Use of primers and compositions thereof and probes in the preparation of kits for detecting HPV
Patent Information
- Application Number
- CN202310251747.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-14
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2043-03-14
AI Technical Summary
传统的DNA检测方法,包括测序法、原位杂交法、PCR法(电泳鉴定结果)等,结果相对准确,但检测灵敏度低、操作繁琐、耗时久、扩增后的产物暴露易造成交叉污染,不适用于临床上的大规模应用
[0110]本发明克服了传统的宫颈癌筛查方法存在的检测耗时长、假阴性率高、操作技术门槛高的问题,提供了检测14种引发宫颈癌的HPV的引物和探针,并提供了相应的检测试剂盒,不仅简化操作过程,降低成本和技术复杂性,还大大缩短宫颈癌的筛查时间,具有高特异性,适用于临床上的大规模宫颈癌初步筛查,具有推广应用价值。
Smart Images

Figure CN116121465B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of application, and more particularly, to the use of primers and combinations thereof with probes in the preparation of kits for detecting HPV. Background Technology
[0002] Cervical cancer is a common gynecological malignancy in women, ranking first among female reproductive tract malignancies. Worldwide, more than 500,000 new cases of cervical cancer are diagnosed annually, and more than 300,000 people die from this malignant tumor each year. Cervical cancer is also currently the only malignant tumor with a clearly defined cause and comprehensive three-tiered prevention measures. Persistent infection with high-risk human papillomavirus (HPV) is the main cause of cervical intraepithelial neoplasia and cervical cancer. Global studies show that high-risk HPV DNA is detected in 99.7% of cervical cancer patients. Currently, more than 100 different types of HPV are known, most of which are considered "low-risk" and not associated with cervical cancer, but 14 HPV types (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68) are classified as "high-risk." The International Agency for Research on Cancer has evaluated and determined that almost all cervical cancers are caused by infection with these 14 high-risk HPV types. Among them, the two highest-risk strains, HPV16 and HPV18, can cause approximately 70% of cervical cancer cases.
[0003] According to estimates by the World Health Organization (WHO), without appropriate and effective screening methods and preventive measures, the incidence of cervical cancer in Asia will rise by 40% by 2025. It takes approximately 5 to 10 years for a patient with cervical intraepithelial neoplasia (CIN) to progress from persistent infection with high-risk HPV to CIN and finally to cervical cancer. Literature reports that the 5-year cure rate for early-stage cervical cancer can be as high as 90%, making early detection, diagnosis, and treatment crucial for patients with CIN. Establishing a detection method for high-risk HPV for cervical cancer screening is of great significance for the prevention, diagnosis, and treatment of cervical cancer.
[0004] Current cervical cancer screening methods mainly include three types: cytology examination, colposcopy and biopsy, and HPV testing. Initial screening typically involves cytology examination and HPV testing.
[0005] Cytological examination is the "gold standard" for cervical cancer screening, and has been used globally for 75 years. Typical techniques include traditional Pap smears (CV) and liquid-based thin-layer cytology (TCT). However, even as the "gold standard," cytological examination can only detect about 50% of precancerous cervical lesions. Studies have shown that even if a woman tests positive for HPV types 16 or 18, and the cytology results are normal, one in ten women will still have precancerous cervical lesions. Therefore, cytological examination alone is insufficient to assess a woman's risk of developing cervical cancer; HPV testing can be helpful in cervical cancer screening.
[0006] Colposcopy allows for real-time visual assessment of the cervix, particularly the cervical transformation zone, to detect cervical intraepithelial neoplasia (CIN), squamous intraepithelial lesions (SIL), and invasive carcinoma. It is a crucial initial step in evaluating abnormal cervical cancer screening results, assessing the risk of precancerous lesions. However, colposcopy requires highly trained and experienced physicians, and the interpretation of results is subjective and imprecise, with a false negative rate (the proportion of missed high-grade lesions or invasive carcinoma) ranging from 13% to 69%. Therefore, colposcopy-guided biopsy is not suitable for large-scale initial clinical screening.
[0007] Existing HPV testing methods include immunological and nucleic acid testing. Immunological methods, such as immunoprecipitation, ELISA, and hybridization capture, have limitations in large-scale clinical application due to drawbacks such as low sensitivity, high false-positive rate, low specificity, cumbersome operation, and difficulty in HPV genotyping. The latest WHO guidelines for cervical precancerous lesion screening and treatment published in 2021 recommend HPV-DNA testing as the preferred method for initial cervical cancer screening. Traditional DNA testing methods, including sequencing, in situ hybridization, and PCR (electrophoresis identification), provide relatively accurate results, but suffer from low sensitivity, cumbersome operation, long processing times, and the risk of cross-contamination from amplified products, making them unsuitable for large-scale clinical application. In contrast, real-time fluorescence PCR technology, developed from traditional PCR, offers high sensitivity, strong specificity, high automation, moderate cost, virtually no contamination, and HPV genotyping capabilities. These advantages undoubtedly bring significant benefits to the early diagnosis of human papillomavirus.
[0008] Currently, there is an urgent need to establish a rapid detection method for high-risk HPV-DNA that is highly sensitive, specific, has a low false negative rate, short detection time, and is easy to operate. Summary of the Invention
[0009] To address the problems existing in the prior art, the present invention provides the application of primers and their combinations with probes in the preparation of kits for detecting HPV.
[0010] The first objective of this invention is to provide the application of primers in the preparation of kits for detecting HPV.
[0011] A second object of the present invention is to provide the use of the primer and probe composition in the preparation of a kit for detecting HPV.
[0012] A third objective of this invention is to provide a kit for detecting HPV.
[0013] To achieve the above objectives, the present invention is implemented through the following solution:
[0014] This invention provides specific primers and probes for detecting the L1 gene of 14 high-risk HPV types: HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68. The International Agency for Research on Cancer has evaluated and determined that almost all cervical cancers are caused by infection with these 14 high-risk HPV types; therefore, detecting these 14 HPV types can effectively facilitate large-scale preliminary cervical cancer screening.
[0015] A primer for detecting HPV, the nucleotide sequence of which is shown in SEQ ID NO: 15-42.
[0016] The application of primers in the preparation of HPV detection kits, wherein the nucleotide sequences of the primers are shown in SEQ ID NO: 15-42.
[0017] The HPV types are HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.
[0018] The nucleotide sequences of the primers for detecting HPV16 are shown in SEQ ID NO: 15-16;
[0019] The nucleotide sequences of the primers for detecting HPV18 are shown in SEQ ID NO: 17-18;
[0020] The nucleotide sequences of the primers for detecting HPV31 are shown in SEQ ID NO: 19-20;
[0021] The nucleotide sequences of the primers for detecting HPV33 are shown in SEQ ID NO: 21-22;
[0022] The nucleotide sequences of the primers for detecting HPV35 are shown in SEQ ID NO: 23-24;
[0023] The nucleotide sequences of the primers for detecting HPV39 are shown in SEQ ID NO: 25-26;
[0024] The nucleotide sequences of the primers for detecting HPV45 are shown in SEQ ID NO: 27-28;
[0025] The nucleotide sequences of the primers for detecting HPV51 are shown in SEQ ID NO: 29-30;
[0026] The nucleotide sequences of the primers for detecting HPV52 are shown in SEQ ID NO: 31-32;
[0027] The nucleotide sequences of the primers for detecting HPV56 are shown in SEQ ID NO: 33-34;
[0028] The nucleotide sequences of the primers for detecting HPV58 are shown in SEQ ID NO: 35-36;
[0029] The nucleotide sequences of the primers for detecting HPV59 are shown in SEQ ID NO: 37-38;
[0030] The nucleotide sequences of the primers for detecting HPV66 are shown in SEQ ID NO: 39-40;
[0031] The nucleotide sequences of the primers for detecting HPV68 are shown in SEQ ID NO: 41-42.
[0032] A composition of primers and probes for detecting HPV, wherein the primers are those described above; and the nucleotide sequences of the probes are shown in SEQ ID NO: 1-14.
[0033] The application of the primer and probe composition in the preparation of a kit for detecting HPV, wherein the primer is the primer described above; and the nucleotide sequence of the probe is shown in SEQ ID NO: 1-14.
[0034] The nucleotide sequence of the probe for detecting HPV16 is shown in SEQ ID NO: 1;
[0035] The nucleotide sequence of the probe for detecting HPV18 is shown in SEQ ID NO: 2;
[0036] The nucleotide sequence of the probe for detecting HPV31 is shown in SEQ ID NO: 3;
[0037] The nucleotide sequence of the probe for detecting HPV33 is shown in SEQ ID NO: 4;
[0038] The nucleotide sequence of the probe for detecting HPV35 is shown in SEQ ID NO: 5;
[0039] The nucleotide sequence of the probe for detecting HPV39 is shown in SEQ ID NO: 6;
[0040] The nucleotide sequence of the probe for detecting HPV45 is shown in SEQ ID NO: 7;
[0041] The nucleotide sequence of the probe for detecting HPV51 is shown in SEQ ID NO: 8;
[0042] The nucleotide sequence of the probe for detecting HPV52 is shown in SEQ ID NO: 9;
[0043] The nucleotide sequence of the probe for detecting HPV56 is shown in SEQ ID NO: 10;
[0044] The nucleotide sequence of the probe for detecting HPV58 is shown in SEQ ID NO: 11;
[0045] The nucleotide sequence of the probe for detecting HPV59 is shown in SEQ ID NO: 12;
[0046] The nucleotide sequence of the probe for detecting HPV66 is shown in SEQ ID NO: 13;
[0047] The nucleotide sequence of the probe for detecting HPV68 is shown in SEQ ID NO: 14.
[0048] Preferably, the composition comprises groups A to C, wherein the probes of each group have different fluorescent reporter groups at their 5' ends and fluorescent quencher groups at their 3' ends; the fluorescent reporter groups are any one of Texas Red, VIC, or FAM; and the fluorescent quencher groups are any one of BHQ1, BHQ2, or DQ1.
[0049] Group A contains a probe with a nucleotide sequence as shown in SEQ ID NO: 1 and primers with nucleotide sequences as shown in SEQ ID NO: 15-16; Group B contains a probe with a nucleotide sequence as shown in SEQ ID NO: 2 and primers with nucleotide sequences as shown in SEQ ID NO: 17-18; Group C contains a probe with a nucleotide sequence as shown in SEQ ID NO: 3-18 and primers with nucleotide sequences as shown in SEQ ID NO: 19-42.
[0050] Group A detects HPV16, Group B detects HPV18, and Group C detects the remaining 12 types of HPV, namely HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.
[0051] More preferably, the 5' end of group A is provided with a fluorescent reporter group Texas Red; the 5' end of group B is provided with a fluorescent reporter group VIC; and the 5' end of group C is provided with a fluorescent reporter group FAM.
[0052] More preferably, the 3' end of group A is provided with a fluorescence quenching group BHQ2; the 3' end of group B is provided with a fluorescence quenching group BHQ1; and the 3' end of group C is provided with a fluorescence quenching group BHQ1.
[0053] A kit for detecting HPV, comprising primers with the above-mentioned nucleotide sequences as shown in SEQ ID NO: 15-42.
[0054] Preferably, the composition comprises any of the above-described primers and probes, wherein the nucleotide sequences of the primers are shown in SEQ ID NO: 15-42; and the nucleotide sequences of the probes are shown in SEQ ID NO: 1-14.
[0055] More preferably, the composition comprises groups A to C, wherein the probes of each group have different fluorescent reporter groups at their 5' ends and fluorescent quencher groups at their 3' ends; the fluorescent reporter groups are any one of Texas Red, VIC, or FAM; and the fluorescent quencher groups are any one of BHQ1, BHQ2, or DQ1.
[0056] Group A contains a probe with a nucleotide sequence as shown in SEQ ID NO: 1 and primers with nucleotide sequences as shown in SEQ ID NO: 15-16; Group B contains a probe with a nucleotide sequence as shown in SEQ ID NO: 2 and primers with nucleotide sequences as shown in SEQ ID NO: 17-18; Group C contains a probe with a nucleotide sequence as shown in SEQ ID NO: 3-18 and primers with nucleotide sequences as shown in SEQ ID NO: 19-42.
[0057] More preferably, the 5' end of group A is provided with a fluorescent reporter group Texas Red; the 5' end of group B is provided with a fluorescent reporter group VIC; and the 5' end of group C is provided with a fluorescent reporter group FAM.
[0058] More preferably, the 3' end of group A is provided with a fluorescence quenching group BHQ2; the 3' end of group B is provided with a fluorescence quenching group BHQ1; and the 3' end of group C is provided with a fluorescence quenching group BHQ1.
[0059] More preferably, the final concentration of the probes in groups A to C is 0.10 μM to 0.42 μM; and the final concentration of the primers in groups A to C is 0.08 μM to 0.62 μM.
[0060] Most preferably, in group A, the final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 1 is 0.10 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 15-16 is 0.20 μM;
[0061] In group B, the final concentration of the probe with the nucleotide sequence shown in SEQ ID NO: 2 is 0.20 μM, and the final concentration of the primer with the nucleotide sequence shown in SEQ ID NO: 17-18 is 0.40 μM.
[0062] In group C, the final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 3 is 0.14 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 19-20 is 0.26 μM.
[0063] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 4 is 0.20 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 21-22 is 0.40 μM.
[0064] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 5 is 0.12 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 23-24 is 0.26 μM.
[0065] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 6 is 0.20 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 25-26 is 0.40 μM.
[0066] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 7 is 0.20 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 27-28 is 0.40 μM.
[0067] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 8 is 0.20 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 29-30 is 0.30 μM.
[0068] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 9 is 0.40 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 31-32 is 0.60 μM.
[0069] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 10 is 0.20 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 33-34 is 0.30 μM.
[0070] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 11 is 0.12 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 35-36 is 0.30 μM.
[0071] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 12 is 0.20 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 37-38 is 0.30 μM.
[0072] The final concentration of the probe with nucleotide sequences as shown in SEQ ID NO: 13 is 0.22 μM, and the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO: 39-40 is 0.24 μM.
[0073] The probe with the nucleotide sequence shown in SEQ ID NO: 14 has a final concentration of 0.20 μM, and the primers with the nucleotide sequences shown in SEQ ID NO: 41-42 have a final concentration of 0.10 μM.
[0074] Preferably, the composition further comprises group D, which contains primers and probes for detecting the internal reference gene. This invention does not impose any specific limitations on the internal reference gene used to detect the above 14 types of HPV; conventional internal reference genes such as GAPDH, β-actin, and 18S RNA can all be used as internal reference genes.
[0075] More preferably, the internal reference gene is the GAPDH gene.
[0076] More preferably, group D contains a probe for detecting the GAPDH gene with a nucleotide sequence as shown in SEQ ID NO: 43 and primers with nucleotide sequences as shown in SEQ ID NO: 44-45.
[0077] More preferably, in group D, the final concentration of the primers with the nucleotide sequences shown in SEQ ID NO: 44-45 is 0.18 μM to 0.22 μM.
[0078] Most preferably, in group D, the final concentration of the primers with the nucleotide sequences shown in SEQ ID NO: 44-45 is 0.20 μM.
[0079] More preferably, in group D, the probe with the nucleotide sequence shown in SEQ ID NO: 43 has a fluorescent reporter group CY5 at its 5' end and a fluorescent quencher group Eclipse and 4*Zip at its 3' end.
[0080] More preferably, in group D, the final concentration of the probe with the nucleotide sequence shown in SEQ ID NO: 43 is 0.28 μM to 0.32 μM.
[0081] Most preferably, in group D, the final concentration of the probe with the nucleotide sequence shown in SEQ ID NO: 43 is 0.30 μM.
[0082] Preferably, the kit further includes a positive control, which is a pseudovirus, the genome of which contains nucleotide sequences as shown in SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 54.
[0083] Preferably, the kit further includes a negative control, which is purified water.
[0084] Preferably, the kit further comprises real-time PCR reaction reagents.
[0085] More preferably, the real-time PCR reaction reagent comprises PCR buffer and PCR enzyme.
[0086] More preferably, the method of using the kit includes the following steps:
[0087] S1. Obtain the genomic DNA of the sample to be tested;
[0088] S2. Using the DNA of the test sample as a template, prepare a reaction system using the above-mentioned primer and probe combination, negative control, positive control and real-time PCR reagent, perform real-time PCR amplification, obtain the Ct values of Texas Red channel, VIC channel, FAM channel and CY5 channel, and determine whether the test sample contains high-risk human papillomavirus;
[0089] The determination method is as follows:
[0090] The Ct value of at least one of the Texas Red, VIC and FAM channels is ≤38. The presence or absence of a Ct value in the CY5 channel does not affect the result judgment.
[0091] For positive control samples, the Ct values of the Texas Red, VIC, and FAM channels should all be ≤38. For negative control samples, the Ct value of the CY5 channel should be ≤38, and the Ct values of the Texas Red, VIC, and FAM channels should all be >38 or have no Ct value. If at least one of the Texas Red, VIC, FAM, and CY5 channels of the test sample shows a significant amplification curve, the test result is valid and the next step of determining the infection status can be carried out. Otherwise, the test result is invalid and retesting is required.
[0092] Determination of infection status:
[0093] If the CY5 channel Ct value of the test sample is ≤38 and the Texas Red channel, VIC channel, and FAM channel all have Ct values >38 or no Ct value, it indicates that the test sample is not infected with HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.
[0094] A Texas Red channel Ct value ≤ 38, a VIC channel and FAM channel Ct value > 38 or no Ct value indicates that the sample is infected with HPV16 and not infected with HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82.
[0095] A Ct value ≤ 38 for the VIC channel and > 38 or no Ct value for the Texas Red and FAM channels in the tested sample indicates that the sample is infected with HPV18 and not infected with HPV16, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82.
[0096] If the Ct value of the FAM channel of the test sample is ≤38, and the Ct value of the Texas Red channel and VIC channel is >38 or there is no Ct value, it indicates that the test sample is infected with at least one of HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82, but is not infected with HPV16 and HPV18.
[0097] If the Ct value of the Texas Red channel and VIC channel of the test sample is ≤38, and the Ct value of the FAM channel is >38 or there is no Ct value, it indicates that the test sample is infected with HPV16 and HPV18, but not infected with the other 12 types of HPV (HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82).
[0098] If the Ct value of the Texas Red channel and FAM channel of the test sample is ≤38, and the Ct value of the VIC channel is >38 or there is no Ct value, it indicates that the test sample is infected with HPV16, or infected with at least one of HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82, but is not infected with HPV18.
[0099] A Ct value >38 or no Ct value in the Texas Red channel of the test sample, and a Ct value ≤38 in the VIC and FAM channels, indicates that the test sample is infected with at least one of HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82, but is not infected with HPV16.
[0100] The fact that the Ct values of the Texas Red, VIC, and FAM channels of the tested sample were all ≤38 indicates that the tested sample was infected with at least one of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82.
[0101] This invention does not impose any special limitations on the method for extracting genomic DNA from the test sample. Generally, conventional methods or nucleic acid extraction kits can be used to extract the genomic DNA from the test sample.
[0102] More preferably, in step S1, the genomic DNA of the obtained test sample is extracted, and the positive control sample is processed using the same extraction method.
[0103] More preferably, in step S2, the primer and probe composition is present in tris(hydroxymethyl)aminomethane-hydrochloric acid buffer (pH 8.3), which is the primer-probe mixture.
[0104] More preferably, in step S2, the volume ratio of primer-probe mixture, PCR buffer, PCR enzyme and template in the reaction system is (9-11):(6.5-8.5):(2-4):(28-32), and the template is genomic DNA of the test sample, negative control or positive control processed using the same extraction method.
[0105] In step S2, the volume ratio of primer-probe mixture, PCR buffer, PCR enzyme, and template in the reaction system is 10:7:3:30.
[0106] More preferably, in step S2, the procedure for the quantitative PCR amplification is as follows: 48–52°C for 2 minutes; 93–97°C for 15 minutes; 92–96°C for 15 seconds; 48–52°C for 45 seconds; 43–47 cycles.
[0107] More preferably, in step S2, the procedure for the quantitative PCR amplification is as follows: 50°C, 2 minutes; 95°C, 15 minutes; 94°C, 15 seconds; 50°C, 45 seconds; 45 cycles, during which fluorescence is collected.
[0108] More preferably, in step S2, the fluorescence channels selected for fluorescence collection in the quantitative PCR amplification are the Texas Red channel, VIC channel, FAM channel, and CY5 channel.
[0109] Compared with the prior art, the present invention has the following beneficial effects:
[0110] This invention overcomes the problems of long detection time, high false negative rate and high technical threshold of traditional cervical cancer screening methods. It provides primers and probes for detecting 14 types of HPV that cause cervical cancer, and provides corresponding test kits. It not only simplifies the operation process, reduces costs and technical complexity, but also greatly shortens the cervical cancer screening time. It has high specificity and is suitable for large-scale preliminary cervical cancer screening in clinical practice, and has promotion and application value. Attached Figure Description
[0111] Figure 1 The PCR results for detecting negative control samples in this invention are shown.
[0112] Figure 2 This is the PCR result for detecting the positive control sample in this invention. Detailed Implementation
[0113] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0114] Example 1: HPV Nucleic Acid Detection Probes and Primers
[0115] 1. Sequence
[0116] Based on the L1 gene sequences of HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68 (NCBI numbers are: KM058666.1, MH057749.1, KU163584.1, GQ479019.1, GQ...),... Using the following primers (479039.1, MK344673.1, MW052843.1, MW888944.1, KY077863.1, LR862083.1, ON355256.1, MT934364.1, MK648148.1, LR861959.1), nucleic acid detection primers and probes for 14 types of human papillomavirus were designed, and their specific sequences are shown in Tables 1 and 2.
[0117] Table 1. Sequences of nucleic acid detection probes for 14 types of human papillomavirus
[0118]
[0119] The probes with the above nucleotide sequences, as shown in SEQ ID NO: 1 to 14, are all fluorescent probes, labeled with different fluorescent reporter groups and fluorescent quencher groups. Specifically, the HPV16 probe (SEQ ID NO: 1) has a fluorescent reporter group Texas Red at its 5' end and a fluorescent quencher group BHQ2 at its 3' end; the HPV18 probe (SEQ ID NO: 2) has a fluorescent reporter group VIC at its 5' end and a fluorescent quencher group BHQ1 at its 3' end; and the probes for HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68 (SEQ ID NO: 3 to SEQ ID NO: 14) have a fluorescent reporter group FAM at their 5' end and a fluorescent quencher group BHQ1 at their 3' end.
[0120] Table 2. Sequences of primers for nucleic acid detection of 14 types of human papillomavirus.
[0121]
[0122]
[0123] The probes and primers mentioned above can be used to detect 14 types of HPV. Based on the fluorescence signal results presented by the PCR reaction tube, the number of HPV types in the test sample and the infection status of HPV16 and HPV18 can be determined.
[0124] This invention does not impose any special limitations on the internal reference gene used for HPV detection. Conventional internal reference genes such as GAPDH, β-actin, and 18SRNA can all be used as internal reference genes for HPV detection.
[0125] This embodiment uses GAPDH as an example to provide probes and primers for detecting the internal reference gene, with the specific sequences as follows:
[0126] The probe for detecting GAPDH (5' to 3') is TGACCTCAACTACATGGTGAGT (SEQ ID NO: 43), with a fluorescent reporter group CY5 at the 5' end and fluorescent quencher groups Eclipse and 4*Zip at the 3' end;
[0127] Primers for detecting GAPDH (5'-3'): Upstream: GTGAGTGCTACATGGTGA (SEQ ID NO: 44); Downstream: CCATGGGTGGAATCATATT (SEQ ID NO: 45).
[0128] II. Working concentration of primers and probes
[0129] Fourteen plasmids (SEQ ID NO: 46–59) containing DNA fragments of HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68 were used as templates. The plasmid concentrations were 50,000 copies / mL, 5,000 copies / mL, or 500 copies / mL, respectively. Real-time quantitative PCR amplification was performed using the aforementioned primers and probes. The real-time quantitative PCR reaction program was set as follows: 50℃, 2 min; 95℃, 15 min; 94℃, 15 s; 50℃, 45 s; 45 cycles.
[0130] Adjust the amounts of primers and probes of each type to obtain the optimal working concentrations. Specific grouping information for adjusting the amounts is shown in Table 3 below.
[0131] Table 3. Adjustment of working concentration for each type of primer and probe
[0132]
[0133]
[0134] The results showed that in working concentration group 1, the fluorescence intensity of HPV18 was too high, while the fluorescence intensity of HPV35 and HPV51 was too low. The HPV33 curve did not show an S-shape, and HPV45 and HPV56 were missed. The remaining 8 types amplified well. In working concentration group 2, the fluorescence intensity of HPV33, HPV39, HPV45, and HPV66 was too low. The HPV52 and HPV68 curves did not show an S-shape, and HPV56 was missed. The remaining 7 types amplified well. In working concentration group 3, all 14 HPV types showed good amplification curve morphology, and the Ct value showed a good linear relationship with the template concentration gradient. The detection sensitivity met the standards. Therefore, the optimal real-time quantitative PCR reaction system is shown in Table 4.
[0135] Table 4 Real-time quantitative PCR reaction system
[0136]
[0137]
[0138] Example 2: A rapid screening kit for human papillomavirus
[0139] I. Composition
[0140] The kit (48 reactions / kit) includes HPV (12+2) PCR reaction solution A (810 μL / tube), HPV (12+2) PCR reaction solution B (312 μL / tube), positive control (900 μL / tube) and negative control (900 μL / tube).
[0141] HPV(12+2)PCR reaction solution A contains the HPV nucleic acid detection probe and primers from Example 1, and its main components are shown in Table 5.
[0142] Table 5. Main components of HPV (12+2) PCR reaction solution A
[0143]
[0144]
[0145] The probes shown in the above nucleotide sequences, such as SEQ ID NO: 1-14 and SEQ ID NO: 43, are all fluorescent probes, labeled with different fluorescent reporter groups and fluorescent quencher groups. Among them, the HPV16 probe (SEQ ID NO: 1) has a fluorescent reporter group Texas Red at its 5' end and a fluorescent quencher group BHQ2 at its 3' end; the HPV18 probe (SEQ ID NO: 2) has a fluorescent reporter group VIC at its 5' end and a fluorescent quencher group BHQ1 at its 3' end; the probes for HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66 and HPV68 (SEQ ID NO: 3 to SEQ ID NO: 14) have a fluorescent reporter group FAM at its 5' end and a fluorescent quencher group BHQ1 at its 3' end; the GAPDH probe (SEQ ID NO: 43) has a fluorescent reporter group CY5 at its 5' end and fluorescent quenchers Eclipse and 4*Zip at its 3' end.
[0146] When performing real-time quantitative PCR, detection channels for collecting fluorescence are set according to the fluorescent reporter groups of each probe: the Texas Red channel is set for detecting HPV16, the VIC channel is set for detecting HPV18; the FAM channel is set for detecting HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68; and the CY5 channel is set for detecting the GAPDH gene.
[0147] The main components of HPV(12+2) PCR reaction solution B are shown in Table 6.
[0148] Table 6. Main components of HPV (12+2) PCR reaction solution B
[0149]
[0150]
[0151] II. Instructions for Use
[0152] 1. Extraction of genomic DNA from the test sample
[0153] This kit uses cervical exfoliated cell samples as the test sample.
[0154] There are no specific requirements for the extraction method of genomic DNA from the test sample. Generally, routine laboratory methods (phenol-chloroform extraction method) or qualified nucleic acid extraction kits can be used to extract genomic DNA from the test sample.
[0155] The same extraction process was performed on the positive control sample of this kit.
[0156] The extracted genomic DNA from the test sample, negative control, and extracted positive control can be used immediately for testing with this kit, or stored at -20°C for later use.
[0157] 2. Preparation of Real-Time Quantitative PCR Reaction System
[0158] Prepare the real-time quantitative PCR reaction system (total volume 50 μL) according to the information shown in Table 8.
[0159] Table 8 Real-time quantitative PCR reaction system
[0160]
[0161] 3. Real-time quantitative PCR amplification
[0162] (1) Computer test
[0163] Place the PCR reaction tubes into the sample slot of the real-time quantitative PCR instrument and record the placement order.
[0164] (2) Fluorescence channel selection
[0165] Select the Texas Red channel to detect HPV16; select the VIC channel to detect HPV18; select the FAM channel to detect the other 12 types, namely HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68; select the CY5 channel to detect the internal reference gene GAPDH.
[0166] (3) Reaction Procedure
[0167] The same real-time quantitative PCR reaction procedure as in Example 1.
[0168] 4. Results Reading and Analysis
[0169] After the reaction, the Ct values of each fluorescence channel of the test sample were obtained, and the infection status of the test sample was analyzed and determined. The specific determination method is as follows:
[0170] (1) Determining whether the test results are valid
[0171] The Ct value of at least one of the Texas Red, VIC and FAM channels is ≤38. The presence or absence of a Ct value in the CY5 channel does not affect the result judgment.
[0172] For positive control samples, the Ct values of the Texas Red, VIC, and FAM channels should all be ≤38. For negative control samples, the Ct value of the CY5 channel should be ≤38, and the Ct values of the Texas Red, VIC, and FAM channels should all be >38 or have no Ct value. If at least one of the Texas Red, VIC, FAM, and CY5 channels in the test sample shows a clear amplification curve, the test result is valid and can proceed to the next step of determining the infection status. Otherwise, the test result is invalid and needs to be retested.
[0173] (2) Determination of infection status
[0174] If the CY5 channel Ct value of the test sample is ≤38 and the Texas Red channel, VIC channel, and FAM channel all have Ct values >38 or no Ct value, it indicates that the test sample is not infected with 14 types of HPV (HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68).
[0175] A Texas Red channel Ct value ≤ 38, a VIC channel and FAM channel Ct value > 38 or no Ct value indicates that the sample is infected with HPV16 and not infected with the other 13 types of HPV (HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82).
[0176] A Ct value of ≤38 for the VIC channel and >38 or no Ct value for the Texas Red and FAM channels in the test sample indicates that the test sample is infected with HPV18 and not infected with the other 13 types of HPV (HPV16, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82).
[0177] If the Ct value of the FAM channel of the test sample is ≤38, and the Ct value of the Texas Red channel and VIC channel is >38 or there is no Ct value, it indicates that the test sample is infected with at least one of the other 12 types of HPV (HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82), but is not infected with HPV16 and HPV18.
[0178] If the Ct value of the Texas Red channel and VIC channel of the test sample is ≤38, and the Ct value of the FAM channel is >38 or there is no Ct value, it indicates that the test sample is infected with HPV16 and HPV18, but not infected with the other 12 types of HPV (HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82).
[0179] If the Ct value of the Texas Red channel and FAM channel of the test sample is ≤38, and the Ct value of the VIC channel is >38 or there is no Ct value, it indicates that the test sample is infected with HPV16 and at least one of the other 12 types of HPV (HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82), but is not infected with HPV18.
[0180] A Texas Red channel Ct value >38 or no Ct value, and a VIC channel and FAM channel Ct value ≤38 indicate that the sample is infected with HPV18 and at least one of the other 12 types of HPV (HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82), but not infected with HPV16.
[0181] The Texas Red, VIC, and FAM channels of the tested samples all had Ct values ≤38, indicating that the tested samples were infected with at least one of HPV16, HPV18, and the remaining 12 types of HPV (HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82).
[0182] Example 3: Reagent sensitivity
[0183] 1. Experimental Methods
[0184] (1) Prepare a real-time quantitative PCR reaction system according to the method described in Example 2, wherein the template is 30 μL of plasmid containing DNA fragments of HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66 and HPV68 (nucleotide sequence as shown in SEQ ID NO: 46-59, concentration of 500 copies / mL) or 30 μL of positive control of the kit after extraction or 30 μL of negative control of the kit, and the total volume of PCR reaction solution in each tube is 50 μL.
[0185] (2) Perform real-time fluorescence quantitative PCR amplification and result reading and analysis according to the method described in Example 2.
[0186] 2. Experimental Results
[0187] like Figure 1 As shown, in Example 2 of this invention, the reagent kit for detecting negative controls showed no obvious fluorescence amplification curves in the CY5 channel, Texas Red channel, VIC channel, and FAM channel; as Figure 2 As shown, the CY5 channel, Texas Red channel, VIC channel, and FAM channel all exhibited significant fluorescence amplification curves.
[0188] Table 9. Sensitivity test results of the kit
[0189]
[0190] As shown in Table 9, the kit of Example 2 of the present invention can detect the DNA of 14 types of HPV (HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66 and HPV68) at a concentration of approximately 500 copies / mL, which has high sensitivity and can meet the clinical testing needs.
[0191] Example 4: Accuracy of the reagent kit
[0192] 1. Experimental Methods
[0193] (1) Plasmids containing DNA fragments of HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66 and HPV68 in Example 3 were detected using the kit of Example 2 of the present invention (nucleotide sequences as shown in SEQ ID NO: 46-59, each with a concentration of 50,000 copies / mL), and were recorded as positive references P1-P14; clinical samples (clinical negative samples, HPV6 positive clinical samples, HPV11 positive clinical samples, HPV42 positive clinical samples, HPV43 positive clinical samples, HPV81 positive clinical samples and HPV83 positive clinical samples), and inactivated cultures (herpes simplex virus type II, Ureaplasma urealyticum, Mycoplasma hominis, Neisseria gonorrhoeae, Candida albicans, Chlamydia trachomatis and cytomegalovirus) were detected and recorded as negative references N1-N14.
[0194] According to the method described in Example 2, a real-time fluorescence quantitative PCR reaction system was prepared, wherein the template consisted of 30 μL each of the above-mentioned positive reference samples P1-P14 and negative reference samples N1-N14, and the total volume of each PCR reaction solution was 50 μL.
[0195] (2) Perform real-time fluorescence quantitative PCR amplification and result reading and analysis according to the method described in Example 2.
[0196] 2. Experimental Results
[0197] The accuracy test results of the kit of Example 2 of the present invention are shown in Table 10.
[0198] Table 10. Accuracy test results of the reagent kit
[0199]
[0200] As shown in Table 10, the detection accuracy of the kit of the present invention is 100%, indicating that the kit of Example 2 of the present invention has high accuracy, meets the detection requirements, and can be used for the identification of HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66 and HPV68, as well as the determination of HPV16 and HPV18 types.
[0201] Example 5: Application of the reagent kit
[0202] 1. Experimental Methods
[0203] (1) 200 clinical samples (human cervical exfoliated cell samples) confirmed by sequencing were tested using the kit of Example 2 of the present invention. Among them, 171 samples contained high-risk human papillomavirus DNA, 17 clinical samples contained low-risk human papillomavirus DNA (HPV6, HPV11, HPV26, HPV53, HPV73, HPV81 and HPV82), and 12 clinical samples did not contain human papillomavirus DNA.
[0204] Following the method described in Example 2, genomic DNA was extracted from 200 clinical samples to prepare a real-time quantitative PCR reaction system. The template consisted of 30 μL of genomic DNA from the 200 clinical samples, or 30 μL of negative control from the extraction kit, or 30 μL of positive control from the extraction kit. The total volume of each PCR reaction solution was 50 μL.
[0205] (2) Perform real-time fluorescence quantitative PCR amplification and result reading and analysis according to the method described in Example 2.
[0206] 2. Experimental Results
[0207] The kit of Example 2 of this invention was used to test 200 clinical samples that had been confirmed by sequencing. The results are shown in Table 11.
[0208] Table 11 Results of the kit testing 200 sequencing-confirmed clinical samples
[0209]
[0210]
[0211]
[0212]
[0213]
[0214] As shown in Table 11, 46 samples were diagnosed with HPV16 infection via sequencing, while the remaining 154 samples were not infected with HPV16. Using the kit from Example 2 of this invention, the results showed that 46 samples were infected with HPV16 and 154 were not infected with HPV16, and the samples with the same sequencing diagnosis results corresponded one-to-one. Therefore, the concordance rate between the HPV16 detection results and the sequencing diagnosis results of the kit from Example 2 of this invention is 100%.
[0215] Of the 11 samples identified by sequencing, 11 were found to be infected with HPV18, while the remaining 189 samples were not. Using the kit from Example 2 of this invention, the results showed that 11 samples were infected with HPV18, and the remaining 189 samples were not. Therefore, the concordance rate between the HPV18 detection results from the kit in Example 2 of this invention and the sequencing diagnosis results was 100%.
[0216] Of the 133 samples diagnosed by sequencing as infected with at least one of the remaining 12 HPV types, the other 67 samples were not infected with the remaining 12 HPV types. Using the kit from Example 2 of this invention, the 133 samples were found to be infected with at least one of the remaining 12 HPV types, and the 67 samples were found to be uninfected with the remaining 12 HPV types. Furthermore, the samples from these 67 samples corresponded one-to-one with the samples diagnosed by sequencing. Therefore, the concordance rate between the results of the kit from Example 2 of this invention for detecting the remaining 12 HPV types and the sequencing diagnosis results is 100%.
[0217] The kit of Example 2 of this invention was used to test 17 clinical samples with low-risk human papillomavirus DNA positivity and 12 clinical samples without human papillomavirus DNA. The test results showed no Ct values, and the samples were matched one-to-one with the samples with the same sequencing diagnosis results. The concordance rate with the sequencing diagnosis results was 100%, indicating that the kit of Example 2 of this invention has high specificity and does not produce false positive results.
[0218] The above results indicate that the kit of Example 2 of the present invention has high specificity and can specifically detect 14 high-risk HPV types, including HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66 and HPV68, which can meet the needs of clinical testing.
[0219] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. The application of a primer and probe composition in the preparation of a kit for detecting HPV, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO: 15-42; the nucleotide sequences of the probes are shown in SEQ ID NO: 1-14.
2. The application according to claim 1, characterized in that, The composition comprises groups A to C, with different fluorescent reporter groups at the 5' end and fluorescent quencher groups at the 3' end of the probes in each group; The fluorescent reporter group is any one of Texas Red, VIC, or FAM; the fluorescent quencher group is any one of BHQ1, BHQ2, or DQ1. Group A contains a probe with a nucleotide sequence as shown in SEQ ID NO: 1 and primers with nucleotide sequences as shown in SEQ ID NO: 15-16; Group B contains a probe with a nucleotide sequence as shown in SEQ ID NO: 2 and primers with nucleotide sequences as shown in SEQ ID NO: 17-18; Group C contains probes with nucleotide sequences as shown in SEQ ID NO: 3-14 and primers with nucleotide sequences as shown in SEQ ID NO: 19-42.
3. The application according to claim 2, characterized in that, Group A has a fluorescent reporter group TexasRed at its 5' end; Group B has a fluorescent reporter group VIC at its 5' end; and Group C has a fluorescent reporter group FAM at its 5' end.
4. The application according to claim 2, characterized in that, Group A has a fluorescence quenching group BHQ2 at its 3' end; Group B has a fluorescence quenching group BHQ1 at its 3' end; and Group C has a fluorescence quenching group BHQ1 at its 3' end.
5. A kit for detecting HPV, characterized in that, A composition comprising the primer and probe as described in any one of claims 1 to 4.
6. The reagent kit according to claim 5, characterized in that, The composition is the composition described in claim 2.
7. The reagent kit according to claim 6, characterized in that, In the composition, the final concentration of probes in groups A to C is 0.10 μM to 0.42 μM, and the final concentration of primers in groups A to C is 0.08 μM to 0.62 μM.
8. The reagent kit according to claim 5, characterized in that, The kit also includes a positive control, which is a pseudovirus whose genome contains nucleotide sequences as shown in SEQ ID NO: 46, SEQ ID NO: 47 and SEQ ID NO: 54.
Citation Information
Patent Citations
Primer combination, probe combination and human papilloma virus nucleic acid detection kit
CN112575123A