RPA Primers, Kits and Detection Methods for Detecting Cryptocaryon irritans

By designing RPA primers for stimulating cryptocortiva and developing detection kits and detection methods based on RPA technology, the problem of relying on experience and equipment in traditional diagnostic methods is solved, and rapid, specific and sensitive detection of stimulating cryptocortiva is achieved.

CN116121429BActive Publication Date: 2025-05-30HAINAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211455164.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-21
Publication Date
2025-05-30
Estimated Expiration
2042-11-21

AI Technical Summary

Technical Problem

The prior art relies on experience and inaccurate results when diagnosing stimulating cryptocortosis. Traditional PCR and LAMP detection methods require expensive equipment and are difficult to detect in real time on site.

Method used

RPA primers were designed to detect and stimulate cryptocortiva, combined with RPA technology to develop detection kits and detection methods, and amplified products were detected using agarose gel electrophoresis.

Benefits of technology

It realizes rapid, specific, sensitive and does not rely on expensive equipment to stimulate cryptocorticoid detection, and can complete the detection within 30 minutes under a constant temperature of 37℃. It is suitable for rapid detection of stimulating cryptocorticoids in water.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116121429B_ABST
    Figure CN116121429B_ABST
Patent Text Reader

Abstract

The present invention relates to RPA primers, kits and detection methods for detecting Cryptocaryon irritans, belonging to the technical field of Cryptocaryon irritans detection. The technical problem to be solved by the present invention is to provide RPA primers, kits and detection methods for detecting Cryptocaryon irritans. The RPA primers for rapidly detecting Cryptocaryon irritans of the present invention have specific nucleotide sequences. Using the total DNA of the sample as a template, RPA amplification is carried out with the primer pair, and then detected by agar gel electrophoresis. If an electrophoretic band of 232 bp can be detected, it is judged as positive for Cryptocaryon irritans, otherwise it is negative. For the method of the present invention, the total DNA of 4 Cryptocaryon irritans larvae can be detected at the lowest. The method for detecting Cryptocaryon irritans of the present invention is simple to operate, requires a short time (the detection is completed in 90 minutes), has accurate detection results, good specificity, strong stability and high sensitivity, and is suitable for the rapid detection of Cryptocaryon irritans and the early diagnosis of cryptocaryonosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an RPA primer, a kit and a detection method for detecting Cryptocaryon irritans, and belongs to the technical field of Cryptocaryon irritans detection. Background Art

[0002] Cryptocaryon irritans is a ciliate protozoan that parasitizes marine bony fish, causing a parasitic disease called Cryptocaryon irritans, which can cause host death. It is commonly known as "white spot disease" because it often causes small, visible white spots on the skin, gills, and fins of infected fish. Cryptocaryon irritans has no apparent selectivity for host fish species or size, infecting nearly all marine bony fish. The parasitic process causes mechanical damage and organ dysfunction in the fish, which can easily trigger secondary bacterial infections. Parasitism in the gills can cause respiratory distress, frantic swimming, and, in severe cases, death from suffocation. From 2007 to 2010, Cryptocaryon irritans outbreaks occurred continuously in Shacheng Port and Sandu Bay in Ningde, Fujian Province, and Luoyuan Bay in Fuzhou, with incidence rates ranging from 30% to 100% and economic losses exceeding 300 million yuan. The most severe outbreak occurred in Luoyuan Bay, where all aquacultured species in nearly 43,000 cages were infected, resulting in an 80% mortality rate and economic losses exceeding 200 million yuan. From 2014 to 2015, Cryptocaryon irritans trophozoites were detected almost year-round in farmed grouper in Hainan. In 2014, an outbreak of Cryptocaryon irritans occurred in Haiou Village, Qionghai, resulting in the death of an entire pond of spotted grouper. A similar outbreak occurred in Wanning's northern harbor in 2015. In October 2017, all of the ovate pomfret farmed in cages in Houshui Bay, Hainan, became infected with Cryptocaryon irritans, resulting in a mortality rate exceeding 90% and direct economic losses of 150 million yuan. Cryptocaryon irritans has caused significant economic losses to the marine aquaculture industry.

[0003] Currently, diagnostic methods for Cryptocaryon irritans disease primarily include traditional clinical diagnosis and microscopic examination. Techniques for detecting the pathogen Cryptocaryon irritans include traditional PCR and loop-mediated isothermal amplification (LAMP). Traditional clinical diagnosis relies on observation of fish activity and external examination, while microscopic examination involves sampling the lesions or gills of diseased fish and examining them under a microscope for the presence of Cryptocaryon irritans trophozoites. While simple, these traditional diagnostic methods are overly reliant on experience, suffer from inaccurate results, and struggle to detect the disease early, making them limited to preliminary diagnosis. Conventional PCR, while accurate, requires expensive equipment and is limited to laboratory testing, not real-time on-site testing. LAMP technology can complete detection within one hour at a constant temperature of 65°C, requiring relatively low instrumentation requirements. However, its reaction system requires six primers and is prone to false positives. Recombinase polymerase amplification (RPA) is a novel isothermal amplification technology developed by a British company in 2006. It utilizes recombinase, single-strand binding protein (SSB), and DNA polymerase as the three core enzymes for target DNA fragment amplification. Amplification is achieved at a constant temperature of 37–39°C, requiring no expensive equipment and requiring simple, quick operation. Combined with other detection technologies such as test strips, RPA enables rapid and accurate on-site detection. Furthermore, this highly sensitive method allows for accurate diagnosis of the disease before typical symptoms develop, enabling prevention and control measures before widespread outbreaks, effectively controlling the impact of Cryptocaryon irritans. It can also be used for early monitoring and detection of Cryptocaryon irritans in aquaculture water, effectively controlling the risk of early infection with the disease, and holds broad application prospects. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the shortcomings of traditional diagnosis and microscopy techniques, such as strong dependence on experience, inaccurate results, and difficulty in initial diagnosis, as well as the shortcomings of traditional PCR and LAMP detection methods for the pathogen Cryptocaryon irritans, such as dependence on expensive instruments and equipment, long detection cycle, and difficulty in on-site real-time detection. An RPA primer, detection kit and detection method for detecting Cryptocaryon irritans are provided.

[0005] The first technical problem to be solved by the present invention is to provide an RPA primer for detecting Cryptocaryon irritans.

[0006] The nucleotide sequence of the RPA primer for detecting Cryptocaryon irritans of the present invention is as follows:

[0007] The nucleotide sequence of the forward primer FP is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer RP is shown in SEQ ID No. 2.

[0008] The second technical problem solved by the present invention is to provide the use of the RPA primers for detecting Cryptocaryon irritans in preparing a detection kit for Cryptocaryon irritans.

[0009] The RPA primers for detecting Cryptocaryon irritans of the present invention can be used to prepare a detection kit for Cryptocaryon irritans, and can detect Cryptocaryon irritans quickly, specifically, sensitively, simply and practically.

[0010] The third technical problem solved by the present invention is to provide a detection kit for Cryptocaryon irritans.

[0011] The present invention provides a detection kit for Cryptocaryon irritans, comprising the above-mentioned RPA primers for detecting Cryptocaryon irritans.

[0012] In a specific embodiment of the present invention, the detection kit further comprises reagents for RPA reaction.

[0013] In a specific embodiment of the present invention, the reagents for the RPA reaction include: a reaction tube containing RPA freeze-dried particles, a reaction buffer, ddH2O and magnesium acetate.

[0014] In a specific embodiment of the present invention, the reaction tube containing the RPA freeze-dried particles includes: phage recombinase UvsX, auxiliary factor UvsY, DNA polymerase, single-stranded binding protein and dNTPS.

[0015] The present invention also provides a method for detecting Cryptocaryon irritans in water based on RPA technology.

[0016] The present invention provides a method for detecting Cryptocaryon irritans in water based on RPA technology. The total DNA extracted from the sample to be tested is used as a template, an RPA reaction is performed using the above-mentioned RPA primers for detecting Cryptocaryon irritans, and the amplified product is detected by agarose gel electrophoresis. If a 232bp electrophoresis band can be detected, it is judged to be Cryptocaryon irritans positive, otherwise it is negative.

[0017] In a specific embodiment of the present invention, the RPA reaction is amplified at a constant temperature of 37° C. for at least 30 minutes.

[0018] In a specific embodiment of the present invention, the amplified product is detected by 1% agarose gel electrophoresis.

[0019] In one embodiment of the present invention, the amplification system of the RPA reaction includes: a reaction tube containing RPA freeze-dried particles, 29.4 μL of dry powder dissolution buffer, 12.1 μL of dd H2O, 2 μL of forward primer, 2 μL of reverse primer, 2 μL of 78.25 ng / μL DNA template and 2.5 μL of 280 mM magnesium acetate solution.

[0020] Compared with the prior art, the RPA detection method for Cryptocaryon irritans of the present invention has the following beneficial effects:

[0021] This paper establishes an RPA detection method for Cryptocaryon irritans, which can be used for qualitative detection of Cryptocaryon irritans. Compared with other technologies, this method does not rely on expensive equipment. Amplification of the target gene can be achieved in a 37°C constant temperature device, or even by holding the sample in the hand to maintain a stable temperature. The method is simple to operate, requires a short detection time (90 minutes), and provides accurate results with good specificity, strong stability, and high sensitivity. It is suitable for the rapid detection of Cryptocaryon irritans in water bodies and has promising application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This figure shows the electrophoresis results of screening 13 reverse primers using the RPA forward primer FP-3 in Example 1. Lane M represents the Maker DL2000; lanes 1 to 13 represent the 13 reverse primers, namely RP-1, RP-2, RP-3, RP-4, RP-5, RP-8, RP-9, RP-14, RP-15, RP-16, RP-17, RP-19, and RP-20; lane 14 represents the positive control for the RPA detection kit.

[0023] Figure 2 This is a schematic diagram of the electrophoresis results of screening 11 forward primers using the RPA reverse primer RP-14 in Example 1. Lane M represents the Maker DL2000; lanes 1 to 11 represent the 11 forward primers, namely FP-1, FP-2, FP-3, FP-4, FP-5, FP-6, FP-7, FP-13, FP-15, FP-18, and FP-19; lane 12 represents the positive control for the RPA detection kit.

[0024] Figure 3 Schematic diagram of the electrophoresis results of RPA detection of Cryptocaryon irritans in Example 1. Lane M is MakerDL2000; Lanes 1 to 5 are five parallel tests of Cryptocaryon irritans sample DNA spiked at a concentration of 78.25 ng / μL; 6. ddH2O negative control.

[0025] Figure 4The figure is a schematic diagram of the electrophoresis results of the RPA method specificity experiment in Example 2. Lane M is MakerDL2000; Lane 1 is a DNA sample of Cryptocaryon irritans with an extraction concentration of 78.25 ng / μL; Lanes 2-9 are, respectively, 85.95 ng / μL total DNA sample of Vibrio alginolyticus, 60.80 ng / μL total DNA sample of Vibrio harveyi, 105.55 ng / μL total DNA sample of Photobacterium mermanii, 225.05 ng / μL total DNA sample of Edwardsiella tarda, 129.20 ng / μL total DNA sample of Streptococcus agalactiae, 104.65 ng / μL total DNA sample of Streptococcus iniae, 117.05 ng / μL total DNA sample of Benedenia, and 86.23 ng / μL total DNA sample of Dinoflagellate.

[0026] Figure 5 Schematic diagram of the electrophoresis results of the RPA sensitivity experiment in Example 3. Lane M is Marker DL2000; Lane 1 is a ddH2O negative control; Lanes 2 to 7 are total DNA extracted from 1, 2, 4, 8, 16, and 32 Cryptocaryon irritans larvae, respectively.

[0027] Figure 6 Schematic diagram of the electrophoresis results of the RPA reproducibility experiment in Example 4. Lane M is Marker DL2000; lanes 1 to 6 are total DNA extracted from 16 Cryptocaryon irritans larvae, and lane 7 is a ddH2O negative control.

[0028] Figure 7 Detection of Cryptocaryon irritans in a mixed sample of muscle and gill tissue of ovate pomfret using the RPA method described in Example 5. Lane M is Marker DL2000; lanes 1-20 are DNA extracted from a mixed sample of muscle and gill tissue of 20 samples; and lane 21 is a ddH2O negative control.

[0029] Figure 8 This is the PCR detection method used in Example 5 to detect Cryptocaryon irritans in a mixed sample of muscle and gill tissue of elliptic pomfret. Lane M is Marker DL2000; lanes 1 to 20 are DNA extracted from a mixed sample of muscle and gill tissue of 20 samples; and lane 21 is a ddH2O negative control.

[0030] Figure 9 The RPA detection method used in Example 6 was used to detect Cryptocaryon irritans in aquaculture water, wherein lane M is MarkerDL2000, lane 1 is a ddH2O negative control, and lanes 2 to 7 are total DNA from aquaculture water samples. DETAILED DESCRIPTION

[0031] The nucleotide sequence of the RPA primer for detecting Cryptocaryon irritans of the present invention is as follows:

[0032] The nucleotide sequence of the forward primer FP is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer RP is shown in SEQ ID No. 2.

[0033] That is, forward primer FP: 5′-CTTCACTTAGAGGAAGGAGAAGTCGTAACAAGG-3′;

[0034] Reverse primer RP: 5′-CGTTATGGGAGCCAAGATATCCACCGTTGAAAA-3′.

[0035] The present invention designs multiple forward primers (FP) and reverse primers (RP) based on the 18S rRNA gene sequence of Cryptocaryon irritans (JN636814.1). The forward primer is fixed as FP3, and the optimal reverse primer is screened. The optimal reverse primer is then used to screen the optimal forward primer, ultimately identifying the optimal pair of RPA-specific primers. The optimal primers selected are 30 to 35 bases long and have a GC content between 40% and 60%. Polyguanine should be avoided in the 3 to 5 nucleotides at the 5' end; cytosine is beneficial here and can promote fragment recombination.

[0036] The specific amplified fragment corresponding to the primers is located between positions 167 and 398 of the 18S rRNA gene (JN636814.1) of Cryptocaryon irritans, has a size of 232 bp, and the nucleotide sequence is shown in SEQ ID No. 3:

[0037] 5'- CTTCACTTAGAGGAAGGAGAAGTCGTAACAAGG TTTCCGTAGGTGAACCTGCGGAAGGATCATTAACACAATTAAGATCAAACCTAAAAATTTATTCTGATGTATTGAGATCTGATAATTTTTAATTATCAATCTCAAATTTTTACAAATTTATTTTAATAATAAATATCATTAAGTTAATTAAATTAACTAAAGAAAA TTTTCAACGGTGGATATC TTGGCTCCCATAACG -3'.

[0038] The optimal primer pair screened was used for RPA amplification, and the amplified product was detected by agarose gel electrophoresis. If a 232-bp electrophoretic band was detected, the test was positive for Cryptocaryon irritans; otherwise, it was negative. This method is rapid, specific, sensitive, simple, and practical.

[0039] The RPA primers for detecting Cryptocaryon irritans of the present invention can be used to prepare a detection kit for Cryptocaryon irritans, and can detect Cryptocaryon irritans quickly, specifically, sensitively, simply and practically.

[0040] The present invention provides a detection kit for Cryptocaryon irritans, comprising the above-mentioned RPA primers for detecting Cryptocaryon irritans.

[0041] In a specific embodiment of the present invention, the detection kit further comprises reagents for RPA reaction.

[0042] Reagents commonly used in the RPA reaction in the art are applicable to the present invention. In a specific embodiment of the present invention, the reagents for the RPA reaction include: a reaction tube containing RPA freeze-dried particles, a reaction buffer, ddH2O and magnesium acetate.

[0043] In a specific embodiment of the present invention, the reaction tube containing the RPA freeze-dried particles includes: phage recombinase UvsX, auxiliary factor UvsY, DNA polymerase, single-stranded binding protein and dNTPS.

[0044] The present invention discloses a method for detecting Cryptocaryon irritans in water based on RPA technology. The total DNA extracted from the sample to be tested is used as a template, an RPA reaction is performed using the above-mentioned RPA primers for detecting Cryptocaryon irritans, and the amplified product is detected by agarose gel electrophoresis. If a 232 bp electrophoresis band is detected, the test is judged to be Cryptocaryon irritans positive, otherwise it is negative.

[0045] In a specific embodiment of the present invention, the RPA reaction is amplified at a constant temperature of 37° C. for at least 30 minutes.

[0046] In a specific embodiment of the present invention, the amplified product is detected by 1% agarose gel electrophoresis.

[0047] In one embodiment of the present invention, the amplification system of the RPA reaction includes: a reaction tube containing RPA freeze-dried particles, 29.4 μL of dry powder dissolution buffer, 12.1 μL of dd H2O, 2 μL of forward primer, 2 μL of reverse primer, 2 μL of 78.25 ng / μL DNA template and 2.5 μL of 280 mM magnesium acetate solution.

[0048] Specifically, the specific scheme of the method includes the following steps:

[0049] 1. Specific primers: Based on the sequence of the Cryptocaryon irritans 18S rRNA gene (JN636814.1), 11 forward primers FP and 13 reverse primers RP were designed (Table 1). The forward primer was fixed as FP3, and the best reverse primer was screened. The best forward primer was then screened with the best reverse primer to obtain the best pair of RPA-specific primers. Their sequences are shown below:

[0050] Forward primer FP6: 5′-CTTCACTTAGAGGAAGGAGAAGTCGTAACAAGG-3′

[0051] Reverse primer RP14: 5′-CGTTATGGGAGCCAAGATATCCACCGTTGAAAA-3′

[0052] The optimal primers screened out were 30 to 35 bases in length, with a GC content of 40% to 60%. The 3 to 5 nucleotides at the 5' end should avoid polyguanine, as cytosine is beneficial here and can promote fragment recombination.

[0053] The specific amplified fragment corresponding to the primers is located between positions 167 and 398 of the 18S rRNA gene (JN636814.1) of Cryptocaryon irritans, has a size of 232 bp, and the nucleotide sequence is:

[0054] 5'- CTTCACTTAGAGGAAGGAGAAGTCGTAACAAGG TTTCCGTAGGTGAACCTGCGGAAGGATCATTAACACAATTAAGATCAAACCTAAAAATTTATTCTGATGTATTGAGATCTGATAATTTTTAATTATCAATCTCAAATTTTTACAAATTTATTTTAATAATAAATATCATTAAGTTAATTAAATTAACTAAAGAAAA TTTTCAACGGTGGATATC TTGGCTCCCATAACG -3'

[0055] The best primer pair screened out was used for RPA amplification, and the amplified product was detected by agarose gel electrophoresis. If a 232 bp electrophoresis band was detected, it was judged to be positive for Cryptocaryon irritans, otherwise it was negative.

[0056] 2. Total DNA Extraction from Samples

[0057] Using a genome extraction kit, place <25 mg of Cryptocaryon irritans sample in a 1.5 mL centrifuge tube. Add 200 μL of lysis buffer A and 20 μL of proteinase K, then vortex to mix. Incubate at 56°C for complete enzymatic digestion, inverting the tube several times to mix thoroughly until no granular precipitate remains. Add 200 μL of lysis buffer B to provide a suitable environment for column loading and vortex to mix thoroughly. Add 150 μL of anhydrous ethanol, vortex to mix thoroughly, and centrifuge to collect the liquid on the inner wall of the tube cap. Transfer the collected mixture (including the flocculent precipitate) to an adsorption column, place the column in a 2 mL collection tube, and centrifuge at 13,400 g for 1 minute. Discard the filtrate and place the column in the collection tube. Add 500 μL of wash buffer A (anhydrous ethanol was added before use) along the tube wall and centrifuge at 13,400 g for 1 minute. Discard the filtrate and place the column in the collection tube. Add 500 μL of wash buffer A (anhydrous ethanol was added before use) along the tube wall and centrifuge at 13,400 g for 1 minute. Discard the filtrate and place the column in the collection tube. Add 600 μL of Wash Buffer B (add anhydrous ethanol before use) along the tube wall, centrifuge at 13,400 g for 1 minute, discard the filtrate, and repeat this step once. Place the adsorption column in a collection tube. Centrifuge the empty column at 13,400 g for 2 minutes. After centrifugation, leave the empty column uncovered for 2–5 minutes to allow any residual ethanol to evaporate completely. Transfer the adsorption column to a new 1.5 mL centrifuge tube. Add 50–100 μL of elution buffer, preheated to 55°C, to the center of the adsorption column membrane and let it stand at room temperature for 2–5 minutes. Centrifuge at 13,400 g for 1 minute. Assay the total DNA concentration of the extracted Cryptocaryon irritans sample and dilute to 78.25 ng / μL.

[0058] 3.RPA amplification system

[0059] 29.4 μL of dry powder dissolution buffer, 12.1 μL of ddH2O, 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 2 μL of the 78.25 ng / μL stimulated Cryptocaryon sample DNA template extracted above, and 2.5 μL of 280 mM magnesium acetate.

[0060] 4. Lyophilized enzyme complex reaction tube

[0061] The freeze-dried powder in the freeze-dried enzyme complex reaction tube contains the recombinant enzyme, single-stranded binding protein, polymerase, etc. for the RPA reaction.

[0062] 5. Sample loading order and reaction conditions for RPA amplification reaction

[0063] First, add the dry powder dissolution buffer, ddH2O, forward primer, reverse primer, and sample DNA template from the RPA reaction system to the lyophilized enzyme complex reaction tube in sequence. Finally, add magnesium acetate solution to initiate the reaction. (For multiple reactions, magnesium acetate solution is added to the reaction tube lid to ensure simultaneous reactions.) After capping, invert the reaction tube 8–10 times to mix thoroughly. After mixing, shake the reaction solution to the bottom of the tube. Immediately incubate the reaction tube in a 37°C water bath or other thermostatic device for 30 minutes. After the reaction is complete, remove the reaction tube and place it on ice to terminate the reaction. Purify the amplified product using a PCR product purification kit.

[0064] 6.RPA amplification product purification

[0065] Transfer the RPA amplification product to a 1.5 mL centrifuge tube and make up to 100 μL with sterile water. Add 5 volumes of Buffer GDP and mix thoroughly by inversion or vortexing. Place the adsorption column in a collection tube and transfer the above liquid to the adsorption column. Centrifuge at 8000 g for 60 seconds. Discard the filtrate, place the adsorption column in a collection tube, add 700 μL of Buffer GW to the adsorption column, and centrifuge at 13400 g for 60 seconds. Repeat this step once. Discard the filtrate, return the adsorption column to the centrifuge tube, and centrifuge at 13400 g for 2 minutes. Place the adsorption column in a 1.5 mL centrifuge tube, add 30 μL of elution buffer to the center of the adsorption column, and allow it to stand for 2 minutes. Centrifuge at 13400 g for 1 minute. Discard the adsorption column.

[0066] 7. Detection of amplified products by agarose gel electrophoresis

[0067] The detection method of the amplified product is as follows: 5 μL of the purified product is subjected to 1% agarose gel electrophoresis (180 V, 25 min), and the results are observed under ultraviolet light.

[0068] The present invention will be further described below with reference to the embodiments and accompanying drawings.

[0069] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0070] The RPA detection kit (DNA Constant Temperature Rapid Amplification Kit (Basic)) was purchased from Changzhou Anpu Future Biotechnology Co., Ltd., the genome extraction kit was purchased from Nanjing Novozymes Biotechnology Co., Ltd., the bacterial genomic DNA extraction kit was purchased from Tiangen Co., Ltd., and the product purification kit was purchased from Nanjing Novozymes Biotechnology Co., Ltd. Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0071] The Cryptocaryon irritans, Vibrio alginolyticus, Vibrio harveyi, Photobacterium mermanii, Edwardsiella tarda, Streptococcus agalactiae, Streptococcus iniae, Benedenia, and Dinoflagellate used in the following examples were all collected, identified, and preserved in our laboratory.

[0072] Example 1 RPA detection of Cryptocaryon irritans

[0073] 1) Extraction of total DNA from samples

[0074] Use the genome extraction kit. The specific steps are as follows:

[0075] Take <25 mg of Cryptocaryon irritans sample and chop it into pieces in a 1.5 mL centrifuge tube. Add 200 μL of lysis buffer A and 20 μL of proteinase K solution in sequence and shake to mix.

[0076] Incubate in a 56°C water bath until complete enzymatic hydrolysis, mixing by inverting several times until no granular precipitation remains in the solution.

[0077] Add 200 μL of lysis buffer B to provide the column environment and shake to mix;

[0078] Add 150 μL of anhydrous ethanol, shake to mix, and centrifuge briefly to collect the liquid on the inner wall of the tube cap;

[0079] Place the adsorption column in a 2 mL collection tube and transfer the liquid (including the flocculent precipitate) to the adsorption column. Centrifuge at 13400 g for 1 min.

[0080] Discard the filtrate and place the adsorption column in a collection tube. Add 500 μL of wash buffer A (add anhydrous ethanol before use) to the adsorption column along the tube wall and centrifuge at 13400 g for 1 minute.

[0081] Discard the filtrate and place the adsorption column in a collection tube. Add 600 μL of wash buffer B (add anhydrous ethanol before use) along the tube wall. Centrifuge at 13400 g for 1 minute, discard the filtrate, and repeat this step once.

[0082] Place the adsorption column in a collection tube. Centrifuge the empty column at 13400 g for 2 minutes.

[0083] After centrifugation of the empty column, leave it open for 2 to 5 minutes to allow the remaining ethanol to evaporate completely;

[0084] Transfer the adsorption column to a new 1.5 mL centrifuge tube. Add 50–100 μL of elution buffer, preheated to 55°C, to the center of the column membrane and incubate at room temperature for 2–5 minutes. Centrifuge at 13,400 g for 1 minute. Measure the extracted DNA concentration and dilute to 78.25 ng / μL. Store the DNA product at -20°C.

[0085] 2) Design and optimization of RPA primers

[0086] The conserved sequence of the Cryptocaryon irritans 18S rRNA gene (JN636814.1) was found in GenBank. Referring to the RPA primer screening guide of TwistDX (UK), the following guidelines were followed: a minimum primer length of 30 and a maximum of 36, a primer GC% of 40%-60%, avoidance of primer dimers and hairpin structures, and long strings of repeats; and amplification product size between 100 and 200 bp and a maximum of 500 bp. Primer Premier 5 software was used to design 11 RPA forward primers and 13 reverse primers. The primer sequences are shown in Table 1. These primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0087] Table 1

[0088]

[0089] First, the forward primer FP3 was randomly selected to screen 13 reverse primers. The reverse primer with the best amplification efficiency was selected by analyzing the number, size, shape and brightness of agarose gel electrophoresis bands. The test results were as follows: Figure 1 Lane M in the figure is Maker DL2000; lanes 1 to 13 are 13 reverse primers, namely RP-1, RP-2, RP-3, RP-4, RP-5, RP-8, RP-9, RP-14, RP-15, RP-16, RP-17, RP-19, and RP-20; lane 14 is the positive control of the RPA detection kit. The best reverse primer is RP14. The selected best reverse primer is then used to screen the forward primer. The forward primer with the best amplification efficiency is selected by analyzing the number, size, shape, and brightness of the agarose gel electrophoresis bands. The test results are shown in Figure 1. Figure 2 Lane M in the figure represents the Maker DL2000; lanes 1 to 11 represent 11 forward primers, namely FP-1, FP-2, FP-3, FP-4, FP-5, FP-6, FP-7, FP-13, FP-15, FP-18, and FP-19; lane 12 is the positive control for the RPA detection kit. The optimal forward primer is FP6. Therefore, the optimal RPA primer pair for detecting Cryptocaryon irritans was determined to be FP6 and RP14. The sequences of the optimal primer pair are as follows:

[0090] Forward primer FP6: 5′-CTTCACTTAGAGGAAGGAGAAGTCGTAACAAGG-3′

[0091] Reverse primer RP14: 5′-CGTTATGGGAGCCAAGATATCCACCGTTGAAAA-3′

[0092] 3) RPA reaction

[0093] The total reaction volume was 50 μL. First, 47.5 μL of reaction solution was prepared, including 29.4 μL of dry powder dissolution buffer, 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 12.1 μL of ddH2O, and 2 μL of 78.25 ng / μL stimulating Cryptocaryon DNA template solution. The above reaction solution was then added to the freeze-dried enzyme powder reaction tube. Finally, 2.5 μL of 280 mM magnesium acetate solution was added to the reaction tube. For multiple reactions, to ensure the simultaneous progress of the reactions, 2.5 μL of 280 mM magnesium acetate solution was added to the inside of the reaction tube lid. After the lid was closed, the reaction tube was inverted and shaken 8-10 times to mix thoroughly. After mixing, the reaction solution was shaken to the bottom of the tube. The reaction tube was immediately placed in a 37°C constant temperature water bath and incubated for 30 min. After the reaction was completed, the reaction tube was removed and placed on ice to terminate the reaction. The operation was repeated five times.

[0094] 4) Purification of RPA amplification products

[0095] Because the extracted total DNA contains impurities and proteases in the RPA amplification reaction system, which can interfere with agarose gel electrophoresis and result in smeared bands, the amplified product must be purified before gel electrophoresis. Purify the RPA amplified product using a PCR product purification kit as follows: Transfer the RPA amplified product to a 1.5 mL centrifuge tube and make up to 100 μL with sterile water. Add 5 volumes of Buffer GDP and mix thoroughly by inversion or vortexing. Place the adsorption column in a collection tube and transfer the above solution to the adsorption column. Centrifuge at 8000 g for 60 seconds. Discard the filtrate, place the adsorption column in the collection tube, add 700 μL of Buffer GW (prepared with anhydrous ethanol) to the adsorption column, and centrifuge at 13400 g for 60 seconds. Repeat this step once. Discard the filtrate, return the adsorption column to the centrifuge tube, and centrifuge at 13400 g for 2 minutes. Place the adsorption column in a 1.5 mL centrifuge tube, add 30 μL of elution buffer to the center of the column, and let it stand for 2 minutes. Centrifuge at 13400 g for 1 min. Discard the adsorption column.

[0096] 5) RPA amplification product detection

[0097] Take 5 μL of the purified product and perform 1% agarose gel electrophoresis, and finally use a gel imager to obtain the target electrophoresis band judgment results. Figure 3As shown, lane M is the Maker DL2000; lanes 1 to 5 represent five replicates of Cryptocaryon irritans DNA spiked at a concentration of 78.25 ng / μL; lane 6 represents the negative control, ddH2O. The lane spiked with 78.25 ng / μL Cryptocaryon irritans DNA exhibits a distinct target band at 232 bp, forming a neat, square shape with no tailing. The negative control spiked with ddH2O exhibits no bands at all, demonstrating no significant differences across the five replicates. The target band was recovered from the gel using a gel recovery kit, and the target DNA fragment was extracted and sent for sequencing. The sequencing results are as follows:

[0098] CTTCACTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACACAATTAAGATCAAACCTAAAAATTTATTCTGATGTATTGAGATCTGATAATTTTTAATTATCAATCTCAAATTTTTACAAATTTATTTTAATAATAAATATCATTAAGTTAATTAAATTAACTAAAGAAAATTTTCAACGGTGGATATCTTGGCTCCCATAACG

[0099] The sequence of the DNA product amplified by RPA was compared with the target fragment designed by the primers, and the consistency was 100%, indicating that the established RPA method can be used for the detection of Cryptocaryon irritans.

[0100] Example 2: RPA detection method specificity verification experiment

[0101] DNA was extracted from the bacterial cultures of Vibrio alginolyticus, Vibrio harveyi, Photorhabdus mermanii, Edwardsiella tarda, Streptococcus agalactiae, and Streptococcus iniae using a bacterial genomic DNA extraction kit. Benedenia and amylodinium were extracted using a genome extraction kit, and the total DNA of Cryptocaryon irritans, 85.95 ng / μL Vibrio alginolyticus, 60.80 ng / μL Vibrio harveyi, 105.55 ng / μL Photobacterium mermanii, 225.05 ng / μL Edwardsiella tarda, 129.20 ng / μL Streptococcus agalactiae, 104.65 ng / μL Streptococcus dolphis, 117.05 ng / μL Benedenia, and 86.23 ng / μL amylodinium was used as a template for RPA amplification. RPA amplification was performed using the RPA primers in Example 1, ddH2O was used as a negative control, and the amplified products were detected by 1% agarose gel electrophoresis. The results are as follows: Figure 4Lane M in the figure is a Maker DL2000; lane 1 is a DNA sample of Cryptocaryon irritans with an extraction concentration of 78.25 ng / μL; lanes 2 to 9 are, respectively, 85.95 ng / μL total DNA samples of Vibrio alginolyticus, 60.80 ng / μL total DNA samples of Vibrio harveyi, 105.55 ng / μL total DNA samples of Photobacterium mermanii, 225.05 ng / μL total DNA samples of Edwardsiella tarda, 129.20 ng / μL total DNA samples of Streptococcus agalactiae, 104.65 ng / μL total DNA samples of Streptococcus iniae, 117.05 ng / μL total DNA samples of Benedenia, and 86.23 ng / μL total DNA samples of Dinoflagellate.

[0102] Figure 4 The results showed that the lane containing the DNA template extracted from the Cryptocaryon irritans sample had an obvious target band at 232 bp, while the lane containing the total DNA template extracted from the samples of Vibrio alginolyticus, Vibrio harveyi, Photorhabdus mermanii, Edwardsiella tarda, Streptococcus agalactiae, Streptococcus iniae, Benedenia, and amylodinium did not show any amplified bands, indicating that the RPA primers and RPA detection method of the present invention are highly specific for Cryptocaryon irritans.

[0103] Example 3: RPA detection method sensitivity experiment

[0104] The total DNA extracted from 1, 2, 4, 8, 16, and 32 Cryptocaryon irritans larvae was used as a template and RPA amplification was performed using the method of Example 1. ddH2O was used as a negative control to investigate the sensitivity of the method. Figure 5 Lane M is Marker DL2000; lane 1 is the ddH2O negative control; lanes 2 to 7 are total DNA extracted from 1, 2, 4, 8, 16, and 32 Cryptocaryon irritans larvae, respectively.

[0105] The results showed that when the total DNA template extracted from the sample contained four Cryptocaryon irritans larvae, the expected bright and clear target bands were detected. However, when the DNA template extracted from the sample contained one or two Cryptocaryon irritans larvae, amplified bands were also detected, but they were more fuzzy. The negative control showed no amplified bands. This indicates that the sensitivity of the RPA detection method for Cryptocaryon irritans can reach four Cryptocaryon irritans in the sample, indicating high detection sensitivity.

[0106] Example 4: RPA detection method repeatability experiment

[0107] The total DNA extracted from 16 Cryptocaryon irritans larvae was used as a template and RPA amplification was performed using the method of Example 1. The above operation was repeated 6 times and the amplified products were detected by agarose gel electrophoresis to investigate the repeatability of the method. Figure 6As shown, lane M represents marker DL2000; lanes 1 to 6 represent total DNA extracted from 16 Cryptocaryon irritans larvae; and lane 7 represents a ddH2O negative control. Clear, bright, and neatly shaped target bands appear in all six RPA amplifications, with no significant differences between the bands, demonstrating the high reproducibility of the method.

[0108] Example 5: Detection of Cryptocaryon irritans in mixed samples of muscle and gill tissues of ovate pomfret by RPA

[0109] Samples of oval pomfret were collected from Changjiang and Huangliu, Guangdong. The muscle tissue and gill tissue of the oval pomfret were mixed and crushed. The total DNA of the sample was extracted using the method of Example 1. The total DNA sample was divided into two parts. One part was amplified by RPA according to the method of Example 1 and detected by agarose gel electrophoresis. The other part was amplified by traditional PCR method for specific target DNA fragments and detected by agarose gel electrophoresis. The primer pair was

[0110] Forward primer Cryp-F: 5′-CACTAGTTAGTGCGGGAAGT-3′;

[0111] Reverse primer S15: 5'-TGAGAGAATTAATCATAATTTATAT-3',

[0112] The total PCR amplification system was 25 μL, including 12.5 μL of 2× Taq Master Mix, 9.5 μL of ddH2O, 1 μL of forward primer, 1 μL of reverse primer, and 1 μL of sample. The PCR amplification conditions were 94°C for 5 min, 94°C for 30 s, 53°C for 30 s, 72°C for 1 min, 72°C for 10 min, and 16°C for 30 cycles. The agarose gel electrophoresis results of the RPA amplification products and the traditional PCR amplification products were shown in Figure 4. Figure 7 and Figure 8 Lane M is Marker DL2000; lanes 1 to 20 are DNA extracted from a mixture of muscle and gill tissue from 20 samples; lane 21 is a ddH2O negative control. The results showed that the RPA detection method and the traditional PCR detection method had a 100% agreement.

[0113] Example 6: RPA detection method for detecting Cryptocaryon irritans in aquaculture water

[0114] 1000 ml of water used for fish farming was collected and filtered with a filter to remove impurities. 1 ppm of formalin was added to the water, and then centrifuged at 10,000 rpm for 5 minutes to collect Cryptocaryon irritans larvae. After removing the supernatant, the precipitate was used to extract the total DNA of the sample, perform RPA amplification, and perform agarose gel electrophoresis. The above operation was repeated 6 times. The results are shown in FIG. Figure 9As shown, lane M is Marker DL2000; lanes 2 to 7 are total DNA from aquaculture water samples, and lane 1 is a ddH2O negative control. It can be seen that the RPA primers and RPA detection method of the present invention can qualitatively detect Cryptocaryon irritans in aquaculture water.

Claims

1. RPA primers for detecting Cryptocaryon irritans, characterized in that, the nucleotide sequences of the RPA primers are as follows: the nucleotide sequence of the forward primer FP is shown as SEQ ID No.1, and the nucleotide sequence of the reverse primer RP is shown as SEQ ID No.

2.

2. Use of the RPA primers for detecting Cryptocaryon irritans according to claim 1 in the preparation of a detection kit for Cryptocaryon irritans.

3. A detection kit for Cryptocaryon irritans, characterized in that: it contains the RPA primers for detecting Cryptocaryon irritans according to claim 1.

4. The detection kit for Cryptocaryon irritans according to claim 3, characterized in that: it further includes reagents for RPA reaction.

5. The detection kit for Cryptocaryon irritans according to claim 4, characterized in that: Reagents for RPA reaction include: reaction tubes containing freeze-dried RPA particles, reaction buffer, ddH 2 O, and magnesium acetate.

6. The detection kit for Cryptocaryon irritans according to claim 5, characterized in that: The reaction tube containing RPA freeze-dried particles includes: phage recombinase UvsX, cofactor UvsY, DNA polymerase, single-stranded binding protein and dNTPs.

7. A method for detecting Cryptocaryon irritans in water based on RPA technology, characterized in that: using the total DNA extracted from the sample to be tested as a template, performing RPA reaction with the RPA primers for detecting Cryptocaryon irritans according to claim 1, detecting the amplification product by agarose gel electrophoresis, if an electrophoretic band of 232bp can be detected, it is judged as positive for Cryptocaryon irritans, otherwise it is negative.

8. The method for detecting Cryptocaryon irritans in water based on RPA technology according to claim 7, characterized in that: The RPA reaction is amplified for at least 30 min under the constant temperature condition of 37°C.

9. The method for detecting Cryptocaryon irritans in water based on RPA technology according to claim 7, characterized in that: 1% agarose gel electrophoresis is used to detect the amplification product.

10. The method for detecting Cryptocaryon irritans in water based on RPA technology according to claim 7, characterized in that: The amplification system for the RPA reaction includes: a reaction tube containing RPA freeze-dried particles, 29.4 μL of dry powder dissolution buffer, 12.1 μL of ddH 2 O, 2 μL of forward primer, 2 μL of reverse primer, 2 μL of 78.25 ng / μL DNA template, and 2.5 μL of 280 mM magnesium acetate solution.

Citation Information

Patent Citations

  • RPA-CRISPR / Cas12a-based kit for rapidly detecting griseolus angularis

    CN118834980A