An enzyme-free isothermal nucleic acid amplification system and its application in mRNA detection

Abstract

The application belongs to the technical field of nucleic acid detection and cell imaging, and discloses an enzyme-free constant-temperature nucleic acid amplification system and application thereof in mRNA detection. The enzyme-free constant-temperature nucleic acid amplification system comprises a hairpin H1, a hairpin H2 and a double-stranded H3L; the double-stranded H3L is composed of an L chain and an H3 chain; the hairpin H1 and the hairpin H2 are marked with a fluorescent donor and a fluorescent acceptor which can undergo fluorescence resonance energy transfer; in the presence of target nucleic acid, the hairpin H1 and the hairpin H2 undergo catalytic hairpin self-assembly reaction to form an H1-H2 complex; the H1-H2 complex can react with the double-stranded H3L to replace the hairpin H3; the hairpin H3 can induce the hairpin H1 and the hairpin H2 to undergo catalytic hairpin self-assembly reaction to form the H1-H2 complex. The enzyme-free constant-temperature nucleic acid amplification system can effectively improve the sensitivity of detection and imaging, and has the characteristics of short reaction time, high sensitivity and strong specificity.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of nucleic acid detection and cell imaging, and particularly relates to an enzyme-free isothermal nucleic acid amplification system and application thereof in mRNA detection. BACKGROUND

[0002] RNA plays a crucial role in the life activities of organisms, and messenger RNA (mRNA) is a kind of single-stranded ribonucleic acid that carries genetic information and can guide protein synthesis, and plays a core role in gene expression and regulation. Understanding gene expression and regulation not only increases the understanding of various life processes, but also helps disease diagnosis and treatment, for example, mRNA expression is closely related to the occurrence and development of cancer.

[0003] In view of the above characteristics of mRNA, researchers have developed many mRNA detection and imaging methods, among which mRNA in situ analysis is the mainstream imaging technology. In situ analysis of mRNA in living cells can provide comprehensive information such as expression, localization, degradation, storage and regulation of RNA in different types of cells, and therefore can be used for clinical diagnosis and drug efficacy monitoring of malignant tumors, and even become the "gold standard" for some cancer-related diseases.

[0004] Fluorescence in situ hybridization (FISH) technology is a traditional method of mRNA in situ analysis, which can realize imaging at the level of tissue, cells and even subcellular level, and has the advantage of high-resolution RNA localization, but the method has limited sensitivity. In recent years, isothermal nucleic acid amplification technology has been considered as an effective method for high-sensitivity nucleic acid detection in living cells due to its mild reaction conditions and high-efficiency amplification under isothermal conditions. Isothermal nucleic acid amplification technology is mainly divided into isothermal amplification technology based on biological enzymes and isothermal nucleic acid amplification technology without biological enzyme participation. Isothermal amplification based on proteinase participation is limited by the difficulty of protein transfection into living cells, which limits the method in mRNA imaging in living cells. Enzyme-free isothermal nucleic acid amplification, which can spontaneously react without biological enzymes and nucleic acid probes can be effectively transfected into cells, has been favored by more researchers, mainly including catalytic hairpin self-assembly reaction (CHA) and chain hybridization reaction (HCR). CHA is a commonly used isothermal enzyme-free amplification method. A typical CHA reaction consists of one initiator strand and two complementary nucleic acid hairpins. The complementary bases of the two nucleic acid hairpins are closed in the hairpin stem, and the reaction can only be triggered in the presence of the initiator strand, and the initiator strand can be repeatedly used until the two nucleic acid hairpins are consumed, thereby realizing nucleic acid amplification. HCR is a kind of isothermal enzyme-free signal amplification technology proposed by Dirks and Pierce. In HCR, the target can trigger the alternating opening of two nucleic acid hairpins, and finally form a DNA structure containing dozens or even hundreds of repeating units, realizing rapid and efficient signal amplification.

[0005] Although the above methods are widely used for the analysis of mRNA in living cells, these methods are linear signal amplification, and the amplification efficiency is limited, which can only detect mRNA with a content as low as pM level in cells, however, the content of part of mRNA in cells is actually lower, and it is difficult to achieve good detection by using the above methods. Therefore, the present application hopes to propose an enzyme-free isothermal nucleic acid amplification system with better detection sensitivity for the detection of mRNA and cell imaging. SUMMARY

[0006] The present application aims to at least solve one of the above technical problems in the prior art. To this end, the present application proposes an enzyme-free isothermal nucleic acid amplification system and its application in mRNA detection. The use of the enzyme-free isothermal nucleic acid amplification system for mRNA detection can realize exponential amplification of fluorescent signals, effectively improve the sensitivity of detection and imaging, and has the characteristics of short reaction time and strong specificity.

[0007] The present application provides an enzyme-free isothermal nucleic acid amplification system, comprising hairpin H1, hairpin H2 and double-stranded H3L; the double-stranded H3L is composed of L chain and H3 chain;

[0008] The hairpin H1 and the hairpin H2 are respectively labeled with a fluorescent donor and a fluorescent acceptor which can undergo fluorescence resonance energy transfer;

[0009] In the presence of target nucleic acid, the hairpin H1 and the hairpin H2 are triggered to undergo catalytic hairpin self-assembly reaction (CHA) to form H1-H2 complex and replace the target nucleic acid; the H1-H2 complex can combine with the L chain of the double-stranded H3L and replace the hairpin H3;

[0010] The hairpin H3 further triggers the hairpin H1 and the hairpin H2 to undergo catalytic hairpin self-assembly reaction (CHA) to form H1-H2 complex and replace the hairpin H3.

[0011] The use of the enzyme-free isothermal nucleic acid amplification system for detection will trigger the reaction when target nucleic acid exists in the system to be detected, and the target nucleic acid and the hairpin H3 produced by the reaction can continuously catalyze and trigger multiple rounds of catalytic hairpin self-assembly reaction of H1 and H2, trigger exponential chain displacement, and finally realize exponential amplification of fluorescent signals, effectively improve the sensitivity of detection and imaging.

[0012] Currently, the fluorescence groups that produce FRET are mainly FAM / TAMRA and Cy3 / Cy5. Preferably, the fluorescent donor is Cy3, and the fluorescent acceptor is Cy5.

[0013] Preferably, the molar ratio of the double-stranded H3L, the hairpin H1 and the hairpin H2 is 1:(1.5-2.5):(1.5-2.5).

[0014] More preferably, the molar ratio of the double-stranded H3L, the hairpin H1 and the hairpin H2 is 1:2:2.

[0015] The application also provides application of the above-mentioned enzyme-free isothermal nucleic acid amplification system in mRNA detection for non-disease diagnosis purposes.

[0016] Preferably, the mRNA detection is mRNA detection in living cells.

[0017] The application also provides an mRNA detection reagent comprising the above-mentioned enzyme-free isothermal nucleic acid amplification system and a carrier.

[0018] Since nucleic acids are not easy to pass through the cell membrane, a carrier is needed to load into cells. Common carriers include liposomes, MnO2 nanosheets and β-FeOOH nanorods. Preferably, the carrier is β-FeOOH nanorods. Tests show that β-FeOOH (NPs) has good safety, can effectively load and protect nucleic acid probes such as hairpin H1, hairpin H2 and double-stranded H3L, and can be efficiently taken up by living cells, so that the enzyme-free isothermal nucleic acid amplification system can play a good detection role.

[0019] Preferably, when the target nucleic acid is TK1 (thymidine kinase 1) mRNA, the nucleotide sequence of the hairpin H1 is shown in SEQ ID NO: 1; the nucleotide sequence of the hairpin H2 is shown in SEQ ID NO: 2; the nucleotide sequence of the L chain is shown in SEQ ID NO: 3, and the nucleotide sequence of the H3 chain is shown in SEQ ID NO: 4.

[0020] The application also provides a preparation method of the above-mentioned mRNA detection reagent, comprising the following steps:

[0021] The carrier is reacted with the hairpin H1, the hairpin H2 and the double-stranded H3L in a buffer system to obtain the mRNA detection reagent.

[0022] Preferably, the buffer is a Tris buffer.

[0023] Compared with the prior art, the application has the following beneficial effects:

[0024] The mRNA detection using the enzyme-free isothermal nucleic acid amplification system has the advantages of short reaction time (a significant fluorescent signal can be generated within 90 minutes), good specificity (can distinguish base mismatches), and high detection sensitivity (the detection line is as low as fM, which can be used for micro mRNA detection), and has a good application prospect in in-situ imaging of mRNA in living cells. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 It is a technical principle diagram of the enzyme-free isothermal nucleic acid amplification system.

[0026] Figure 2 TEM characterization results of β-FeOOH nanomaterials (NPs).

[0027] Figure 3 DLS (A) and Zeta (B) characterization results of β-FeOOH nanomaterials (NPs).

[0028] Figure 4 Polyacrylamide gel electrophoresis chart of H3 chain, L chain and double-stranded H3L; wherein, lane 1: H3, lane 2: L, lane 3: H3L.

[0029] Figure 5 Polyacrylamide gel electrophoresis chart of exponential CHA reaction system; wherein, lane 1: H1, lane 2: H2, lane 3: H3L, lane 4: H1+H2, lane 5: H1+H2+target, lane 6: H1+H2+H3L, lane 7: H1+H2+H3L+target.

[0030] Figure 6 Fluorescence verification chart of exponential CHA reaction system.

[0031] Figure 7 Real-time fluorescence chart of exponential CHA reaction system and traditional CHA reaction system.

[0032] Figure 8 Concentration optimization chart of double-stranded H3L.

[0033] Figure 9 Fluorescence spectrum chart (A) and standard curve chart (B) of exponential CHA reaction system; and fluorescence spectrum chart (C) and standard curve chart (D) of traditional CHA reaction system.

[0034] Figure 10 Specificity verification results of exponential CHA reaction system; wherein, B chart represents the fluorescence intensity value when fluorescence resonance transfer changes in A chart.

[0035] Figure 11 Fluorescence spectrum and corresponding standard curve chart of H1, H2 and H3L; wherein, A and D charts are fluorescence spectrum chart and standard curve of H1; B and E charts are fluorescence spectrum chart and standard curve of H2; C and F charts are fluorescence spectrum chart and standard curve of H3L.

[0036] Figure 12 Stability of free H1 labeled with FAM / BHQ1 and H1 loaded on NPs in DNase I (A chart) and 10% serum (B chart).

[0037] Figure 13Cellular toxicity of NPs and Hairpins-DNA@NPs.

[0038] Figure 14 Results of the uptake ability test of MCF-10A, MCF-7 and MDA-MB-231 cells to NPs.

[0039] Figure 15 CLSM images of MCF-7 cells treated with H1+H2 (i.e. CHA), NPs+H1+H2 (i.e. CHA+NPs), H1+H2+H3L (i.e. ECHA), NPs+H1+H2+H3L (i.e. ECHA+NPs) respectively.

[0040] Figure 16 CLSM images of MCF-7 cells treated with NPs+H1+H2+H3L for different time.

[0041] Figure 17 CLSM images of MCF-7 cells untreated, pretreated with Anti-TK1 and pretreated with TK1 respectively and incubated with NPs system for 2h.

[0042] Figure 18 CLSM images of MCF-10A, MCF-7 and MDA-MB-231 cells treated with NPs+H1+H2+H3L. DETAILED DESCRIPTION

[0043] In order to make the skilled in the art more clearly understand the technical solutions described in the present application, the following examples are listed for illustration. It should be pointed out that the following examples are only preferred embodiments of the present application, and do not constitute a limitation on the scope of protection required by the present application, any modification, substitution, combination made without deviating from the spirit and principles of the present application, are included in the protection scope of the present application.

[0044] The raw materials, reagents or devices used in the following examples, if not specifically stated, can be obtained from conventional commercial channels, or can be obtained by existing known methods.

[0045] Example 1

[0046] The present embodiment provides an enzyme-free isothermal nucleic acid amplification system, which comprises hairpin H1, hairpin H2 and double-stranded H3L (composed of L chain and H3 chain), wherein H1 and H2 are respectively modified with fluorescent donor and fluorescent acceptor. The enzyme-free isothermal nucleic acid amplification system can be used for quantitative detection and imaging of nucleic acid (such as mRNA) in living cells, and its technical principle is as shown in Figure 1 Specifically, it comprises:

[0047] When the target nucleic acid target is present in the system to be tested, the hairpin H1 is opened to form a double-stranded H1-target with the target nucleic acid target; the opened H1 exposes a single strand that can be complementary to the stem of H2, and the hairpin H2 is then opened and combined to form an H1-H2 complex. The fluorescent donor and the fluorescent acceptor on H1 and H2 can induce fluorescence resonance energy transfer due to the close proximity, thereby generating a fluorescence signal; and the target nucleic acid target is displaced in the form of strand displacement, and the displaced target nucleic acid target can continue to promote the above reaction, thereby achieving cyclic use.

[0048] Since the 3' end of the hairpin H1 and the 5' end of the hairpin H2 are each modified with a sequence complementary to the L strand, when the H1-H2 complex is formed, the portion complementary to the L on the H1-H2 complex can be approximately a complete long strand and can displace H3 from the double-stranded H3L to form a stable complex long strand, and the free H3 can spontaneously form a hairpin structure. At this time, the sequences at the two ends of the hairpin H3 can be approximately a long strand identical to the target nucleic acid sequence, and can act as an analogue of the target nucleic acid target to form a double-stranded H1-H3 with the hairpin H1. The opened H1 exposes a single strand that can be complementary to the stem of H2, and the hairpin H2 is then opened and combined to form an H1-H2 complex. The fluorescent donor and the fluorescent acceptor on H1 and H2 can induce fluorescence resonance energy transfer due to the close proximity, thereby generating a fluorescence signal; and the hairpin H3 is displaced in the form of strand displacement, and the displaced hairpin H3 can continue to promote the above reaction, thereby achieving cyclic use.

[0049] In the above reaction, both the target nucleic acid target and the hairpin H3 can continuously catalyze multiple rounds of self-assembly reactions of H1 and H2, trigger exponential strand displacement, and ultimately realize exponential amplification of the fluorescence signal. Therefore, the reaction triggered by the above enzyme-free isothermal nucleic acid amplification system is named as exponential CHA (i.e., ECHA).

[0050] Example 2

[0051] This embodiment provides an enzyme-free isothermal nucleic acid amplification system for detecting TK1 (thymidine kinase 1) mRNA, wherein: the nucleotide sequence of the hairpin H1 is shown in SEQ ID NO: 1, and the fluorescent donor Cy3 is marked at the dash line;

[0052] 5'-CTGAGCAATCTGGAAGCGACGGACCATGTG T AGAGATCCGTCGCTTCCAGCCT CC-3'(SEQ ID NO: 1);

[0053] The nucleotide sequence of the hairpin H2 is shown in SEQ ID NO: 2, and the fluorescent acceptor Cy5 is marked at the dash line;

[0054] 5'-CCCCCAGCAGAGTACCGACGGATCTC T ACACATGGTCCGTCGCTTCCAGCCAT GTGTAGAGA-3' (SEQ ID NO: 2);

[0055] The double-stranded H3L is composed of an L chain and an H3 chain. The nucleotide sequence of the L chain is shown in SEQ ID NO: 3, and the nucleotide sequence of the H3 chain is shown in SEQ ID NO: 4.

[0056] 5'-GGAGGCTGGAAGGTACTCTGCTGGGTAACAAG-3' (SEQ ID NO: 3);

[0057] 5'-TCCGTCGCTTGTTACCCAGCAGAGTACCTTCGGGTAACCCAGATTGCTCAG-3' (SEQ ID NO: 4).

[0058] Example 3: Preparation of β-FeOOH nanomaterials (NPs) and Hairpins-DNA@NPs

[0059] Using polyetherimide (PEI) as a capping agent, nanorod-shaped NPs were synthesized via a hydrolysis reaction of FeCl3·6H2O. Figure 2 TEM characterization results show that NPs exhibit a needle-like structure, indicating that the material has been successfully synthesized.

[0060] Then, the NPs were reacted with hairpin H1 (200 nM), hairpin H2 (200 nM) and double-stranded H3L (100 nM) from Example 2 in a Tris buffer (20 mM, pH 7.4) system for 1 h to obtain Hairpins-DNA@NPs (or probes@NPs).

[0061] Depend on Figure 3 The DLS and Zeta characterization results show that the NP particle size changed from 77 nm to 87 nm (Figure A) and the potential changed from 38.4 mV to -4.3 mV (Figure B), indicating that the probes@NPs complex was successfully formed.

[0062] Example 4: Verification of the feasibility of the polypropylene gel electrophoresis method

[0063] According to the sequence information of Example 2, each nucleic acid chain was synthesized, and a target nucleic acid (i.e., TK1, the nucleotide sequence of which is: 5'-TCCGTCGCTTCCAGATTGCTCAG-3' (SEQ ID NO: 5)) was synthesized. Equal molar amounts of H3 and L chains were synthesized into double-stranded H3L through gradient cooling, and then it was verified whether the double-stranded was synthesized by non-denaturing PAGE electrophoresis reaction at 220V for 40min. Next, H1 (200nM) and H2 (200nM) were reacted for 1h in the presence or absence of target and H3L, respectively, and then it was verified the feasibility of the method by non-denaturing PAGE electrophoresis reaction at 220V for 40min.

[0064] From Figure 4 It can be seen that a new band with a larger molecular weight appears in lane 3, indicating that H3 and L have indeed synthesized double-stranded H3L. From Figure 5 It can be seen that there is no obvious new band produced in the presence of H1 and H2; obvious new bands are produced when target, H1 and H2 are mixed; almost no new bands are produced when H1, H2 and H3L are present simultaneously; and two new bands are produced when target, H1, H2 and H3L are present simultaneously, proving that the method is feasible.

[0065] Example 5: Fluorescence verification of the feasibility of the method

[0066] H1 labeled with a fluorescent donor and H2 labeled with a fluorescent acceptor were used as reaction probes, and incubation and reaction were carried out in the presence or absence of a target nucleic acid (the nucleotide sequence of which is shown in SEQ ID NO: 5), H3L or mismatched H3L (i.e., H3L.1), and then the degree of fluorescence energy resonance transfer was detected to verify the occurrence of CHA reaction and amplification reaction, and the fluorescence value was determined by a fluorescence spectrophotometer. Mismatched H3L (H3L.1) was composed of H3.1 chain and L.1 chain, the nucleotide sequence of H3.1 chain was: 5'-TCCGTCGCCTTGTTACCCAGCAGAAACCGTACGGGTAACCCAGATTTGCTGAG-3' (SEQ ID NO: 6); and the nucleotide sequence of L.1 chain was: 5'-GCAGGGTACGGTTTCTGCTGGG-3' (SEQ ID NO: 7).

[0067] The test results are as follows: Figure 6As shown, when the target nucleic acid is absent, the traditional CHA (i.e., H1+H2) and exponential CHA (i.e., H1+H2+H3L) show only very weak fluorescence, indicating that the reaction hardly occurs when the target nucleic acid is absent. When H1, H2 and the target are present, the traditional CHA reaction produces strong fluorescence. When the mismatched H3L strand is added, the fluorescence intensity does not change much (because L.1 cannot be recognized by the double-stranded H1-H2, H3 cannot be released, and exponential amplification cannot be initiated). However, when H3L and the target are added simultaneously, the fluorescence is significantly enhanced, proving that the addition of the H3L double strand is required to trigger the exponential amplification reaction, and the amplification efficiency is significantly higher than that of the traditional CHA.

[0068] Example 6: Comparison and verification of kinetic curves

[0069] H1, labeled with a fluorescent donor, and H2, labeled with a fluorescent acceptor, were used as reaction probes. Reactions were carried out in the presence or absence of the target nucleic acid (target) or in the presence of H3L. Fluorescence kinetic curves were detected using a fluorescence spectrophotometer. The fluorescence growth trend over time was compared under the condition of no target to verify the theoretical calculations and determine the reaction time.

[0070] Depend on Figure 7 It can be seen that within a reaction time of 90 min, the blank curves of the two systems basically overlapped, and the reaction system with added H3L showed a significant difference in sensitivity compared with the traditional CHA reaction, verifying that the enzyme-free isothermal nucleic acid amplification system developed in this invention has higher reaction kinetic characteristics.

[0071] Example 7: Optimization of probe concentration in an enzyme-free isothermal nucleic acid amplification system

[0072] Hairpin H1 labeled with a fluorescent donor and hairpin H2 labeled with a fluorescent acceptor were used as reaction probes. 10 nM of the target nucleic acid was added and reacted with different concentrations of double-stranded H3L. Figure 8 It can be seen that the signal-to-noise ratio is the highest when the molar ratio of H3L:H1:H2 is 1:2:2, that is, H3L:H1:H2=1:2:2 can be regarded as a better reaction ratio.

[0073] Example 8: Plotting the standard curve for the exponential CHA reaction

[0074] Standard curves were constructed using different target concentrations and corresponding energy resonance transfer intensity ratios. Hairpin H1 labeled with a fluorescent donor and hairpin H2 labeled with a fluorescent acceptor were used as reaction probes to prepare a series of test solutions with different target nucleic acid concentrations. Then, a specific volume of solution containing H1 and H2 reaction probes, the target, and H3L double strands was prepared. After a certain reaction time, the energy resonance transfer fluorescence intensity was measured using a fluorescence spectrophotometer.

[0075] From Figure 9 It can be seen that when the target nucleic acid is detected by the enzyme-free constant temperature nucleic acid amplification system in Example 2, the concentration range of the selected target nucleic acid is 0nM to 10nM, and there is a good linear relationship between 1pM and 1nM. When the traditional CHA is used for detection, the concentration range of the selected target nucleic acid is 0nM to 300nM, and when the concentration is 100nM, it basically reaches saturation. By calculating the LOD values (3σ / k, σ represents the standard deviation calculated by repeating the determination of the blank group 11 times, and K is the slope of the respective equation) of the two, the LOD value of the enzyme-free constant temperature nucleic acid amplification system in Example 2 is 237fM, and the LOD value of the traditional CHA is 25pM. It is proved that the system has a lower detection limit and can detect lower abundance mRNA.

[0076] Example 9: Specificity evaluation

[0077] The hairpin H1 labeled with a fluorescent donor and the hairpin H2 labeled with a fluorescent acceptor are used as reaction probes, and incubation is carried out under the conditions of having and not having the target nucleic acid target and the target containing the mismatched chain. The change of fluorescence resonance energy transfer is observed by a fluorescence spectrophotometer to verify, and the specificity of the reaction is evaluated at the same time. The nucleotide sequence of the target containing the mismatched chain is as follows:

[0078] TK1 mis1: 5'-TCCGTCGCTTGGAGATTGCTCAG-3' (SEQ ID NO: 8)

[0079] TK1 mis2: 5'-TCCGTGCCTTCCAGATTGCTCAG-3' (SEQ ID NO: 9)

[0080] TK1 mis3: 5'-TCCGTCGCTTCCAGATTGGACAG-3' (SEQ ID NO: 10)

[0081] TK1 mis4: 5'-TCCGTCGCTTCCAGATTCCTCAG-3' (SEQ ID NO: 11).

[0082] The results are shown in Figure 10 It can be seen that the fluorescence intensity value of the system containing the mismatched chain and the fluorescence intensity value of the system without the target nucleic acid target are quite weak, and the fluorescence intensity is significantly enhanced after the target nucleic acid target is added. This shows that the system has high specificity.

[0083] Example 10: NPs can load nucleic acid probes

[0084] Using H1, H2, and H3L labeled with the fluorescent groups Cy3, Cy5, and FAM as fluorescent probes, a series of different concentrations were designed. The corresponding fluorescence values ​​were measured using a fluorescence spectrophotometer, and standard curves were plotted. Then, the three probes were loaded onto NPs, centrifuged, and the supernatant was collected and its fluorescence value was measured. The maximum loading rate of NPs was calculated by fitting the supernatant to the unloaded fluorescence standard curve.

[0085] Figure 11 The standard curves for the three probes are shown. By fitting the standard curves with the fluorescence curves of the three probes, the loading rates of the three probes on the NPs are all greater than 99%, indicating that the NPs can be loaded with nucleic acid probes.

[0086] Example 11: Stability Study of NPs

[0087] Hairpin H1 labeled with the fluorescent group FAM and the quencher group BHQ1 was loaded onto NPs. The fluorescence changes were detected using real-time fluorescence PCR with probes loaded and unloaded with NPs added to 10% serum or DNasel (10 U / L), respectively, to compare the fluorescence intensity changes with and without NPs. Figure 12 It can be seen that the probe without NPs has a strong fluorescence signal, while the probe with NPs has almost no fluorescence, which indicates that NPs have a protective effect on DNA.

[0088] Example 12: Cytotoxicity of NPs and Hairpins-DNA@NPs

[0089] MCF-7 cells were loaded at 1×10 4 NPs were seeded at a density of 1 NP / well in 96-well plates and incubated at 37°C and 5% CO2 for 24 h. Different concentrations of NPs were then added, and incubation continued for another 24 h. After removing the old culture medium, 100 μL MTT (0.5 mg / mL) was added to each well, and incubation continued for 4 h. The supernatant was then removed, and 100 μL DMSO solution was added to each well, followed by shaking for 15 min. Finally, absorbance was measured at 490 nm. All experiments were repeated three times.

[0090] Depend on Figure 13 It can be seen that when the concentration of NPs is below 150 μg / mL, the cell survival rate is above 90%, proving that NPs are basically non-toxic to cells.

[0091] Example 13: Cellular uptake of NPs

[0092] MCF-7, MCF-10A, MDA-MB-231 cells were inoculated in 6-well plates and incubated at 37°C in a 5% CO2 environment, and after the growth density was 90%, NPs with less cytotoxicity and higher concentration were added for co-incubation for 2h. The cells were digested and counted, concentrated nitric acid was added, and it was placed overnight at constant temperature. The concentration of Fe in the supernatant was determined by ICP-MS, and the cell uptake rate of NPs was calculated. 2+ The results showed that the cell uptake rate of NPs was 0.5%, 0.3%, and 0.2% for MCF-7, MCF-10A, and MDA-MB-231 cells, respectively. Figure 14 For the uptake of NPs by the three cells, compared with the blank cells, the efficiency of NPs entering the three cells was good, indicating that the cells could achieve efficient uptake of NPs.

[0093] Example 14: Verification of energy resonance transfer occurring in living cells

[0094] In view of the good performance of the enzyme-free isothermal nucleic acid amplification system for detecting target nucleic acid target in vitro, the feasibility of detecting target nucleic acid target in living cells was further studied. Four groups of the same MCF-7 cells were taken, the first group was added with H1+H2 (i.e. CHA), the second group was added with NPs+H1+H2 (i.e. CHA+NPs), the third group was added with H1+H2+H3L (i.e. ECHA), and the fourth group was added with NPs+H1+H2+H3L (i.e. ECHA+NPs). Then the four groups of cells were incubated at 37°C in a 5% CO2 environment for 2h, and the fluorescence intensity of energy resonance transfer in the four groups of cells was observed by inverted confocal laser microscope to verify the occurrence of FRET in cells.

[0095] From Figure 15 It can be seen that the addition of complete system NPs+H1+H2+H3L can produce stronger fluorescence, which indicates that the detection system has the ability of living cell imaging, and the efficiency of energy resonance transfer is the highest.

[0096] Example 15: Optimization of mRNA imaging time in living cells

[0097] Six groups of the same MCF-7 cells were taken, and NPs+H1+H2+H3L was added every half hour, for a total of 2.5h. The fluorescence intensity of energy resonance transfer in the six groups of cells was observed by inverted confocal microscope to determine the optimal reaction time. Figure 16 The results showed that when the incubation time of nucleic acid chains in cells was 2h, the fluorescence value reached the maximum, so the final cell imaging time was determined to be 2h.

[0098] Example 16: Sensitivity imaging of mRNA in living cells

[0099] After the optimal imaging time was obtained, further study was made on the detection of the content change of the target in the living cells. Three groups of the same MCF-7 cells were taken, the first group was pre-incubated with the target nucleic acid target sequence for 2 hours, the second group was not treated, and the third group was pre-incubated with antisense target (i.e. Anti-TK1, nucleotide sequence: 5'-GTACTGAGCAATCTGGAAGCGACGGACG-3' (SEQ ID NO: 12)) for 2 hours. After the three groups of pre-treated cells were added into NPs+H1+H2+H3L, they were incubated at 37°C in a 5% CO2 environment for 2 hours, and then the fluorescence intensity of the energy resonance transfer in the three groups of cells was observed by an inverted confocal microscope to verify the accuracy of the detection of the target nucleic acid target in the cells.

[0100] From Figure 17 It can be seen that the fluorescence intensity of the MCF-7 cells incubated with the target nucleic acid target is stronger than that of the untreated group, and the fluorescence intensity of the MCF-7 cells incubated with antisense target is basically zero, which proves that the method can successfully detect the change of the expression level of the target nucleic acid in the cells.

[0101] Example 17: In situ imaging of mRNA in different cells

[0102] Finally, we verified the application of the method in actual cancer diagnosis. The method was used to detect the content of the target nucleic acid (TK1 mRNA) in related cancer cells and normal cells, and cancer cells MCF-7, MDA-MB-231 and normal cells MCF-10A were selected respectively. After the three kinds of cells were seeded on the confocal dishes and incubated for 24 h, NPs+H1+H2+H3L was added, and after incubation at 37°C in a 5% CO2 environment for 2 h, the fluorescence intensity of the energy resonance transfer in the three groups of cells was observed by an inverted confocal microscope.

[0103] From Figure 18 It can be seen that the fluorescence intensity of the MCF-7 cells incubated with the target nucleic acid target is stronger than that of the untreated group, and the fluorescence intensity of the MCF-7 cells incubated with antisense target is basically zero, which proves that the method can successfully detect the change of the expression level of the target nucleic acid in the cells.

[0104] The embodiments of the application are described in detail above with reference to the drawings, but the application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the application. In addition, the embodiments of the application and the features in the embodiments can be combined with each other without conflict.

Claims

1. An enzyme-free isothermal nucleic acid amplification system, characterized in that, It includes hairpin H1, hairpin H2, and double chain H3L; the double chain H3L is composed of L chain and H3 chain; Hairpin H1 and hairpin H2 are respectively labeled with a fluorescent donor and a fluorescent acceptor capable of fluorescence resonance energy transfer; In the presence of the target nucleic acid, a catalytic hairpin self-assembly reaction is initiated between the hairpin H1 and the hairpin H2 to form an H1-H2 complex, which then replaces the target nucleic acid. The H1-H2 complex can bind to the L chain in the double-stranded H3L and replace it to obtain hairpin H3. The hairpin H3 further initiates a catalytic hairpin self-assembly reaction between the hairpin H1 and the hairpin H2 to form an H1-H2 complex, which is then replaced to obtain hairpin H3; When the test system contains the target nucleic acid, hairpin H1 is opened to form a double-stranded H1-target with the target nucleic acid. The opened H1 exposes a single strand that is complementary to the stem of H2. Hairpin H2 is then opened and binds to it to form the H1-H2 complex. The fluorescent donor and fluorescent acceptor on H1 and H2 are close to each other, which can induce fluorescence energy resonance transfer and generate a fluorescence signal. The target nucleic acid is then displaced by chain substitution. The displaced target nucleic acid can continue to promote the above reaction and can be recycled. Since the 3' end of hairpin H1 and the 5' end of hairpin H2 are each modified with a sequence complementary to the L chain, when the H1-H2 complex is formed, the L-complementary part of the H1-H2 complex can be approximated as a complete long chain and can displace H3 from the double-stranded H3L to form a stable complex long chain, while the free H3 can spontaneously form a hairpin structure. At this time, the sequences at both ends of hairpin H3 can be approximated as long chains identical to the target nucleic acid sequence, and can act as analogs of the target nucleic acid to form double-stranded H1-H3 with hairpin H1. The opened H1 exposes a single chain that can be complementary to the stem of H2, and hairpin H2 is then opened and binds to it to form the H1-H2 complex. The fluorescent donor and fluorescent acceptor on H1 and H2 are close to each other, which can induce fluorescence energy resonance transfer and generate a fluorescence signal. This allows hairpin H3 to displace the fluorescent donor and acceptor in the form of chain substitution. The displaced hairpin H3 can continue to promote the above reaction and achieve recycling.

2. The enzyme-free isothermal nucleic acid amplification system according to claim 1, characterized in that, The fluorescent donor is Cy3, and the fluorescent acceptor is Cy5.

3. The enzyme-free isothermal nucleic acid amplification system according to claim 1, characterized in that, The molar ratio of the double-chain H3L, hairpin H1, and hairpin H2 is 1:(1.5-2.5):(1.5-2.5).

4. The enzyme-free isothermal nucleic acid amplification system according to claim 3, characterized in that, The molar ratio of the double-chain H3L, hairpin H1, and hairpin H2 is 1:2:

2.

5. The application of the enzyme-free isothermal nucleic acid amplification system according to any one of claims 1-4 in mRNA detection for non-disease diagnostic purposes.

6. The application according to claim 5, characterized in that, The mRNA detection refers to the detection of mRNA in living cells.

7. An mRNA detection reagent, characterized in that, The enzyme-free isothermal nucleic acid amplification system and vector as described in any one of claims 1-4.

8. The mRNA detection reagent according to claim 7, characterized in that, The carrier is at least one of β-FeOOH nanorods, liposomes, and MnO2 nanosheets.

9. The mRNA detection reagent according to claim 7, characterized in that, When the target nucleic acid is TK1 mRNA, the nucleotide sequence of hairpin H1 is as shown in SEQ ID NO: 1; the nucleotide sequence of hairpin H2 is as shown in SEQ ID NO: 2; the nucleotide sequence of the L chain is as shown in SEQ ID NO: 3; and the nucleotide sequence of the H3 chain is as shown in SEQ ID NO:

4.

10. The method for preparing the mRNA detection reagent according to any one of claims 7-9, characterized in that, Includes the following steps: The vector was reacted with hairpin H1, hairpin H2 and double-stranded H3L in a buffer system to obtain the mRNA detection reagent. The carrier is at least one of β-FeOOH nanorods, liposomes, and MnO2 nanosheets.

Images