase (phoA) to guide the secretion and expression of the target protein into the bacterial periplasmic cavity, thereby separating it from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasmic cavity is soluble. At the same time, the thioredoxin TrxA and Cas9 protein are fused and expressed. TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein. At the same time, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment to obtain the natural form of the Cas9 protein. After the fusion protein is cleaved by His-tagged enterokinase, the TrxA-His polypeptide fragment and His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of the Cas9 protein, avoiding damage and loss to the target protein caused by multiple purification and dialysis. At the same time, the present invention also designs an NLS site at the N-terminus and C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the cell nucleus for gene editing. In addition, the present invention selects the E. coli BL21 (DE3) strain as the target protein expression strain. This strain can efficiently express exogenous genes cloned in an expression vector containing a bacteriophage T7 promoter (such as pET-32a). At the same time, the present invention performs codon optimization on the codons of the Cas9 protein to fully adapt to the codon preference of the expression strain, thereby improving the expression level of the target protein. In addition, after the bacteria grow to a certain number, the present invention uses IPTG to induce the expression of the target protein at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Inducing expression at low temperature also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization designs and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with the commercial Cas9 protein.
[0113] (3) The Cas9 high-efficiency protein constructed and expressed by the present invention was combined with in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA was optimized. The final gene-edited single-cell clone rate was as high as 97.1%, which is much higher than the conventional gene editing efficiency (10-30%).
[0114] (4) Using the target gene knockout single cell clone obtained by the present invention to carry out somatic cell nuclear transplantation animal cloning can directly obtain cloned pigs with target gene knockout, and the gene mutation can be stably inherited.
[0115] The method of embryo transplantation after microinjection of gene editing materials into fertilized eggs used in mouse model making is relatively low in probability of directly obtaining offspring with gene mutations, and requires hybridization and breeding of offspring, which is not suitable for large animal (such as pig) model making with a long gestation period. Therefore, the present invention adopts a method of in vitro editing of primary cells with high technical difficulty and high challenge, as well as Cas9 protein and double gRNA cutting and screening of positive edited single cell clones. Later, the corresponding disease model pigs are directly obtained by somatic cell nuclear transplantation animal cloning technology, which can greatly shorten the model pig production cycle and save manpower, material resources and financial resources.
[0116] This study uses CRISPR / Cas9 technology combined with dual gRNA editing to knock out the COL2A1 gene, mimicking the genetic characteristics of type II collagenosis. Single-cell clones of the COL2A1 gene knockout were generated, laying the foundation for the subsequent development of pig models of type II collagenosis through somatic cell nuclear transfer (SCNT) animal cloning. This study will help to study and reveal the pathogenesis of type II collagenosis caused by abnormal COL2A1 gene function. It can also be used for drug screening, efficacy evaluation, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and a powerful experimental tool for the successful treatment of type II collagenosis in humans. This study has significant application value for the development of drugs for type II collagenosis and for revealing the pathogenesis of the disease. BRIEF DESCRIPTION OF THE DRAWINGS
[0117] Figure 1 This is the alignment result of the forward sequencing of the single cell clone numbered 33 and the wild-type sequence.
[0118] Figure 2 This is the comparison result of reverse sequencing of single cell clone numbered 14 and the wild-type sequence.
[0119] Figure 3 This is the comparison result of reverse sequencing of single cell clone numbered 24 and the wild-type sequence.
[0120] Figure 4 This is the alignment result of the forward sequencing of the single cell clone numbered 2 and the wild-type sequence.
[0121] Figure 5 This is the electrophoresis diagram of PCR amplification performed using the genome extracted from the ear tissue of a pig named BX4 as a template using different primer pairs in Example 2.
[0122] Figure 6 The electrophoretic diagrams are obtained by performing PCR amplification using the primer pairs consisting of COL2A1-E27-JDF219 and COL2A1-E27-JDR660 using the genomic DNA of 10 pigs as templates in Example 2.
[0123] Figure 7 Schematic diagram of the structure of plasmid pET-32a.
[0124] Figure 8 Schematic diagram of the structure of plasmid pKG-GE4.
[0125] Figure 9 This is the electrophoresis diagram of the optimized ratio of gRNA to NCN protein in Example 4.
[0126] Figure 10 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 4. DETAILED DESCRIPTION
[0127] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0128] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercial Cas9-A protein is a commercially available Cas9 protein with good results. The commercial Cas9-B protein is a commercially available Cas9 protein with good results. Complete culture medium (% is volume ratio): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, constant temperature incubator with 5% CO2 and 5% O2.
[0129] The primary porcine fibroblasts used in Examples 1 and 2 were prepared from ear tissues of newborn Bama Xiang pigs. The primary porcine fibroblasts used in Example 4 were prepared from ear tissues of newborn Congjiang Xiang pigs. Method for preparing primary porcine fibroblasts from pig ear tissue: ① Remove 0.5 g of pig ear tissue, remove hair and bone tissue, and soak in 75% alcohol for 30-40 seconds. Wash five times with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco), followed by one wash with PBS buffer. ② Mince the tissue with scissors and digest with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 hour. Centrifuge at 500 g for 5 minutes and discard the supernatant. ③ Resuspend the pellet in 1 mL of complete culture medium and plate onto a 10 cm diameter cell culture dish sealed with 0.2% gelatin (VWR) containing 10 mL of complete culture medium. Culture until the cells reach approximately 60% of the bottom of the dish. ④ After completing step 3, trypsinize and harvest the cells, then resuspend them in complete culture medium for subsequent electroporation experiments.
[0130] Plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in patent application 202010084343.6. In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 395-680 constitute the CMV enhancer, nucleotides 682-890 constitute the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode the polypeptide P2A (the amino acid sequence of polypeptide P2A is "ATNFSLLKQAGDVEENPGP" and the break position is The sequence of the nucleotide sequence of the first amino acid residue starting from the C-terminus and the second amino acid residue starting from the C-terminus is shown in Figure 2. Nucleotides 5333-6046 encode the EGFP protein, nucleotides 6056-6109 encode the polypeptide T2A (the amino acid sequence of polypeptide T2A is "EGRGSLLTCGDVEENPGP", and the cleavage position is between the first amino acid residue starting from the C-terminus and the second amino acid residue starting from the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 constitute the WPRE sequence element, nucleotides 7382-7615 constitute the 3'LTR sequence element, and nucleotides 7647-7871 constitute the bGH poly(A) signal sequence element. In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 911-6706 form a fusion gene to express the fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.
[0131] The pKG-U6gRNA vector, or plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in patent application 202010084343.6. In SEQ ID NO: 3 in patent application 202010084343.6, nucleotides 2280-2539 constitute the hU6 promoter, and nucleotides 2558-2637 are used to transcribe the gRNA backbone. During use, a 20-bp DNA molecule (used to transcribe the target sequence binding region of the gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, which is then transcribed in cells to produce the gRNA.
[0132] Example 1: Preparation of COL2A1 gene knockout Bama Xiang pig single cell clone
[0133] Two highly efficient gRNA targets (COL2A1-E27-gRNA3 target and COL2A1-E27-gRNA4 target) were screened and obtained in Example 2.
[0134] The NCN protein was provided by the NCN protein solution prepared in Example 3.
[0135] 1. Preparation of gRNA
[0136] 1. Preparation of COL2A1-T7-gRNA3 and COL2A1-T7-gRNA4 transcription templates
[0137] The COL2A1-T7-gRNA3 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.
[0138] The COL2A1-T7-gRNA4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.
[0139] 2. Obtain gRNA by in vitro transcription
[0140] The COL2A1-T7-gRNA3 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441). TM The COL2A1-gRNA3 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). COL2A1-gRNA3 is a single-stranded RNA, as shown in SEQ ID NO: 16.
[0141] The COL2A1-T7-gRNA4 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441). TM The COL2A1-gRNA4 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). COL2A1-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: 17.
[0142] COL2A1-gRNA3 (SEQ ID NO: 16):
[0143] GGCCAGGGAAACCCAUGACACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCCGGUGCUUUUCOL2A1-gRNA4 (SEQ ID NO: 17):
[0144] GGCCAGGGCGACCAUCUUCACCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU
[0145] 2. Transfection of Primary Porcine Fibroblasts
[0146] 1. Co-transfect porcine primary fibroblasts with COL2A1-gRNA3, COL2A1-gRNA4, and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg COL2A1-gRNA3, 1 μg COL2A1-gRNA4, 4 μg NCN protein. Co-transfection was performed by electroporation using the Mammalian Nucleofection Kit (Neon kit, ThermoFisher) and the Neon™ transfection system (parameters: 1450V, 10ms, 3 pulses).
[0147] 2. After completing step 1, culture the cells in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.
[0148] 3. After completing step 2, use trypsin to digest and collect the cells, then wash with complete culture medium, resuspend in complete culture medium, and then pick each monoclonal clone and transfer it to a 96-well plate (1 cell per well, each well contains 100 μl complete culture medium) and culture for 2 weeks (replace new complete culture medium every 2-3 days).
[0149] 4. After completing step 3, trypsinize and collect the cells (about 2 / 3 of the cells obtained in each well are inoculated into a 6-well plate filled with complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).
[0150] 5. Take the 6-well plate from step 4 and culture until the cells grow to 80% confluence, digest and collect the cells with trypsin, and freeze the cells using cell freezing solution (90% complete culture medium + 10% DMSO, volume ratio).
[0151] 6. Take the centrifuge tube from step 4, remove the cells, lyse the cells, and extract genomic DNA. Perform PCR amplification using the primer pair consisting of COL2A1-E27-JDF219 and COL2A1-E27-JDR660, followed by electrophoresis. Use primary porcine fibroblasts as a wild-type control (WT).
[0152] 7. After completing step 6, recover the PCR amplification product and sequence it.
[0153] There is only one sequencing result for primary porcine fibroblasts, and its genotype is wild type (also known as homozygous wild type). If a single-cell clone has two sequencing results, one of which is consistent with the sequencing result of primary porcine fibroblasts and the other has a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is heterozygous; if a single-cell clone has two sequencing results, both of which have a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is biallelic different mutation type; if a single-cell clone has one sequencing result and has a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is biallelic identical mutation type; if a single-cell clone has one sequencing result and is consistent with the sequencing result of primary porcine fibroblasts, the genotype of the single-cell clone is wild type (also known as homozygous wild type).
[0154] The results are shown in Table 1. The genotype of single-cell clone numbered 33 was wild-type. The genotypes of single-cell clones numbered 4, 10, 14, 20, 21, and 22 were heterozygous. The genotypes of single-cell clones numbered 1, 3, 5, 6, 7, 9, 11, 12, 13, 15, 16, 18, 19, 24, 25, 26, 28, 29, 30, 31, 32, 34, and 35 were biallelic mutations. The genotypes of single-cell clones numbered 2, 8, 17, 23, and 27 were biallelic mutations. The rate of obtaining COL2A1 gene-edited single-cell clones was 97.1%.
[0155] Exemplary sequencing results are shown in Figures 1 to 4 . Figure 1 This is the result of forward sequencing of the single-cell clone numbered 33 and its alignment with the wild-type sequence, which was determined to be wild-type. Figure 2 This is the result of reverse sequencing of the single-cell clone numbered 14 and its comparison with the wild-type sequence, which was determined to be heterozygous. Figure 3 This is the result of reverse sequencing of the single-cell clone numbered 24 and the comparison with the wild-type sequence, which is a double-allelic mutation type. Figure 4 This is the result of the forward sequencing of the single-cell clone No. 2 and the alignment with the wild-type sequence, which is a biallelic identical mutation type.
[0156] Table 1 Genotyping results of COL2A1 gene-edited single-cell clones
[0157]
[0158]
[0159] The above-mentioned single-cell clones of heterozygous, biallelic identical mutations, and biallelic different mutations are all target single-cell clones. Using these cells as nuclear transplant donor cells for somatic cell cloning can produce cloned pigs, namely, type II collagen disease model pigs.
[0160] Example 2: Screening of efficient gRNA targets for the COL2A1 gene
[0161] Porcine COL2A1 gene information: Encodes type II collagen α1 chain; located on chromosome 5; Gene ID 397323, Sus scrofa. The protein encoded by the porcine COL2A1 gene is listed in NCBI as XP_020948270.1 (May 13, 2017). A partial fragment of the protein encoded by the porcine COL2A1 gene is shown in SEQ ID NO: 8. In porcine genomic DNA, the COL2A1 gene has 54 exons. The 27th coding exon and its upstream and downstream 300 bp are shown in SEQ ID NO: 9.
[0162] 1. Conservation analysis of the COL2A1 gene presumed deletion region and adjacent genomic sequences
[0163] There were 10 newborn Bama Xiang pigs, including 6 females (named BC1, BC2, BC3, BC4, BC5, and BC6) and 4 males (named BX1, BX2, BX3, and BX4).
[0164] COL2A1-E27-JDF220:CTGTGCCCTTCCACAGTAGG;
[0165] COL2A1-E27-JDR660: GGCTAAAGCCGAGTATCCCC;
[0166] COL2A1-E27-JDF219: CCTGTGCCCTTCCACAGTAG;
[0167] COL2A1-E27-JDR633: CTGCCCCATGGAAGACTGTT.
[0168] Genomic DNA extracted from the ear tissue of a pig named BX4 was used as a template for PCR amplification using different primer pairs, followed by 1% agarose gel electrophoresis. Figure 5 . Figure 5 Middle: Group 1: Uses the primer pair consisting of COL2A1-E27-JDF219 and COL2A1-E27-JDR633; Group 2: Uses the primer pair consisting of COL2A1-E27-JDF219 and COL2A1-E27-JDR660; Group 3: Uses the primer pair consisting of COL2A1-E27-JDF220 and COL2A1-E27-JDR633; Group 4: Uses the primer pair consisting of COL2A1-E27-JDF220 and COL2A1-E27-JDR660. The results show that the primer pair consisting of COL2A1-E27-JDF219 and COL2A1-E27-JDR660 is preferred for amplifying the target fragment.
[0169] The genomic DNA of 10 pigs was used as template, and the primer pair consisting of COL2A1-E27-JDF219 and COL2A1-E27-JDR660 was used for PCR amplification, followed by 1% agarose gel electrophoresis. Figure 6 The PCR amplification products were recovered and sequenced, and the sequencing results were compared with the COL2A1 gene sequence in the public database. The conserved regions shared by the 10 pigs were selected for gRNA target design.
[0170] 2. Target Screening
[0171] By screening NGG (avoiding possible mutation sites), several targets were initially screened, and 4 targets were further screened after preliminary experiments.
[0172] The four targets are as follows:
[0173] COL2A1-E27-gRNA1 target: TGGACCTCCAGGTCCCCAAG;
[0174] COL2A1-E27-gRNA2 target: CGAGCCCCTTGGGGACCTGG;
[0175] COL2A1-E27-gRNA3 target: CCAGGGAAACCCATGACACC;
[0176] COL2A1-E27-gRNA4 target: CCAGGGCGACCATCTTCACC.
[0177] 3. Preparation of gRNA
[0178] The plasmid pKG-U6gRNA was taken and digested with the restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).
[0179] COL2A1-E27-gRNA1-S and COL2A1-E27-gRNA1-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (COL2A1-E27-gRNA1). Plasmid pKG-U6gRNA (COL2A1-E27-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10. COL2A1-E27-gRNA1 .
[0180] sgRNA COL2A1-E27-gRNA1 (SEQ ID NO: 10):
[0181] UGGACCUCCAGGUCCCCAAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0182] COL2A1-E27-gRNA2-S and COL2A1-E27-gRNA2-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (COL2A1-E27-gRNA2). Plasmid pKG-U6gRNA (COL2A1-E27-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11. COL2A1-E27-gRNA2 .
[0183] sgRNA COL2A1-E27-gRNA2 (SEQ ID NO: 11):
[0184] CGAGCCCCUUGGGGACCUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0185] COL2A1-E27-gRNA3-S and COL2A1-E27-gRNA3-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain the plasmid pKG-U6gRNA (COL2A1-E27-gRNA3). Plasmid pKG-U6gRNA (COL2A1-E27-gRNA3) expresses the sgRNA shown in SEQ ID NO: 12 COL2A1-E27-gRNA3 .
[0186] sgRNA COL2A1-E27-gRNA3 (SEQ ID NO: 12):
[0187] CCAGGGAAACCCAUGACACCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0188] COL2A1-E27-gRNA4-S and COL2A1-E27-gRNA4-A were synthesized separately, mixed, and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain the plasmid pKG-U6gRNA (COL2A1-E27-gRNA4). Plasmid pKG-U6gRNA (COL2A1-E27-gRNA4) expresses the sgRNA shown in SEQ ID NO: 13 COL2A1-E27-gRNA4 .
[0189] sgRNA COL2A1-E27-gRNA4 (SEQ ID NO: 13):
[0190] CCAGGGCGACCAUCUUCACCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu
[0191] COL2A1-E27-gRNA1-S:caccgTGGACCTCCAGGTCCCCAAG;
[0192] COL2A1-E27-gRNA1-A:aaacCTTGGGGACCTGGAGGTCCAc;
[0193] COL2A1-E27-gRNA2-S: caccgCGAGCCCCTTGGGGACCTGG;
[0194] COL2A1-E27-gRNA2-A:aaacCCAGGTCCCCAAGGGGCTCGc;
[0195] COL2A1-E27-gRNA3-S:caccgCCAGGGAAACCCCATGACACC;
[0196] COL2A1-E27-gRNA3-A:aaacGGTGTCATGGGTTTCCCTGGc;
[0197] COL2A1-E27-gRNA4-S: caccgCCAGGGCGACCATCTTCACC;
[0198] COL2A1-E27-gRNA4-A:aaacGGTGAAGATGGTCGCCCTGGc.
[0199] COL2A1-E27-gRNA1-S, COL2A1-E27-gRNA1-A, COL2A1-E27-gRNA2-S, COL2A1-E27-gRNA2-A, COL2A1-E27-gRNA3-S, COL2A1-E27-gRNA3-A, COL2A1-E27-gRNA4-S, and COL2A1-E27-gRNA4-A are all single-stranded DNA molecules.
[0200] 4. Comparison of Editing Efficiency of Different Target Combinations
[0201] 1. Co-transfection
[0202] Group 1: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (COL2A1-E27-gRNA1) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (COL2A1-E27-gRNA1): 1.08 μg plasmid pKG-GE3.
[0203] Group 2: Co-transfect primary porcine fibroblasts with the plasmid pKG-U6gRNA (COL2A1-E27-gRNA2) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (COL2A1-E27-gRNA2): 1.08 μg plasmid pKG-GE3.
[0204] Group 3: Co-transfected porcine primary fibroblasts with plasmid pKG-U6gRNA (COL2A1-E27-gRNA3) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (COL2A1-E27-gRNA3): 1.08 μg plasmid pKG-GE3.
[0205] Group 4: Co-transfect porcine primary fibroblasts with the plasmid pKG-U6gRNA (COL2A1-E27-gRNA4) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (COL2A1-E27-gRNA4): 1.08 μg plasmid pKG-GE3.
[0206] Group 5: Primary porcine fibroblasts, electroporated with the same electroporation parameters but without adding plasmids.
[0207] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).
[0208] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.
[0209] 3. After completing step 2, digest and harvest the cells with trypsin, lyse the cells, and extract genomic DNA. PCR amplify the DNA using the primer pair consisting of COL2A1-E27-JDF219 and COL2A1-E27-JDR660, followed by 1% agarose gel electrophoresis to detect target gene mutations.
[0210] After gel excision and recovery, the target product was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of different targets. The gene editing efficiencies of the first, second, third, and fourth groups were 5%, 63%, 81%, and 68%, respectively. No gene editing occurred in the fifth group. The results showed that the COL2A1-E27-gRNA3 and COL2A1-E27-gRNA4 targets had high editing efficiencies.
[0211] Example 3. Preparation and purification of NCN protein
[0212] 1. Construction of prokaryotic Cas9 efficient expression vector
[0213] The schematic diagram of the structure of plasmid pET-32a is shown in Figure 7 .
[0214] Plasmid pKG-GE4 was modified from plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid. The schematic diagram of the structure is shown in Figure 8 .
[0215] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a Lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode an alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag (also known as a His6 tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotide sequence encoding the spCas9 protein has been codon-optimized for the Escherichia coli BL21(DE3) strain.
[0216] The main modifications of plasmid pKG-GE4 are as follows: ① The coding region of TrxA protein is retained. TrxA protein can help the expressed target protein form disulfide bonds and increase the solubility and activity of the target protein; the coding sequence of alkaline phosphatase signal peptide is added before the coding region of TrxA protein. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the bacterial membrane and can be cleaved by prokaryotic periplasmic signal peptidase; ② The coding sequence of His-Tag is added after the coding sequence of TrxA protein. His-Tag can be used for ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove the His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the codon-optimized Cas9 gene suitable for expression in Escherichia coli BL21 (DE3) strain, and add the nuclear localization signal coding sequence upstream and downstream of the gene to increase the nuclear localization ability of the Cas9 protein purified later.
[0217] The fusion gene in plasmid pKG-GE4 is shown at nucleotides 5209-9852 in SEQ ID NO: 1, encoding the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein). Due to the presence of the alkaline phosphatase signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3, which is named NCN protein.
[0218] 2. Inducible Expression
[0219] 1. Introduce plasmid pKG-GE4 into Escherichia coli BL21 (DE3) to obtain recombinant bacteria.
[0220] 2. The recombinant bacteria obtained in step 1 were inoculated into liquid LB medium containing 100 μg / ml ampicillin and cultured overnight at 37°C and 200 rpm with shaking.
[0221] 3. Inoculate the bacterial solution obtained in step 2 into liquid LB medium and culture at 30°C and 230 rpm until the OD 600nm The value was set to 1.0, and then isopropylthiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The cells were shaken and cultured at 25°C and 230 rpm for 12 hours, and then centrifuged at 4°C and 10,000 g for 15 minutes to collect the cells.
[0222] 4. Take the bacteria obtained in step 3 and wash them with PBS buffer.
[0223] 3. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS
[0224] 1. Take the cells obtained in step 2, add crude extraction buffer and suspend the cells, then use a homogenizer to break the cells (1000 par three times), then centrifuge at 4°C, 15000g for 30 minutes, collect the supernatant, filter the supernatant through a 0.22μm pore size filter, and collect the filtrate. In this step, 10ml of crude extraction buffer is added for every gram of wet weight of cells.
[0225] Crude extraction buffer: contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance is ddH2O.
[0226] 2. Purify the fusion protein using affinity chromatography.
[0227] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate of 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate of 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).
[0228] Ni-NTA agarose column: GenScript, L00250 / L00250-C, filler volume 10 ml.
[0229] Equilibration solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.
[0230] Buffer: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, and the balance is ddH2O.
[0231] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.
[0232] 4. Enzymatic cleavage of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein
[0233] 1. Take 15 ml of the post-column solution collected in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity). Then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.
[0234] 2. Add commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotechnology, C620031, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in step 1 (approximately 6 ml). Digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.
[0235] 3. Take the solution from step 2 (about 6 ml) and mix it with 480 μl Ni-NTA resin (GenScript, L00250 / L00250-C). Rotate and mix at room temperature for 15 min, then centrifuge at 7000 g for 3 min and collect the supernatant (4-5.5 ml).
[0236] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.
[0237] Sequencing revealed that the N-terminal 15 amino acid residues of the protein in the NCN protein solution were as shown in positions 1 to 15 of SEQ ID NO: 3, namely, the NCN protein.
[0238] Enzyme storage solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (volume ratio) glycerol, and the balance is ddH2O.
[0239] Example 4: Performance of NCN Protein
[0240] The NCN protein was provided by the NCN protein solution prepared in Example 3.
[0241] Two gRNA targets targeting the TTN gene were selected as follows:
[0242] TTN-gRNA1 target: AGAGCACAGTCAGCCTGGCG;
[0243] TTN-gRNA2 target: CTTCCAGAATTGGATCTCCG.
[0244] The primers used to identify the target fragment containing the gRNA in the TTN gene are as follows:
[0245] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;
[0246] TTN-R560: CAAAGTTAACTCTCTGTGTCT.
[0247] 1. Preparation of gRNA
[0248] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates
[0249] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.
[0250] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.
[0251] 2. Obtain gRNA by in vitro transcription
[0252] TTN-T7-gRNA1 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM TTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908) to obtain a single-stranded RNA, as shown in SEQ ID NO: 6.
[0253] TTN-T7-gRNA2 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM TTN-gRNA2 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908) to obtain a single-stranded RNA, as shown in SEQ ID NO: 7.
[0254] 2. Optimization of the ratio of gRNA to NCN protein
[0255] 1. Co-transfection of primary porcine fibroblasts
[0256] Group 1: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2, and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.
[0257] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into primary porcine fibroblasts. Ratio: approximately 100,000 primary porcine fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.
[0258] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.
[0259] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.
[0260] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into primary porcine fibroblasts. Ratio: approximately 100,000 primary porcine fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0261] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).
[0262] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.
[0263] 3. After completing step 2, trypsin was used to digest and collect the cells, and genomic DNA was extracted. PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis was performed.
[0264] Electrophoresis diagram Figure 9 The 505bp band is the wild-type band (WT), and the 254bp band (the wild-type band is 505bp and theoretically lacks 251bp) is the deletion mutation band (MT).
[0265] Gene deletion mutation efficiency = (MT grayscale / MT band bp number) / (WT grayscale / WT band bp number + MT grayscale / MT band bp number) × 100%. The gene deletion mutation efficiency was 19.9% in the first group, 39.9% in the second group, 79.9% in the third group, and 44.3% in the fourth group. No mutation occurred in the fifth group.
[0266] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1μg:1μg:4μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1μg:1μg:4μg.
[0267] 3. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein
[0268] 1. Co-transfection of primary porcine fibroblasts
[0269] Cas9-A Group: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2, and commercially available Cas9-A protein. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-A protein.
[0270] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.
[0271] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.
[0272] Control group: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0273] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).
[0274] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.
[0275] 3. After completing step 2, trypsin was used to digest and collect the cells, and genomic DNA was extracted. PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis was performed.
[0276] Electrophoresis diagram Figure 10 The gene deletion mutation efficiency using the commercial Cas9-A protein was 28.5%, the gene deletion mutation efficiency using the NCN protein was 85.6%, and the gene deletion mutation efficiency using the commercial Cas9-B protein was 16.6%.
[0277] The results showed that compared with commercial Cas9 protein, the NCN protein prepared by the present invention significantly improved the gene editing efficiency.
[0278] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.
Claims
1. Application of COL2A1-gRNA3, COL2A1-gRNA4, and NCN protein in the preparation of kits; The COL2A1-gRNA3 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16; the COL2A1-gRNA4 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17; The NCN protein is shown in SEQ ID NO: 3; The preparation method of the NCN protein comprises the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria; (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria; (3) crushing the collected bacteria and collecting the crude protein solution; (4) purifying the His6-tagged fusion protein from the crude protein solution using affinity chromatography; (5) The His6-tagged fusion protein was cleaved with enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein; The plasmid pKG-GE4 is shown in SEQ ID NO: 1; The purpose of the kit is as follows (a) or (b) or (c): (a) preparing recombinant pig cells; (b) preparing a pig model of type II collagen disease; (c) preparing a cell model of type II collagen disease, a tissue model of type II collagen disease, or an organ model of type II collagen disease.
2. A kit comprising COL2A1-gRNA3, COL2A1-gRNA4, and NCN protein; COL2A1-gRNA3 is the COL2A1-gRNA3 described in claim 1; COL2A1-gRNA4 is the COL2A1-gRNA4 described in claim 1; NCN protein is the NCN protein described in claim 1; The purpose of the kit is as follows (a) or (b) or (c): (a) preparing recombinant pig cells; (b) preparing a pig model of type II collagen disease; (c) preparing a cell model of type II collagen disease, a tissue model of type II collagen disease, or an organ model of type II collagen disease.
3. A method for preparing recombinant pig cells, comprising the following steps: co-transfecting COL2A1-gRNA3, COL2A1-gRNA4, and NCN protein into pig cells to obtain recombinant pig cells; COL2A1-gRNA3 is the COL2A1-gRNA3 described in claim 1; COL2A1-gRNA4 is the COL2A1-gRNA4 described in claim 1; and NCN protein is the NCN protein described in claim 1.
Citation Information
Patent Citations
CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects
CN112522255A
Application of gRNA target combinations in construction of hemophilia model pig cell line
CN112442515A