A cell membrane bionic nanovesicle expressing transferrin and its preparation method and application

Abstract

The present invention discloses a cell membrane bionic nanovesicle (TF NVs) expressing transferrin, and a preparation method and application thereof. The TF NVs are composed of biological cell membranes, and transferrin is expressed on the cell membrane surface; and further, derived TF NVs are prepared, including iron-loaded nanovesicles, drug-loaded nanovesicles, and iron-loaded and drug-loaded nanovesicles. The present invention shows that the above-mentioned nanovesicles can bind to the transferrin receptor TFRC in tumor cells to target tumor cells, thereby realizing tumor-targeted delivery of nanovesicles. At the same time, it can significantly inhibit tumor cell proliferation and induce tumor cell ferroptosis; in the in vivo physiological environment, it can inhibit tumor growth and proliferation in mice, and promote the accumulation of iron ions in the tumor site, and achieve the treatment of tumors by inducing tumor cell ferroptosis, which can be used as a new drug delivery tool or drug preparation, and also provides a new idea for cancer treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and more specifically, to a cell membrane bionic nanovesicle expressing transferrin, and a preparation method and application thereof. Background Art

[0002] Traditional cancer treatments include chemotherapy, radiotherapy, and surgery, which are effective but have serious side effects. In addition, the survival benefits of chemotherapy and radiotherapy are insufficient, and surgery is ineffective for metastatic tumors. Therefore, it is very necessary to develop more effective and less toxic treatments. Compared with traditional therapies, cancer immunotherapy treats cancer by activating the immune response of the immune system. The method of enhancing the immune system to fight cancer was first proposed by Dr. William Coley in the late 19th century. In addition, he was also the first to propose that intratumoral injection of microbial toxins induce anticancer effects. Since then, research on cancer immunotherapy has flourished and achieved good clinical results, such as tumor vaccines, immune checkpoint blockade, and chimeric antigen receptor T cell (CAR-T) therapy. At present, immunotherapy has achieved good results in the treatment of various malignant tumors and plays an important role in the field of cancer treatment. However, due to the obvious complexity and uncertainty of immunotherapy, inducing overactivity of the immune system may lead to serious adverse reactions. Therefore, it is of great significance to develop new treatments to overcome adverse events caused by immunotherapy.

[0003] Cell death is an inevitable process for the renewal of life. There are many ways of cell death, such as programmed cell death (autophagy), apoptosis, necrosis, etc. With the continuous deepening of scientific research, new ways of cell death have also surfaced. In 2012, a new way of cell death, ferroptosis, was proposed by Dixon et al. Ferroptosis is an oxidative death method that depends on iron ions. It is mainly manifested by excessive oxidative stress and membrane lipid peroxidation, which eventually leads to plasma membrane rupture and cell death. With the continuous deepening of research, the regulatory mechanism of ferroptosis is constantly enriched, but the two classic molecular mechanisms are still the activity blocking of glutathione peroxidase 4 (GPX4). The first is to inhibit the synthesis of GPX4 by inhibiting System Xc- (cystine / glutamate membrane reverse transport channel); the other is to directly use drugs to degrade or block the activity of GPX4. The final result of these two mechanisms is the accumulation of lipid peroxide ROS on the membrane, which produces cytotoxicity and destroys the integrity of the membrane, leading to cell death. However, in recent years, with the continuous deepening of a large number of studies, researchers have also discovered some molecular mechanisms that are not dependent on the GPX4 pathway, such as the ferroptosis-suppressor-protein 1 (FSP1) pathway, the Keap1-Nrf2-ARE signaling pathway, the p53 regulatory mechanism, the PUFAs (polyunsaturated fatty acids) transport pathway, the glutamine transport pathway, the transferrin transport pathway, and so on.

[0004] Transferrin receptor (TFRC, CD71) is a type II transmembrane glycoprotein expressed on the surface of rapidly proliferating cells. It is composed of two identical subunits (95KD) connected by disulfide bonds and is one of the important factors in the body's iron metabolism, immune function and cell regulation. Many studies have shown that TFRC is overexpressed in a variety of tumor cells (including lung cancer, liver cancer, breast cancer, pancreatic cancer, etc.), and the expression level of TFRC is positively correlated with tumor grade and stage. Moreover, TFRC is expressed higher in HCC tissues than in normal tissues, which is associated with a poorer survival rate and can indicate the clinical prognosis of HCC. There are three main reasons for the overexpression of TFRC in tumor cells: 1) Iron is an important element for cell proliferation and energy metabolism, and TFRC is an important protein component necessary for cell iron metabolism. Tumor cells highly express TFRC, which can meet the large demand for iron in tumor cell growth and proliferation; 2) TFRC participates in regulating the NF-κB signaling pathway of cancer cells, breaking the balance between cell proliferation and apoptosis and inhibiting cell apoptosis, thereby improving the survival rate of tumor cells; 3) TFRC promotes mitochondrial respiration, increases ROS production, induces DNA loss and causes mutations, and promotes the occurrence and metastasis of tumors. Therefore, TFRC is considered to be an effective tumor marker that can effectively target tumor cells and improve the effect of tumor treatment.

[0005] At the same time, TFRC is also a cell ferroptosis-related iron uptake receptor, which is necessary for the cell to uptake transferrin complexes. Studies have shown that TFRC gene silencing can inhibit ferroptosis caused by Erastin or other inducers. On the contrary, adding iron-bound transferrin or bioavailable iron (such as ammonium ferric citrate) to the growth medium without adding other divalent metals will accelerate Erastin-induced ferroptosis. Therefore, inducing ferroptosis by targeting tumor cells with TFRC will be a new strategy for tumor treatment with great development potential. However, there is currently a lack of related drug delivery carriers and drug preparations that can induce ferroptosis by binding to TFRC targeting tumor cells. Summary of the invention

[0006] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide a cell membrane bionic nanovesicle expressing transferrin.

[0007] The second object of the present invention is to provide a method for preparing the cell membrane bionic nanovesicles expressing transferrin.

[0008] The third object of the present invention is to provide an iron-loaded nanovesicle.

[0009] The fourth object of the present invention is to provide the use of the cell membrane bionic nanovesicles expressing transferrin or the iron-loaded nanovesicles as drug carriers in the preparation of tumor therapeutic drugs.

[0010] The fifth object of the present invention is to provide a tumor targeting drug preparation.

[0011] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0012] The invention discloses a cell membrane bionic nanovesicle (TF NVs) with a genetically modified membrane surface highly expressing transferrin, which is composed of a biological cell membrane and expresses transferrin on the cell membrane surface.

[0013] In recent years, extracellular vesicle drug delivery has been proposed as one of the strategies for cell-free therapy, and has attracted increasing attention for its ability to improve the safety and efficacy of immunotherapy. Extracellular vesicles are heterogeneous membrane vesicles produced by living cells and are natural carriers of intercellular information and substances. Extracellular vesicles are widely present in blood, urine, saliva, cerebrospinal fluid, pleural fluid and breast milk, and can be divided into exosomes, microvesicles and apoptotic bodies according to the different ways of production. At the same time, as a natural carrier, extracellular vesicles have been widely studied in the field of drug delivery. Unlike other drug-loaded nanomaterials, extracellular vesicles can directly deliver drug-loaded substances to the cytoplasm, with the advantages of good biocompatibility and low immunogenicity. Extracellular vesicles also show the potential to cross physiological barriers and homologous targeting. In addition, extracellular vesicles also have a wide range of biological regulatory functions, such as immunomodulation, signal transduction, etc. Because of the above advantages, the use of extracellular vesicles is expected to develop safer and cell-free immunotherapy strategies.

[0014] The present application provides a nanovesicle (TFNVs) with high expression of transferrin on the membrane surface through genetic engineering modification. The TF NVs can target and bind to TFRC in tumor cells, induce ferroptosis in tumor cells, inhibit tumor growth, and can efficiently load iron and drugs without biosafety issues. It can be used as a new tumor-targeted drug delivery tool, and also provides a new idea for cancer treatment, with great application prospects.

[0015] Preferably, the biological cell membrane is derived from HEK-293T cell line.

[0016] Preferably, the particle size of the cell membrane bionic nanovesicles is 100-200 nm.

[0017] Further preferably, the particle size of the cell membrane bionic nanovesicles is 120-160 nm.

[0018] More preferably, the particle size of the cell membrane bionic nanovesicles is 150-160 nm.

[0019] Preferably, the electric potential of the cell membrane bionic nanovesicle is -37mv to -39mV.

[0020] Further preferably, the electric potential of the cell membrane bionic nanovesicle is -38 mV.

[0021] The method for preparing the cell membrane bionic nanovesicles expressing transferrin of the present invention comprises the following steps:

[0022] S1. Insert a transmembrane protein gene sequence at the N-terminus of the secretory transferrin (TF) gene sequence, add a green fluorescent tag (GFP) tag, and construct a cell line that stably overexpresses transferrin on the membrane by lentiviral infection;

[0023] S2. Extract the cell membrane of the cell line that stably overexpresses transferrin on the membrane in step S1, and prepare cell membrane biomimetic nanovesicles expressing transferrin by extrusion vesicle method.

[0024] Preferably, step S1 is to insert a transmembrane protein gene sequence (FIBCD1) at the N-terminus of the secretory TF protein gene sequence (NM_001063.4), use the pLV-puro-GFPSpark vector to make the TF protein carry a green fluorescent (GFP) label, construct the pLV-puro-FIBCD1-TF-GFPSpark vector, and then infect HEK-293T cells with lentivirus to successfully construct HEK-293T cells that stably overexpress TF on the membrane.

[0025] Preferably, step S2 is to lyse HEK-293T cells overexpressing TF protein, centrifuge at 4°C, 5000r for 10 min, discard the unlysed cell precipitate, take the supernatant and centrifuge it at 12000r for 10 min, remove the supernatant, wash the membrane precipitate and squeeze it out to obtain cell membrane bionic nanovesicles expressing transferrin.

[0026] Preferably, the extrusion bubbling is performed by first performing preliminary extrusion using a 0.4-0.5 μm filter membrane, and then further extruding using a 0.2-0.25 μm filter membrane and sterilizing and packaging, so as to prepare TF-GFP NVs.

[0027] More preferably, the extrusion bubbling is performed by first performing preliminary extrusion using a 0.45 μm filter membrane, and then further extruding using a 0.22 μm filter membrane and sterilizing and packaging, so as to prepare TF-GFP NVs.

[0028] The present invention also provides an iron-loaded nanovesicle (TF-Fe 3+ NVs), comprising any of the above-mentioned cell membrane bionic nanovesicles expressing transferrin and Fe 3+ The TF-Fe 3+NVs can significantly inhibit the proliferation and growth of tumor cells, and can significantly induce the expression of ACSL4, an indicator molecule of tumor cell ferroptosis, the accumulation of LIP, and the generation of ROS, thereby promoting the accumulation of iron ions in the tumor site and inducing ferroptosis of tumor cells.

[0029] The TF-Fe 3+ The preparation method of NVs is to combine TF NVs with Fe 3+ The iron-loaded nanovesicles TF-Fe were prepared by incubating at 36-38°C for 25-35 min. 3+ NVs.

[0030] The present invention also provides the use of any of the above-mentioned cell membrane bionic nanovesicles expressing transferrin or iron-loaded nanovesicles as a drug carrier in the preparation of tumor therapeutic drugs.

[0031] The present invention also provides a tumor-targeted drug preparation, comprising any of the above-mentioned transferrin-expressing cell membrane biomimetic nanovesicles (TF NVs) or iron-loaded nanovesicles (TF-Fe 3+ NVs) as drug carriers and anti-tumor drugs encapsulated in nanovesicles. That is, drug-loaded nanovesicles (drug@TF NVs) or iron-loaded and drug-loaded nanovesicles (drug@TF-Fe 3+ NVs). The nanovesicles in the drug preparation simultaneously serve as drug carriers targeting tumors and have the ability to induce ferroptosis of tumor cells, thereby exerting an anti-tumor effect.

[0032] The preparation method of the drug-loaded nanovesicles (drug@TF NVs) is to co-incubate TF NVs with anti-tumor drugs and achieve drug encapsulation through electroporation, thereby preparing drug-loaded nanovesicles.

[0033] The iron-loaded and drug-loaded nanovesicle (drug@TF-Fe 3+ The preparation method of NVs is to combine drug-loaded nanovesicles (drug@TF NVs) with Fe 3+ The iron-loaded and drug-loaded nanovesicles (drug@TF-Fe 3+ NVs).

[0034] Preferably, the tumor therapeutic drug is a tumor therapeutic drug that can induce ferroptosis in tumor cells. The function of inducing ferroptosis of tumor cells possessed by the nanovesicles can be used in conjunction with other tumor therapeutic drugs that can induce ferroptosis of tumor cells to synergistically perform anti-tumor activities.

[0035] More preferably, the tumor therapeutic drug is sorafenib (SOR).

[0036] Preferably, the tumor is liver cancer.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The present invention provides a cell membrane bionic nanovesicle expressing transferrin and a series of derivatized transferrin nanovesicles, including iron-loaded nanovesicles, drug-loaded nanovesicles, and iron-loaded and drug-loaded co-administered nanovesicles; the present invention shows that the above-mentioned nanovesicles can target tumor cells in combination with transferrin receptor TFRC in tumor cells, thereby realizing tumor-targeted delivery of nanovesicles; at the same time, it can significantly inhibit tumor cell proliferation and induce tumor cell ferroptosis; in the physiological environment in vivo, it can inhibit tumor growth and proliferation in mice, and promote the accumulation of iron ions in the tumor site, and also have good therapeutic effects in the in situ tumor mouse model. The above-mentioned nanovesicles of the present invention can achieve the treatment of tumors by inducing tumor cell ferroptosis, which can be used as a new drug delivery tool or pharmaceutical preparation, and also provide a new idea for cancer treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Preparation and characterization of TF NVs. A: Preparation process of TF NVs. B: qPCR was used to detect the TF mRNA levels in 293T cells (NC) and 293T-TF-GFP cells. C: The expression of green fluorescent tag (GFP) was observed under a laser confocal microscope, scale: 5μm, proving that TF-GFP was successfully expressed on the membrane. D: The morphology of nanovesicles was observed using TEM, scale: 200nm. E: The particle size distribution of TF nanovesicles was analyzed using DLS, which was mainly distributed in 120-160nm. F: The Zeta potential distribution of TFNVs was analyzed using PALS, which was stably maintained at -38mV, indicating that the membrane structure was stable. G: The morphology of TF-GFP NVs with green fluorescent tags was observed under a laser confocal microscope, scale: 2μm. H: WB was used to analyze the expression of GFP protein tag in 293T NVs, 293T cell lysate, 293T-GFP NVs, 293T-GFP cell lysate, 293T-TF-GFP NVs, and 293T-TF-GFP cell lysate, with Na+K+ATPase membrane protein as the quantitative internal reference, WCL: whole cell lysate.

[0040] Figure 2The biological targeting function of TF NVs in vivo. A: qPCR was used to detect the TFRC mRNA level in 293T cells (NC) and 293T-TFRC-OFP cells. B: WB was used to analyze the expression of OFP protein tags in 293T cell lysate, 293T-OFP cell lysate, and 293T-TFRC-OFP cell lysate. WCL: whole cell lysate. It proves that the receptor TFRC overexpression cell line was successfully constructed. C: Laser confocal microscopy was used to observe the co-localization of green nanovesicles and red TFRC receptors and their internalization into cells. Scale bar: 5μm. D: Flow cytometry was used to detect the internalization of TF NVs at 0 and 6h. E: The distribution of Cy5.5-labeled TF NVs and 293T NVs in mice was detected using an in vivo imager. It can be seen that TF NVs can be significantly enriched in the liver and liver cancer tumors.

[0041] Figure 3 To expand the application of TF NVs (drug targeted delivery). 3+ TF-Fe 3+ NVs, TF NVs and sorafenib (SOR) were co-incubated and electroporated to prepare SOR@TF-Fe 3+ NVs. B: TF-Fe 3+ The amount of iron ions bound by NVs. C: SOR@TF-Fe 3+ NVs can encapsulate 33% of sorafenib. D: Analysis of TF NVs and TF-Fe by DLS 3+ NVs, SOR@TF-Fe 3+ The particle size distribution of NVs is mainly around 160nm. E: PALS analysis of TF NVs and TF-Fe 3+ NVs, SOR@TF-Fe 3+ The Zeta potential distribution of NVs is stable at -38mV, indicating that the membrane structure is stable. F: Green drug-loaded nanovesicles co-localize with red TFRC receptors and are internalized into cells using laser confocal microscopy, scale: 5μm. G: TF-Fe 3+ NVs endocytosis at 0, 6, 12, and 24 hours. H: Hepatocellular carcinoma cell clone formation experiment. The right side shows the quantitative analysis of the number of clones in each treatment group. HegG2-SR: HepG2 sorafenib-resistance cells; TF-Fe 3+ NVs, SOR@TF-Fe 3+ NVs can significantly inhibit the proliferation and growth of tumor cells.

[0042] Figure 4 TF NVs induced ferroptosis of tumor cells in vitro. A: SOR@TF-Fe 3+ NVs can rely on the targeted delivery function of TF to deliver Fe 3+ , SOR is delivered to tumor cells to induce ferroptosis in tumor cells. B: qPCR analysis of the expression of ACSL4, an indicator of ferroptosis, ACSL4: Long-chain-fatty-acid-CoA ligase 4. C: Flow cytometry detection of the level of labile iron pool in liver cancer cell lines and drug-resistant cell lines; LIP: Labile iron pool, a characteristic indicator of ferroptosis. D: Flow cytometry detection of the level of reactive oxygen species ROS in liver cancer cell lines and drug-resistant cell lines; ROS: Reactive Oxygen Species, labeled by DCFH-DA, a characteristic indicator of ferroptosis. E: SOR@TF-Fe 3+ Ferrostatin-1 (Fer-1), a necrosis inhibitor Decrostatin-1 (Dec), and apoptosis inhibitor Z-VAD-FMK (Z-VAD) were added to detect the clone formation of liver cancer cells under NVs treatment. The right side is the quantitative analysis of the number of clones in each treatment group; this shows that ferroptosis inhibitors can rescue SOR@TF-Fe 3+ NVs-induced tumor cell growth inhibition indicates that SOR@TF-Fe 3+ NVs indeed induce ferroptosis.

[0043] Figure 5 TF NVs inhibit tumor proliferation in vivo. A: Construction of subcutaneous mouse model of liver cancer and schematic diagram of drug administration. B: Changes in subcutaneous tumor volume. C: Analysis of mouse survival rate. D: Tumor tissues of each treatment group were removed for hematoxylin and eosin staining (H&E), Ki67 immunohistochemistry analysis, and Prussian blue staining analysis. 3+ NVs, SOR@TF-Fe 3+ NVs can significantly inhibit the proliferation of tumor cells and promote the accumulation of iron ions in the tumor site (Prussian blue staining), scale: 100μm. E: qPCR analysis of the expression of ACSL4, an indicator of iron death in tumor tissue. F: Schematic diagram of the construction of an in situ liver cancer mouse model and the dosing regimen. G: The liver of the in situ liver cancer mouse was removed to observe the infiltration and regression of the tumor tissue, and the weight of the liver in each group was recorded. H: The heart, liver, spleen, lung, and kidney of the mice in each treatment group were removed for H&E staining to observe the effect of the vesicles on normal organs, and no obvious tissue damage was found. Scale: 100μm. I: Complete blood cell count (CBC) was used to detect the expression of whole blood cells after administration.

[0044] Figure 6 This is an overview of the preparation and application of TF NVs of the present invention. DETAILED DESCRIPTION

[0045] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0046] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0047] Example 1 Preparation of Cell Membrane Nanovesicles (TF NVs) Highly Expressing Transferrin

[0048] (1) First, we clarified that nanovesicles are mainly derived from cell membranes and mainly play a targeting function by presenting membrane proteins. In order to achieve the membrane expression of transferrin (TF), Figure 1 As shown in A, we inserted a transmembrane protein gene sequence (FIBCD1) at the N-terminus of the secretory TF protein gene sequence (NM_001063.4), and used the pLV-puro-GFPSpark vector to label the TF protein with a green fluorescent (GFP) tag to construct pLV-puro-FIBCD1-TF-GFPSpark. We successfully constructed HEK-293T cells (293T-TF-GFP) that stably overexpressed TF on the membrane through lentiviral infection, and observed 100% green fluorescence expression rate under a fluorescence microscope.

[0049] The TF protein gene sequence is:

[0050] ATGAGGCTCGCCGTGGGAGCCCTGCTGGTCTGCGCCGTCCTGGGGCTGTGTCTGGCTGTCCCTGATAAAACTGTGAGATGGTGTGCAGTGTCGGAGCATGAGGCCACTAAGTGCCAGAGTTTCCGCGACCATATGAAAAGCGTCATTCCATCCGATGGTCCCAGTGTTGCTTGTGTGAAGAAAGCCTCCTACCTTGATTGCATCAGGGCCATTGCGGCAAACGAAGCGGATGCTGTGACACTGGATGCAGGTTTGGTGTATGATGCTTACCTGGCTCCCAATAACCTGAAGCCTGTGGTGGCAGAGTTCTATGGGTCAAAAGAGGATCCACAGACTTTCTATTATGCTGTTGCTGTGGTGAAGAAGGATAGTGGCTTCCAGATGAACCAGCTTCGAGGCAAGAAGTCCTGCCACACGGGTCTAGGCAGGTCCGCTGGGTGGAACATCCCCATAGGC

[0051] TTACTTTACTGTGACTTACCTGAGCCACGTAAACCTCTTGAGAAAGCAGTG

[0052] GCCAATTTCTTCTCGGGCAGCTGTGCCCCTTGTGCGGATGGGACGGACTTC

[0053] CCCCAGCTGTGTCAACTGTGTCCAGGGTGTGGCTGCTCCACCCTTAACCAA

[0054] TACTTCGGCTACTCGGGAGCCTTCAAGTGTCTGAAGGATGGTGCTGGGGAT

[0055] GTGGCCTTTGTCAAGCACTCGACTATATTTGAGAACTTGGCAAACAAGGCT

[0056] GACAGGGACCAGTATGAGCTGCTTTGCCTGGACAACACCCGGAAGCCGGT

[0057] AGATGAATACAAGGACTGCCACTTGGCCCAGGTCCCTTCTCATACCGTCGT

[0058] GGCCCGAAGTATGGGCGGCAAGGAGGACTTGATCTGGGAGCTTCTCAACC

[0059] AGGCCCAGGAACATTTTGGCAAAGACAAATCAAAAGAATTCCAACTATTCA

[0060] GCTCTCCTCATGGGAAGGACCTGCTGTTTAAGGACTCTGCCCACGGGTTTT

[0061] TAAAAGTCCCCCCCAGGATGGATGCCAAGATGTACCTGGGCTATGAGTATG

[0062] TCACTGCCATCCGGAATCTACGGGAAGGCACATGCCCAGAAGCCCCAACA

[0063] GATGAATGCAAGCCTGTGAAGTGGTGTGCGCTGAGCCACCACGAGAGGCT

[0064] CAAGTGTGATGAGTGGAGTGTTAACAGTGTAGGGAAAATAGAGTGTGTATC

[0065] AGCAGAGACCACCGAAGACTGCATCGCCAAGATCATGAATGGAGAAGCTG

[0066] ATGCCATGAGCTTGGATGGAGGGTTTGTCTACATAGCGGGCAAGTGTGGTC

[0067] TGGTGCCTGTCTTGGCAGAAAACTACAATAAGAGCGATAATTGTGAGGATA

[0068] CACCAGAGGCAGGGTATTTTGCTATAGCAGTGGTGAAGAAATCAGCTTCTG

[0069] ACCTCACCTGGGACAATCTGAAAGGCAAGAAGTCCTGCCATACGGCAGTT

[0070] GGCAGAACCGCTGGCTGGAACATCCCCATGGGCCTGCTCTACAATAAGATC

[0071] AACCACTGCAGATTTGATGAATTTTTCAGTGAAGGTTGTGCCCCTGGGTCT

[0072] AAGAAAGACTCCAGTCTCTGTAAGCTGTGTATGGGCTCAGGCCTAAACCTG

[0073] TGTGAACCCAACAACAAAGAGGGATACTACGGCTACACAGGCGCTTTCAG

[0074] GTGTCTGGTTGAGAAGGGAGATGTGGCCTTTGTGAAACACCAGACTGTCC

[0075] CACAGAACACTGGGGGAAAAAACCCTGATCCATGGGCTAAGAATCTGAAT

[0076] GAAAAAGACTATGAGTTGCTGTGCCTTGATGGTACCAGGAAACCTGTGGA

[0077] GGAGTATGCGAACTGCCACCTGGCCAGAGCCCCGAATCACGCTGTGGTCA

[0078] CACGGAAAGATAAGGAAGCTTGCGTCCACAAGATATTACGTCAACAGCAG

[0079] CACCTATTTGGAAGCAACGTAACTGACTGCTCGGGCAACTTTTGTTTGTTC

[0080] CGGTCGGAAACCAAGGACCTTCTGTTCAGAGATGACACAGTATGTTTGGCC

[0081] AAACTTCATGACAGAAACACATATGAAAAATACTTAGGAGAAGAATATGTC

[0082] AAGGCTGTTGGTAACCTGAGAAAATGCTCCACCTCATCACTCCTGGAAGCC

[0083] TGCACTTTCCGTAGACCTTAA;

[0084] The FIBCD1 sequence is:

[0085] ATGGTCCCACGAGCGGTGGAAGACCGTGGGCAGCGCGTCCCAACTTGAGGACCGACCGCGCGACAAACCGCAGCGAGCAAGCTGCAGTTATGTCCTGTGCACGGTGCTCCTGTCCCTTGCGGTGCTGCTGGCGGTGGCTGTCACCGGTGTGGTTCTC.

[0086] (2) We extracted RNA from HEK-293T cells that stably overexpressed TF protein and performed qPCR analysis. The results showed that the level of TF mRNA in overexpressed cells was 70,000 times that of normal HEK 293T cells ( Figure 1 B). At the same time, confocal microscopy confirmed that the green fluorescent TF protein was indeed expressed on the membrane, rather than diffused in the cytoplasm like ordinary GFP tags ( Figure 1 C).

[0087] (3) HEK-293T cells overexpressing TF protein (293T-TF-GFP) were collected in HM lysis buffer and added to a pestle and grinder. After grinding on ice for 200 times, the cell lysate was taken out for gradient centrifugation. First, centrifugation was performed at 4°C, 5000r for 10 min, and the unlysed cell pellet was discarded. The supernatant was taken and centrifuged at 12000r for 10 min. The supernatant was removed, and the membrane pellet was washed with PBS and squeezed out. First, it was initially squeezed with a 0.45μm filter membrane, and then further squeezed with a 0.22μm filter membrane and sterilized and packaged. In this way, TF-GFP NVs (hereinafter referred to as TF NVs, Figure 1 A).

[0088] We further tested the characterization of TF NVs to confirm the correctness of the nanovesicles we prepared. We used transmission electron microscopy (TEM) to observe the morphology of the nanovesicles and found that most of the nanovesicle particles were microspheres wrapped by a bilayer membrane, with a particle diameter of 100-200nm, showing a typical cell membrane vesicle morphology ( Figure 1 D), which fully confirmed that the membrane structure particles we prepared were indeed nanovesicles. At the same time, we used dynamic light scattering (DLS) to analyze the particle size distribution range of nanovesicles. From the particle size distribution diagram ( Figure 1 E) we can see that the particle size of TF NVs is mainly distributed around 150nm. Moreover, from the Zeta potential diagram ( Figure 1 F) we can keep the potential of TF NVs at around -38mV, indicating that the membrane structure of TF NVs is relatively stable. At the same time, we observed under a confocal microscope that TF NVs indeed carry green fluorescence and are distributed in a dot-like manner ( Figure 1 G). In addition, to prove that the TF NVs we constructed did express TF protein, we analyzed the expression of GFP protein tag in the protein lysate of 293T cells, 293T nanovesicles, 293T-GFP cells, 293T-GFP nanovesicles, 293T-TF-GFP cells, and 293T-TF-GFP nanovesicles by Western blot. Figure 1 In Figure 3, we can see that when the membrane content is constant, the TF nanovesicles do contain TF-GFP protein (116 kDa), and the content is not much different from that of the cell lysate, indicating that the membrane yield of TF NVs is excellent and the yield is relatively high. The above data confirm that we have successfully prepared nanovesicles with high expression of TF protein, which can be used for further research in subsequent experiments.

[0089] Example 2 TF NVs biological targeting test

[0090] To confirm that TF-NVs have good biological targeting properties, we first constructed a stable cell line (293T-TFRC-OFP) that overexpressed transferrin receptor (TFRC) by lentiviral infection. We extracted RNA from 293T cells (NC) and 293T-TFRC-OFP cells for qPCR detection. The results showed that the level of TFRC mRNA in 293T-TFRC-OFP cells was 200 times that of normal HEK 293T cells ( Figure 2 A), at the same time, we used WB to analyze the expression of OFP protein tags in 293T cell lysate, 293T-OFP cell lysate, and 293T-TFRC-OFP cell lysate. The results showed that OFP protein was highly expressed in 293T-TFRC-OFP cell lysate ( Figure 2 B), indicating that the stable cell line overexpressing transferrin receptor TFRC was successfully constructed. Next, in order to explore whether TF NVs would bind to the TFRC receptor, we used laser confocal microscopy to observe and found that when TF NVs were co-incubated with 293T-TFRC-OFP cells, the green-fluorescent TF NVs nanovesicles and the red-fluorescent TFRC receptors were clearly co-localized ( Figure 2C). Subsequently, we used flow cytometry to detect the endocytosis of TF NVs in human liver cancer cells HepG2 cells with overexpression, knockdown and normal expression of TFRC receptor. The results showed that the endocytosis rate of TF NVs in HepG2 cells with overexpression of TFRC reached 88% at 6 hours, while that in normal HepG2 cells was 55%, both much higher than the 43% in HepG2 cells with knockdown of TFRC expression, indicating that the higher the expression of TFRC, the higher the targeting rate of TF NVs ( Figure 2 D) To further verify that TF NVs can also play a targeting role in vivo, we established a nude mouse subcutaneous liver cancer transplant model and injected TF NVs labeled with Cyanine5.5 NHS ester into the mice via the tail vein. After 1 hour, the mice were killed and various organs and tissues were removed. The in vivo distribution of TF NVs was then observed using a mouse imaging device. Figure 2 In E, we can see that compared with the control 293T NVs, TF NVs are significantly accumulated in tumor tissues where TFRC is generally highly expressed, indicating that nanovesicles expressing TF on the surface of genetically modified membranes are more capable of achieving targeted delivery of nanovesicles than empty nanovesicles.

[0091] Example 3 Preparation and application of derivatized TF NVs

[0092] In order to verify the application prospect of TF NVs in drug targeted delivery, we prepared several derivatized TF NVs ( Figure 3 A), ①TF NVs and Fe 3+ The iron-loaded nanovesicles TF-Fe were prepared by incubation at 37 °C for 30 min. 3+ NVs; ②TFNVs were co-incubated with sorafenib (SOR), a first-line drug for liver cancer treatment, and drug loading was achieved through electroporation to prepare drug-loaded nanovesicles SOR@TF NVs; ③Drug-loaded nanovesicles SOR@TF NVs and Fe 3+ The combined drug delivery nanovesicles SOR@TF-Fe were prepared by incubation at 37°C for 30 min. 3+ First, we tested the iron loading rate of TF NVs. The results showed that the binding rate of TF NVs with iron ions can reach about 90% ( Figure 3 B). At the same time, we ultrasonically crushed the drug-loaded nanovesicles SOR@TF NVs, and after centrifugation, we took the drug supernatant and detected that the drug encapsulation efficiency was 35%, which is better than the drug encapsulation efficiency of other nanovesicles of 10%-25% ( Figure 3 C) To verify whether the derivatized TF NVs would affect the structure of the nanovesicles, we used DLS to analyze the TF NVs, TF-Fe 3+NVs, SOR@TF-Fe 3+ The particle size distribution of NVs was found to be mainly around 160 nm ( Figure 3 D), indicating that neither iron loading nor drug encapsulation will cause significant changes in the size of the vesicles. 3+ NVs, SOR@TF-Fe 3+ The Zeta potential of NVs was found to be stable at -38 mV, indicating that neither iron loading nor drug loading would destroy the stability of the membrane structure of the nanovesicles ( Figure 3 E). In order to explore whether the derived TF NVs would bind to the TFRC receptor, we used laser confocal microscopy to observe and found that when the derived TF NVs were co-incubated with 293T-TFRC-OFP cells for 1 hour, the green fluorescent derived TF NVs nanovesicles and the red fluorescent TFRC receptors were clearly co-localized on the cell membrane. After incubation for another 3 hours, the green fluorescent spots of TF-NVs and the red fluorescent spots of TFRC were co-localized in the cells, indicating that TF NVs can indeed bind to the TFRC receptor and be internalized by the receptor into the cell ( Figure 3 F). Subsequently, we used flow cytometry to detect the endocytosis of the derived TFNVs in human liver cancer cells HepG2 cells with TFRC receptor overexpression, knockdown expression, and normal expression, which was consistent with the results of TF NVs endocytosis ( Figure 2 D), the target binding rate of derived TF NVs was high at multiple time points ( Figure 3 G) Next, we used liver cancer cell clone formation experiments to verify TF NVs, TF-Fe 3+ NVs, SOR@TF-Fe 3+ The in vitro pharmacological activity of NVs showed that TF-Fe 3+ NVs and SOR@TF NVs can significantly inhibit the proliferation and growth of tumor cells, and the combined administration of vesicles SOR@TF-Fe 3+ NVs have a more potent effect ( Figure 3 H). At the same time, we found that SOR@TF-Fe 3+ NVs also showed excellent tumor inhibitory effects in the sorafenib-resistant cell line HepG2-SR (HepG2 sorafenib-resistant cells). Figure 3 H).

[0093] Example 4 Investigation of signaling pathways that may be affected by TF NVs in exerting tumor suppressive effects

[0094] In order to study the signaling pathways that TF NVs may affect in their tumor suppressive effects, we conducted a large number of literature surveys and found that transferrin can transport iron ions into cells through receptor endocytosis. Excessive iron ion accumulation will produce a large amount of reactive oxygen species (ROS) through the Fenton reaction, thereby inducing cell ferroptosis. In addition, sorafenib (SOR), a first-line drug for liver cancer, has also been shown to induce ferroptosis in tumor cells. In order to further verify that TFNVs exert tumor suppressive effects by inducing ferroptosis in tumor cells ( Figure 4 A), we used qPCR to analyze the expression of NVs in HCC cell lines and drug-resistant cell lines after treatment with different experimental groups (NC, 293T NVs, TF NVs, TF-Fe 3+ NVs, SOR, SOR@TF NVs, SOR@TF-Fe 3+ NVs) ferroptosis indicator molecule ACSL4 (Long-chain-fatty-acid-CoAligase 4) expression, the results showed that TF-Fe 3+ NVs and SOR@TF NVs could significantly induce the differential expression of ACSL4, and SOR@TF-Fe 3+ The expression level of ACSL4 mRNA was the highest in the NVs group ( Figure 4 B). We further detected the level of labile iron pool (LIP) in liver cancer cell lines and drug-resistant cell lines by flow cytometry. The results showed that TF-Fe 3+ NVs, SOR@TFNVs, SOR@TF-Fe 3+ NVs can lead to significant accumulation of LIP in tumor cells ( Figure 4 C). Excessive accumulation of LIP will lead to the generation of reactive oxygen species (ROS). We then detected the levels of reactive oxygen species (ROS) in liver cancer cell lines and drug-resistant cell lines. The results showed that the SOR@TF-Fe vesicle group combined with the administration of 3+ The expression level of ROS in the NVs group was generally higher than that in the vesicles alone group ( Figure 4 D). The above results all indicate that TF-Fe 3+ NVs, SOR@TF NVs, SOR@TF-Fe 3+ NVs can significantly induce the expression of ACSL4, an indicator of ferroptosis in tumor cells, the accumulation of LIP, and the generation of ROS. 3+NVs can induce ferroptosis of tumor cells. We added ferroptosis inhibitor Ferrostatin-1 (Fer-1), necrosis inhibitor Decrostatin-1 (Dec), and apoptosis inhibitor Z-VAD-FMK (Z-VAD) to each experimental group to detect the clone formation of liver cancer cells and drug-resistant cell lines. The results showed that only ferroptosis inhibitors could rescue SOR@TF-Fe 3+ NVs-induced tumor cell growth inhibition ( Figure 4 E), indicating that SOR@TF-Fe 3+ NVs indeed induce ferroptosis.

[0095] Example 5

[0096] To further study whether TF NVs can effectively inhibit tumor growth in the in vivo physiological environment, we constructed an in vivo mouse tumor model for further verification.

[0097] 6-8 week old SPF BALB / c-nu mice were purchased from the Animal Experiment Center of Sun Yat-sen University and raised in a sterile environment in the Animal Experiment Center of the East Campus of Sun Yat-sen University. First, the subcutaneous transplanted tumor (HepG2) model mice were randomly divided into 7 groups, 5 mice in each group, namely 293T NVs group, TF NVs group, Fe 3+ Group (3 mg / kg), TF-Fe 3+ NVs group, SOR group (5 mg / kg), SOR@TF NVs group, SOR@TF-Fe 3+ In the NVs group, the drug was administered on the 7th day of tumor growth, and the vesicle dosage was 25 mg / kg (protein weight). The drug was injected into the tail vein every other day, and the physical signs of the mice were observed daily. After the end of the drug administration on the 15th day, samples were taken for histopathology and molecular biology detection ( Figure 5 A).

[0098] Comparison of the changes in subcutaneous tumor volume in different groups showed that TF NVs, TF-Fe 3+ Both NVs and SOR@TF NVs can inhibit tumor growth, especially SOR@TF-Fe 3+ The tumor inhibition effect of NVs group was the most significant ( Figure 5 B) At the same time, by analyzing the data of the survival curve, it can be seen that TF-Fe 3+ NVs, SOR@TF NVs, SOR@TF-Fe 3+ NVs can significantly improve the survival rate of tumor mice ( Figure 5C). In addition, the results of hematoxylin and eosin staining (H&E), Ki67 immunohistochemistry, and Prussian blue staining of tumor tissues in each treatment group showed that TF NVs-derived nanovesicles could significantly inhibit the proliferation of tumor cells and promote the accumulation of iron ions in the tumor site ( Figure 5 D). At the same time, qPCR analysis was performed to analyze the expression of ACSL4, an indicator of ferroptosis in tumor tissues. The results showed that SOR@TF-Fe 3+ The expression level of ACSL4 mRNA in tumor tissues treated with NVs group was the highest ( Figure 5 E).

[0099] To further verify that TF NVs also has a certain therapeutic effect in the mouse orthotopic liver cancer model, we constructed an orthotopic liver cancer mouse model ( Figure 5 F), the model mice were randomly divided into 4 groups, 5 mice in each group, namely Free NVs (293T NVs) group, SOR group (5 mg / kg), SOR@TF-Fe 3+ NVs group and untreated NC group. The drug was administered on the 5th day of tumor growth, and the vesicle dosage was 25 mg / kg (protein weight). The drug was injected into the tail vein every other day, and the mice were observed daily. After the end of the drug administration on the 13th day, the livers of the mice with orthotopic liver cancer were removed to observe the infiltration and regression of the tumor tissue, and the weight of the livers of each group was recorded ( Figure 5 G) The results show that SOR@TF-Fe 3+ The degree of liver tumor infiltration in mice treated with NVs was significantly reduced, and there was tumor regression, and the liver swelling was the lightest. 3+ NVs also have good therapeutic effects in orthotopic tumor mouse models.

[0100] Finally, in the safety verification, we took out the hearts, livers, spleens, lungs, and kidneys of mice in each treatment group for H&E staining to observe the effects of the vesicles on normal organs. The section results showed that a series of derived nanovesicles such as TF NVs had no obvious tissue damage to the heart, liver, spleen, lungs, and kidneys of mice ( Figure 5 H). At the same time, by monitoring the blood routine of mice after administration, it was found that the control group and TF-Fe 3+ There was no significant difference in the levels of lymphocytes, monocytes, neutrophils, and eosinophils in the mice after administration of NVs. Figure 5 I), indicating that TF-Fe 3+ The NVs group had no effect on the blood system after administration. The above results indicate that a series of derivative nanovesicles such as TF NVs are safe for administration.

[0101] In summary, if Figure 6As shown, the present invention prepares cell membrane nanovesicles (TF NVs) with high expression of transferrin and a series of derivatized TF NVs, including iron-loaded nanovesicles TF-Fe 3+ NVs, drug-loaded nanovesicles SOR@TF NVs and combined drug delivery nanovesicles SOR@TF-Fe 3+ NVs. The present invention shows that TF NVs and derived TF NVs can bind to transferrin receptor TFRC in tumor cells to target tumor cells, thereby achieving tumor-targeted delivery of nanovesicles. Further studies have shown that TF-Fe 3+ NVs, SOR@TF NVs, SOR@TF-Fe 3+ NVs can significantly inhibit tumor cell proliferation and induce tumor cell ferroptosis; in the physiological environment in vivo, TF NVs, TF-Fe 3+ Both NVs and SOR@TF NVs can inhibit tumor growth and proliferation in mice and promote the accumulation of iron ions in the tumor site. 3+ NVs had the most significant tumor suppression effect, and SOR@TF-Fe 3+ NVs also have good therapeutic effects in orthotopic tumor mouse models. Therefore, TF NVs and a series of derivative TF NVs can be used as drug delivery carriers or drug preparations to target tumor cells by binding to TFRC to induce tumor cell ferroptosis, thereby achieving tumor treatment.

Claims

1. A tumor-targeted drug preparation, It is characterized in that The invention comprises nanovesicles and anti-tumor drugs contained in the nanovesicles; the nanovesicles are composed of cell membrane bionic nanovesicles expressing transferrin and Fe 3+ The cell membrane bionic nanovesicle is composed of biological cell membrane, and transferrin is expressed on the surface of the cell membrane; the anti-tumor drug is sorafenib; the drug preparation is prepared by co-incubating the cell membrane bionic nanovesicle expressing transferrin with sorafenib and carrying out drug encapsulation through electroporation to prepare drug-loaded nanovesicles, and then 3+ The nanovesicles containing iron and drug for combined administration are prepared by incubating the mixture at 36 to 38° C. for 25 to 35 minutes.

2. The tumor targeting drug preparation according to claim 1, It is characterized in that The particle size of the cell membrane bionic nanovesicle is 100-200nm.

3. The tumor targeting drug preparation according to claim 1, It is characterized in that The electric potential of the cell membrane bionic nanovesicle is -37mv to -39mV.

4. The tumor targeting drug preparation according to any one of claims 1 to 3, It is characterized in that The preparation method of the cell membrane bionic nanovesicles expressing transferrin comprises the following steps: S1. Insert a transmembrane protein gene sequence at the N-terminus of the secretory transferrin gene sequence, add a green fluorescent tag, and construct a cell line that stably overexpresses transferrin on the membrane through lentiviral infection; S2. Extract the cell membrane of the cell line that stably overexpresses transferrin on the membrane in step S1, and prepare cell membrane biomimetic nanovesicles expressing transferrin by extrusion vesicle method.

5. Use of the tumor-targeting drug preparation according to any one of claims 1 to 3 in the preparation of tumor therapeutic drugs.

6. The tumor targeting drug preparation according to any one of claims 1 to 3 or the use according to claim 5, It is characterized in that The tumor is liver cancer.

Images