Interference RNA for inhibiting expression of hsa_circ_0000825 gene and application thereof

By designing and chemically synthesizing interfering RNA with specific nucleotide sequences, and combining it with a vector delivery system, the problem of the inability to effectively inhibit hsa_circ_0000825 expression in existing technologies has been solved, enabling effective treatment of diseases such as cancer.

CN116144661BActive Publication Date: 2025-11-28NANJING UNIV OF POSTS & TELECOMM
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202310060578.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-19
Publication Date
2025-11-28
Estimated Expiration
2043-01-19

AI Technical Summary

Technical Problem

Currently, there is a lack of effective methods to suppress the expression of the hsa_circ_0000825 gene, especially since its abnormal expression is closely related to cancer development in various cancers. Existing RNA interference technologies have failed to effectively suppress hsa_circ_0000825.

Method used

An interfering RNA containing a specific nucleotide sequence, including siRNA, dsRNA, shRNA, aiRNA and combinations thereof, was designed and prepared by chemical synthesis. It was then delivered in combination with a viral or non-viral vector to specifically inhibit the expression of hsa_circ_0000825.

Benefits of technology

It effectively inhibits the expression of hsa_circ_0000825, providing a new treatment option for hsa_circ_0000825-related diseases, especially cancer, with higher specificity and stability, and has broader therapeutic potential compared to small molecule and monoclonal antibody drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116144661B_ABST
    Figure CN116144661B_ABST
Patent Text Reader

Abstract

The application discloses an interfering RNA for inhibiting hsa_circ_0000825 gene expression and application thereof. The interfering RNA is siRNA, a sense strand of which comprises siRNA1: 5'-GACUGAAAGAGGAUGAGUU-3'; siRNA2: 5'-UGAAAGAGGAUGAGUUAGA-3'; and / or an antisense strand of which comprises a nucleotide sequence of siRNA1: 5'-AACUCAUCCUCUUUCAGUC-3'; siRNA2: 5'-UCUAACUCAUCCUCUUUCA-3'. The nucleotide sequence can effectively inhibit hsa_circ_0000825 gene expression in cholangiocarcinoma cells, and provides a new option for preventing or treating hsa_circ_0000825 related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology and biomedicine, and particularly relates to a siRNA for effectively inhibiting hsa_circ_0000825. BACKGROUND

[0002] Circular RNA (circRNAs) is a class of non-coding RNA molecules without 5-terminal cap and 3-terminal poly(A) tail, and forms a ring structure by covalent bond. The currently discovered circRNAs are mainly derived from exons, but there are other types, such as intron, intergenic, antisense, and sense overlapping. Due to trans-splicing, circRNAs exist in large quantities in the cytoplasm of eukaryotic cells, and a small part of intron-derived circRNAs exist in the nucleus, with certain tissue specificity, timing and disease specificity. Compared with traditional linear RNA, circRNA molecules do not have 5-terminal cap and 3-terminal poly(A) tail, and are in a closed ring structure, which is not easy to be degraded by RNase R, and is more stable than linear RNA. circRNA can not only bind to miRNA to play a sponge role, but also can bind to functional proteins to play a role. The abnormal expression of circRNA plays a crucial role in the occurrence and development of cancer. The up-regulation of circPTPN22, hsa_circ_0001772, circCYFIP2, hsa_circ_0017639 and circPIP5K1A, and the down-regulation of hsa_circ_002059, hsa_circ_0000190 and circMTO1 are closely related to the proliferation and metastasis of gastric cancer; and hsa_circ_0001313 affects the cisplatin resistance of gastric cancer cells. Intrahepatic cholangiocarcinoma (ICC) is a primary liver cancer with high invasiveness and extremely poor prognosis. The role of circRNAs in the occurrence and progression of ICC remains to be determined. Studies have shown that circular RNA ACTN4 can promote the progression of intrahepatic cholangiocarcinoma. We found that hsa_circ_0000825 from MTCL1 is significantly up-regulated in ICC. At the same time, we also found that hsa_circ_0000825 is differentially expressed in various cancers, indicating that hsa_circ_0000825 plays a promoting role in the occurrence and development of various cancers.

[0003] RNA interference (RNAi) is a new gene silencing technology developed in recent years, siRNA is the effector molecule of RNAi, in vitro synthesis of siRNA is the latest development of RNA interference technology, especially in the specific inhibition of mammalian cell gene expression, which opens up a new way for gene therapy, but there is no related research on hsa_circ_0000825. SUMMARY

[0004] The application provides an interfering RNA for inhibiting hsa_circ_0000825 gene expression and application thereof, which can effectively inhibit the expression of hsa_circ_0000825 in cancer cells, and has important significance for hsa_circ_0000825 high expression cancer and inflammation.

[0005] The technical scheme provided by the application is as follows:

[0006] An interfering RNA for inhibiting hsa_circ_0000825 gene expression, the interfering RNA comprises a sense strand and an antisense strand which is reverse complementary to the sense strand, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0007] Specifically, the interfering RNA is selected from siRNA, dsRNA, shRNA, aiRNA, miRNA and a combination thereof.

[0008] In an embodiment of the application, the interfering RNA is siRNA.

[0009] In an embodiment of the application, the interfering RNA is chemically synthesized.

[0010] Specifically, the interfering RNA comprises or consists of a nucleotide sequence as shown in SEQ ID NO: 1.

[0011] Specifically, the interfering RNA comprises or consists of a nucleotide sequence as shown in SEQ ID NO: 2.

[0012] Specifically, the sense strand of the interfering RNA comprises or consists of the following nucleotide sequence: siRNA1: 5'-GCAACAUGUCGAUGGACUU-3' (SEQ ID NO: 1); siRNA2: 5'-UGAAAGAGGAUGAGUUAGA-3' (SEQ ID NO: 2).

[0013] The antisense strand of the interfering RNA comprises the following nucleotide sequence: siRNA1: 5'-AACUCAUCCUCUUUCAGUC-3' (SEQ ID NO: 3); siRNA2: 5'-UCUAACUCAUCCUCUUUCA-3' (SEQ ID NO: 4).

[0014] In particular, the antisense strand of the interfering RNA comprises or consists of the following nucleotide sequence: 5'-AAGUCCAUCGACAUGUUGC-3'.

[0015] In particular, the end (e.g., 3' end) of the sense strand and / or the antisense strand of the interfering RNA (e.g., siRNA) molecule can further be provided with n over-hanging bases to increase the activity of the interfering RNA. The over-hanging bases can be the same or different deoxynucleosides (e.g., deoxythymidine (dT), deoxycytidine (dC), deoxyuridine (dU), etc.), and n is an integer from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), particularly an integer from 2 to 4; in an embodiment of the present application, n = 2, and the over-hanging bases can be dTdT, dTdC or dUdU, etc.

[0016] In particular, the 3' end of the sense strand and the antisense strand of the interfering RNA molecule is provided with over-hanging bases dTdT.

[0017] In particular, the sense strand of the interfering RNA comprises or consists of the following nucleotide sequence: siRNA1: 5'-GACUGAAAGAGGAUGAGUUdTdT-3'; siRNA2: 5'-UGAAAGAGGAUGAGUUAGAdTdT-3'.

[0018] In particular, the antisense strand of the interfering RNA comprises or consists of the following nucleotide sequence: siRNA1: 5'-AACUCAUCCUCUUUCAGUCdTdT-3'; siRNA2: 5'-UCUAACUCAUCCUCUUUCAdTdT-3'.

[0019] In particular, the interfering RNA molecule can further comprise at least one modified nucleotide, and the modified interfering RNA has better properties than the corresponding unmodified interfering RNA, such as higher stability, lower immunostimulatory, etc.

[0020] The present application also provides a delivery system of the interfering RNA, which comprises the interfering RNA and a carrier.

[0021] Specifically, the above-mentioned carrier is a viral vector, specifically, lentivirus, retrovirus, adenovirus, herpes simplex virus, etc.

[0022] Specifically, the above-mentioned carrier is a non-viral vector, specifically, liposome, polymer, polypeptide, antibody, aptamer, etc. or a combination thereof; wherein the weight ratio of the above-mentioned interfering RNA to the non-viral vector can be 1:1-50 (such as 1:1, 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, etc.).

[0023] Specifically, the above-mentioned liposome can be a cationic lipid (such as lipofectamine series of Invitrogenn company, 1,2-dioleoyl-3-trimethylammonium propane (DOTAP)), neutral ion liposome (such as dioleoylphosphatidylcholine (DOPC), cholesterol, etc.), anionic liposome (such as dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylethanolamine (DOPE), etc.) or a mixture thereof.

[0024] Specifically, the above-mentioned polymer can be a synthetic polymer (such as polyethyleneimine, cyclodextrin, etc.) or a natural polymer (such as chitosan, terminal collagen, etc.) or a mixture thereof.

[0025] Specifically, the above-mentioned polypeptide can be a cell-penetrating peptide (CPP) (such as protamine, Tat peptide, transportan peptide, penetratin peptide, oligoarginine peptide, etc.).

[0026] Specifically, the above-mentioned antibody can be a single-chain antibody (such as scFv-tp, scFv-9R, etc.).

[0027] The present application also provides a pharmaceutical composition comprising the above-mentioned interfering RNA or its delivery system, and a pharmaceutically acceptable adjuvant.

[0028] The present application also provides a use of the above-mentioned interfering RNA or its delivery system, and a pharmaceutical composition in the preparation of a drug for preventing and / or treating a disease related to hsa_circ_0000825.

[0029] The present application also provides a use of the above-mentioned interfering RNA or its delivery system in the design of a drug for preventing and / or treating a disease related to hsa_circ_0000825.

[0030] The present application also provides a use of the above-mentioned interfering RNA or its delivery system, and a pharmaceutical composition in the inhibition of hsa_circ_0000825 gene expression in living cells.

[0031] The present application also provides a method for inhibiting expression of hsa_circ_0000825 in a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of the above-mentioned interfering RNA or its delivery system, pharmaceutical composition of the present application.

[0032] The present application also provides a method for preventing and / or treating a disease associated with hsa_circ_0000825, comprising the step of administering to the subject a therapeutically effective amount of the above-mentioned interfering RNA or its delivery system, pharmaceutical composition of the present application.

[0033] Specifically, the above-mentioned diseases include, but are not limited to, cancer, inflammation, etc.

[0034] Specifically, the above-mentioned cancer includes, but is not limited to, cholangiocarcinoma, lung cancer (such as non-small cell lung cancer), liver cancer, esophageal cancer, leukemia, cervical cancer, colorectal cancer, pancreatic cancer, kidney cancer, bladder cancer, breast cancer, prostate cancer, gastric cancer, oral epithelial cancer, ovarian cancer, head and neck cancer, brain tumor, glioma, etc.

[0035] The present application also provides a method for introducing the above-mentioned interfering RNA of the present application into a cell, comprising the step of contacting the cell with the delivery system of the interfering RNA.

[0036] Specifically, the above-mentioned cell is in a subject.

[0037] Specifically, the above-mentioned step of contacting the cell with the delivery system of the interfering RNA is a step of contacting the cell by administering the delivery system of the interfering RNA to the subject in vivo through a systemic route or a local route.

[0038] Advantages

[0039] The present application designs and synthesizes an interfering RNA (e.g., siRNA) which can effectively inhibit the expression of hsa_circ_0000825, providing a new choice for preventing or treating diseases associated with hsa_circ_0000825 (particularly, cancer associated with hsa_circ_0000825). Compared with small molecule therapeutic drugs and monoclonal antibody drugs, siRNA performs its function by complete base complementary pairing with mRNA, knocking down the expression of target genes in a sequence-specific manner, which has an innate advantage, while small molecules and monoclonal antibody drugs need to recognize the complex spatial conformation of certain proteins. Because it is impossible to identify target molecules with high activity, affinity and specificity, many diseases cannot be treated with small molecule and monoclonal antibody drugs. This advantage makes the siRNA mode have a shorter research and development time, a wider treatment field, especially for those genes that cannot be developed with this strategy. BRIEF DESCRIPTION OF DRAWINGS

[0040] Figure 1Shown are mass spectrometry profiles of hsa_circ_0000825 siRNA1 sense (A) and antisense (B) strands.

[0041] Figure 2 Shown are mass spectrometry profiles of hsa_circ_0000825 siRNA2 sense (A) and antisense (B) strands.

[0042] Figure 3 Following siRNA treatment, the relative expression of hsa_circ_0000825 was significantly inhibited in three cancer cells. DETAILED DESCRIPTION

[0043] Unless otherwise defined, all scientific and technical terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which the application pertains.

[0044] The term "interfering RNA" or "RNAi" or "interfering RNA sequence" as used herein includes single-stranded RNA (e.g., mature miRNA, ssRNAi oligonucleotide, ssDNAi oligonucleotide) or double-stranded RNA (i.e., duplex RNA such as siRNA, dsRNA, shRNA, aiRNA, or pre-miRNA) that is capable of reducing or inhibiting the expression of a target gene or sequence (e.g., by mediating degradation and inhibiting translation of mRNA complementary to the interfering RNA sequence) when the interfering RNA is in the same cell as the target gene or sequence. Interfering RNA thus refers to single-stranded RNA complementary to a target mRNA sequence or double-stranded RNA formed from two complementary strands or from a single self-complementary strand. In particular, interfering RNA molecules are chemically synthesized.

[0045] Interfering RNA includes "small interfering RNA" or "siRNA," each strand of an siRNA molecule comprising nucleotides of about 15 to about 60 in length (e.g., nucleotides of about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 in length, or nucleotides of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 in length). In one embodiment, siRNA is chemically synthesized. siRNA molecules of the application are capable of silencing the expression of a target sequence in vitro and / or in vivo. In other embodiments, siRNA comprises at least one modified nucleotide, for example, siRNA comprises one, two, three, four, five, six, seven, eight, nine, ten or more modified nucleotides in the double-stranded region.

[0046] The term "dsRNA" or "pre-RNAi molecule" as used herein is intended to include any precursor molecule that is processed in vivo by an endonuclease to produce an active siRNA.

[0047] As used herein, the term "small hairpin RNA" or "short hairpin RNA" or "shRNA" includes a short RNA sequence that produces a tight hairpin turn that can be used to silence gene expression by RNA interference. The shRNA hairpin structure can be cleaved by cellular machinery into siRNA.

[0048] Generally, microRNAs (miRNAs) are single-stranded RNA molecules of about 21-23 nucleotides in length that regulate gene expression.

[0049] In the present application, the term "therapeutically effective amount" refers to the amount of a subject compound that will elicit the biological or medical response of a tissue, system, or subject that is being sought by the researcher, veterinarian, medical doctor or other clinician. The term "therapeutically effective amount" includes an amount of an active ingredient adequate to prevent the manifestation of one or more of the signs or symptoms of a disorder or disease being treated, or to alleviate to some extent one or more of the signs or symptoms of a disorder or disease being treated, when administered. The therapeutically effective amount will vary depending on the active ingredient, the disease being treated, and its severity, and the age, body weight, gender, etc., of the subject.

[0050] In the present application, the subject can be a mammal, such as a human, monkey, dog, rabbit, mouse, rat, etc.

[0051] It should be noted that the following detailed description is exemplary in nature and is intended to provide further description of the application.

[0052] Example 1 Method of synthesis of siRNA

[0053] The oligonucleotide containing 2'-hydroxyl ribonucleotide in the present application is synthesized according to the theoretical yield of 1 μmol, 1 μmol of universal solid support 3'-cholesterol modified CPG (Chemgenes product) is weighed, and 2'-O-TBDMS protected RNA phosphoramidite monomer is dissolved in anhydrous acetonitrile solution to make the concentration reach 0.2 M. 5-ethylthio-1H-tetrazole (Chemgenes product) acetonitrile solution is prepared as an activator (0.25 M), 0.02 M iodine pyridine / water solution is prepared as an oxidant, and 3% trichloroacetic acid dichloromethane solution is prepared as a deprotection reagent, and placed in the corresponding reagent designated position of the ABI 394 type DNA / RNA automatic synthesizer. The synthesis program is set to input the specified oligonucleotide base sequence, and the oligonucleotide synthesis cycle is started, with a coupling time of 6 minutes per step, and a galactose ligand corresponding L and S monomer coupling time of 10-20 minutes. After automatic cycling, the solid-phase synthesis of the oligonucleotide is completed. The CPG is blown dry with dry nitrogen, transferred to a 5 ml EP tube, 2 ml of ammonia / ethanol solution (3 / 1) is added, and heated at 55°C for 16-18 hours. Centrifuge at 10000 rpm for 10 min, take the supernatant, and after the concentrated ammonia / ethanol is sucked dry, a white gel-like solid is obtained. Dissolve the solid in 200 μl of 1 M TBAF THF solution, shake at room temperature for 20 hours. Add 0.5 ml of 1 M Tris-HCl buffer (pH 7.4), shake at room temperature for 15 minutes, and place in a centrifugal extractor to extract the THF to a volume of 1 / 2 of the original volume. The solution is extracted with 0.5 ml of chloroform twice, 1 ml of 0.1 M TEAA loading solution is added, and the mixed solution is poured into a solid-phase extraction column. The mass spectrometry detection and analysis are completed on the HTCS LC-MS system (Novatia) system. The mass spectrometry identification results are as follows: Figure 1 (sense), Figure 2 (antisense). After the first scan, the nucleic acid molecular weight is calculated by normalization with Promass software. The above method is used to synthesize two single strands respectively, and after mass spectrometry identification, the two single strands are mixed in equal molar ratio to anneal into double-stranded, which is the siRNA sequence.

[0054] The sense strand of the interfering RNA comprises:

[0055] siRNA1: 5'-GACUGAAAGAGGAUGAGUUdTdT-3'; siRNA2: 5'-UGAAAGAGGAUGAGUUAGAdTdT-3' and / or,

[0056] The antisense strand of the interfering RNA comprises: siRNA1: 5'- AACUCAUCCUCUUUCAGUCdTdT-3'; siRNA2: 5'-UCUAACUCAUCCUCUUUCAdTdT-3'.

[0057] Example 2 hsa_circ_0000825 siRNA inhibition effect

[0058] 1. Cell culture

[0059] Cell name: RBE, HuCCT1 and HEK293 cells

[0060] a) The three cells were cultured at 37°C, 5% CO2, respectively, and when the cell density of the six-well plate reached 60%-80%, the serum-free DMEM medium was replaced, and the cells were starved for 4-6h;

[0061] b) Dilute 3.5μL siRNA (or siRNA NC, concentration 20μM) with 50μL serum-free medium, dilute 3μL Lipo2000 transfection reagent with 50μL serum-free medium, mix them, shake gently, and stand for 15-20min; in addition, set blank control group;

[0062] c) Add 106.5μL of the above mixture to each well;

[0063] d) After incubation in the incubator for 5min, add 600μL of serum-free DMEM medium;

[0064] e) After 6-8h, discard the old culture medium and replace it with DMEM medium containing 10% FBS, and after 48h of transfection, remove the six-well plate from the 37°C, 5% CO2 incubator, extract RNA for subsequent detection.

[0065] 2. RNA extraction

[0066] a) Trizol lysis: remove the cell culture fluid, rinse with PBS for 2-3 times, then add 1mL Trizol Reagent to each well, pipette 3-5 times, and let the cells lyse completely at room temperature for 3-5min;

[0067] b) Add 0.2 volumes (0.2mL / 1mL Trizol) of chloroform, vortex for 15s, and stand at room temperature for 5min;

[0068] c) Centrifuge at 4°C, 13000rpm for 10min, and carefully pipette the upper aqueous phase (the volume of the aqueous phase is about 60% of the volume of Trizol) into a new 1.5mL centrifuge tube;

[0069] d) Add the same volume of supernatant with isopropanol (about 0.6 mL), mix well upside down, and stand at room temperature for 10 min;

[0070] e) 4°C, 13000 rpm centrifugation for 20 min, white precipitate can be seen at the bottom of the tube, remove the supernatant;

[0071] f) Add 1 mL of 75% ethanol, gently blow and suck to make the precipitate float, centrifuge at 4°C 13000 rpm for 10 min;

[0072] g) Repeat step f;

[0073] h) After removing the supernatant, centrifuge briefly, use a 10 μL gun to dry, open the centrifuge tube cover to dry, and add an appropriate amount of DEPC water to dissolve when the precipitate is dried to translucent.

[0074] I) RNA quality inspection, Nanodrop detects RNA content, and 1% agarose gel electrophoresis detects RNA integrity.

[0075] 3. Q-PCR detection process

[0076] 3.1 RNA reverse transcription

[0077] a) Use the total RNA extracted from the sample as a template to establish the following reaction system:

[0078] Table 1 reaction system

[0079] Use III RT SuperMix for qPCR(+gDNA wiper) kit (vazyme) reverse transcription.

[0080] (1) Prepare the reverse transcription reaction 20 μL system on ice as follows:

[0081]

[0082]

[0083] (2) After vortexing the mixed liquid in the previous step, place it on ice, and set the reverse transcription conditions of the PCR instrument as follows:

[0084]

[0085] (3) After the reaction is completed, add 90 μL of RNase Free ddH2O to each tube to dilute the cDNA to a total volume of 100 μL, mix well by vortexing, and store in a -20°C refrigerator for standby.

[0086] 3.2. Fluorescent real-time quantitative PCR (qRT-PCR)

[0087] Table 2 qRT-PCR reaction system

[0088] The qRT-PCR reaction system was prepared on ice using ChamQ SYBR qPCR Master Mix (High ROX Premixed) kit (vazyme), wherein the hsa_circ_0000825 primer and internal standard gene GAPDH primer sequences are shown in the primer sequence part, and the preparation scheme is as follows:

[0089]

[0090] After preparation, the PCR reaction tube was placed in a centrifuge and centrifuged at 1000 rpm for three minutes, and then placed in a fluorescent real-time quantitative PCR instrument (ABI Stepone plus) for amplification, and the running conditions were as follows:

[0091]

[0092] The melting curve reaction conditions were as follows:

[0093]

[0094] (3) Analysis of qRT-PCR results

[0095] After the program was run, the Ct value of the target gene was exported to a newly created Excel table, and the 2 -ΔΔCt method was used to analyze the expression of related genes. After normalization of the control group value, the relative expression amount of the target gene was calculated, and a gene expression column chart was drawn.

[0096] The primer sequences are as follows:

[0097] GAPDH-F 5’CCAGAACATCATCCCTGCCT 3’(SEQ ID NO: 5);

[0098] GAPDH-R 5’CCTGCTTCACCACCTTCTTG 3’(SEQ ID NO: 6);

[0099] hsa_circ_0000825-F 5’TTGCACCACGAACTTAAGAC 3’(SEQ ID NO: 7);

[0101] hsa_circ_0000825-R 5’AGTTCATCTAACTCATCCTC 3’(SEQ ID NO:

[0102] 8).

[0103] 4, Inhibition effect

[0104] The relative expression amount of hsa_circ_0000825 was calculated by ΔΔCt with GAPDH as the internal reference gene. The inhibition rate of hsa_circ_0000825 siRNA on hsa_circ_0000825 was 87% compared with the transfection of NCsiRNA (control group). The relative expression level of hsa_circ_0000825 in each group of cells is shown in Figure 3 Specifically, hsa_circ_0000825 siRNA can significantly inhibit the expression of hsa_circ_0000825 in cholangiocarcinoma cells (RBE and HuCCT1), and the inhibition effect on the expression of hsa_circ_0000825 in HuCCT1 cells is more significant. In addition, hsa_circ_0000825 siRNA can also significantly inhibit the expression of hsa_circ_0000825 in human embryonic kidney cells (HEK293). These results fully demonstrate the excellent inhibition effect of the designed hsa_circ_0000825 siRNA in the present application.

[0105] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, etc. within the spirit and principle of the present application shall be included in the protection scope of the present application.

[0106] The foregoing embodiments and methods described herein can vary based on the ability, experience and preference of the person skilled in the art.

[0107] In the present application, the order of the steps of the method does not constitute any limitation on the order of the steps of the method.

Claims

1. The application of interfering RNA that inhibits the expression of the hsa_circ_0000825 gene in the preparation of a formulation that inhibits the expression of hsa_circ_0000825 in cholangiocarcinoma cells, wherein the interfering RNA comprises a sense strand and an antisense strand that is complementary to it, wherein the sense strand is the nucleotide sequence shown in SEQ ID NO: 1 and its antisense strand is the nucleotide sequence shown in SEQ ID NO: 3; or the sense strand is the nucleotide sequence shown in SEQ ID NO: 2 and its antisense strand is the nucleotide sequence shown in SEQ ID NO:

4.

2. The application as described in claim 1, characterized in that, The interfering RNA is siRNA.

3. The application as described in claim 1, characterized in that, The interfering RNA further comprises a dangling base; the number of dangling bases is 1-8; the dangling base is a deoxynucleoside; the dangling base is located at the 3′ end of the sense strand and / or antisense strand of the RNA.

4. The application as described in claim 3, characterized in that, The suspended base is dTdT.

5. The application as described in claim 1, characterized in that, The interfering RNA is chemically synthesized.

Citation Information

Patent Citations

  • siRNA capable of inhibiting expression of circ_0002607 and application of siRNA

    CN109762822A

  • siRNA for inhibiting expression of circ_0001016 and application thereof

    CN109825504A

  • siRNA capable of restraining hsa_circ_0027478 expression and application of siRNA

    CN111118011A

  • SiRNA for inhibiting immediate early gene of human cytomegalovirus and application thereof

    CN114990116A

  • Application of preparation for detecting circular RNA and / or expression quantity of circular RNA in preparation of colorectal cancer diagnostic reagent

    CN115058514A