Methylation markers, primer probe combinations, kits for detection of colorectal cancer and applications thereof

Abstract

The application discloses a methylation marker for detecting colorectal cancer, and the methylation marker related to the colorectal cancer comprises a CpG methylation site cg08392199 of a LIFR gene. A primer probe combination for detecting the methylation marker of the colorectal cancer comprises a LIFR-F upstream primer, a LIFR-R downstream primer and a LIFR-P probe. A kit comprises the primer probe combination. The application further relates to application of the methylation marker related to the colorectal cancer to preparation of a kit, and application of the kit to preparation of a product for detecting the colorectal cancer. The cg08392199 site disclosed by the application has high sensitivity and high specificity in detection of the colorectal cancer, the sensitivity reaches 91%, and the specificity is as high as 100%.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and DNA detection technology, and relates to a methylation marker for colorectal cancer detection, its primer-probe combination, kit, and application. Background Technology

[0002] Colorectal cancer (CRC) is a common gastrointestinal malignancy, with 1.93 million new cases worldwide in 2020, representing an incidence rate as high as 10%, of which China accounts for about 20%. In the past decade, the incidence of CRC in my country has been rising year by year, while the age of onset has been decreasing. The mortality rate for colorectal cancer patients over 45 years of age is 95.18%, making it one of the leading causes of cancer death among Chinese residents.

[0003] Colorectal cancer is often discovered through symptoms such as diarrhea, rectal bleeding, or abdominal pain, and it develops from early, asymptomatic intestinal polyps. The 10-15 years between polyp transformation and cancer is considered the golden window for screening; early screening and effective treatment can increase the prevention rate to 95%. In countries with long-term screening programs, the colorectal cancer mortality rate has decreased significantly.

[0004] Traditional screening methods for colorectal cancer include colonoscopy, fecal occult blood test, and CT colon reconstruction. While colonoscopy is considered the gold standard, it still has a 5% false negative rate and is complex, causing patient discomfort and poor compliance. In recent years, methods for detecting colorectal cancer using molecular markers have developed, offering increasingly higher sensitivity and specificity, while also being safe and non-invasive. These methods require only a small sample of the patient's blood or stool to screen for specific molecular markers. The first FDA-approved fecal DNA test kit, "colonguard," assists in the diagnosis of colorectal cancer by detecting the methylation levels of the NDRG4 and BMP3 genes in stool, but its specificity is only 86.6%. Currently, there are also kits on the market that detect the methylation level of the Septin9 gene in peripheral blood, but their sensitivity is only 70%, which also fails to meet clinical requirements.

[0005] Every day, millions of cells shed from the colon wall into the excretory system, including cells involved in the formation of intestinal tumors. These cells contain DNA, which includes genetic information closely related to tumors, reflecting the formation process of colorectal cancer or other tumors. In early-stage colorectal cancer cells, some genes undergo methylation, a precursor to the disease. These cells naturally shed into the intestines and are excreted with feces. By detecting these DNA markers, the presence of colorectal cancer or other tumors in the intestinal wall can be detected. In 2014, the American Cancer Society considered fecal DNA testing the most suitable method for colorectal cancer screening. The Expert Consensus on Early Colorectal Cancer Screening in China (2019, Shanghai) also recommends fecal DNA testing as a method for early colorectal cancer screening. Currently, commercially available kits for detecting fecal methylation to aid in the diagnosis of colorectal cancer have many shortcomings. Their sensitivity and specificity are insufficient, and the cost is high, making them unaffordable for most people and hindering their widespread application in colorectal cancer screening.

[0006] Currently, methylation detection kits based on fecal samples mainly detect sites including SDC2, NDRG4, BMP3, TFPI2, SEPT9, SFRP2, SPG20, and FBN1. This invention provides a novel DNA methylation marker in the LIFR gene and establishes a method for detecting colorectal cancer using this marker. By applying this method in conjunction with TaqMan-PCR technology, highly specific and sensitive detection of advanced adenomas and colorectal cancer can be achieved using only a pair of primers and probes.

[0007] The leukemia inhibitory factor receptor (LIFR) has become a hot topic in recent years in the study of inflammation-related factors. LIFR was first reported in the 1990s, and early research focused primarily on its role as a inflammatory factor in the inflammatory response. With increasing attention paid to the relationship between inflammation-related factors and tumor development, LIFR has re-emerged in the spotlight. LIFR is the receptor for leukemia inhibitory factor (LIF) and is highly homologous to the transmembrane 130kD glycoprotein 130 (gp130). The LIFR gene is located on human chromosome 5p12-p13. Its function is to mediate signals induced by interleukin-6 (IL-6)-related factors, including LIF, cardiotrophin-1 (CT-1), oncostatin M (OSM), and ciliary neurotrophic factor (CNTF), by forming a heterodimer with gp130. The biological functions of these cytokines vary greatly, ranging from maintaining stem cell pluripotency, protecting the liver, and regulating glucose uptake to regulating cell proliferation and differentiation.

[0008] Patent publication number CN 112430657 A detected the methylation levels of the C20orf194, ZNF304, and LIFR genes in blood and tissue DNA. The reported LIFR sites are specifically cg18174928, cg11841722, and cg12602374. The sensitivity of LIFR methylation level detection in colorectal cancer tissue, as described in this patent, is 73.3%, the specificity is 90.2%, and the area under the receiver operating curve (AUC) is 0.806. Summary of the Invention

[0009] To address key issues such as sensitivity and specificity in colorectal cancer screening and diagnosis, this invention discloses a methylation marker associated with colorectal cancer, comprising the CpG methylation site cg08392199 of the LIFR gene.

[0010] The methylation marker associated with colorectal cancer is the CpG methylation site cg08392199 of the LIFR gene. This methylation marker is any combination of the CpG methylation site cg0839219 and the LIFR gene sequence or fragments thereof. Methylation of the LIFR gene cg08392199 site is significantly associated with colorectal cancer and can be used for colorectal cancer screening. If methylation of the LIFR gene cg08392199 site is detected in a subject, the subject is highly likely to have colorectal cancer.

[0011] Under normal circumstances, the cg08392199 site of the LIFR gene under methylation is contained in the nucleotide sequence shown in SEQ ID NO.3.

[0012] Furthermore, the cg08392199 site of the LIFR gene under methylation is the second CG from the 5' end to the 3' end of the nucleotide sequence shown in SEQ ID NO.3.

[0013] On the other hand, the present invention discloses a primer-probe combination comprising a LIFR-F upstream primer, a LIFR-R downstream primer, and a LIFR-P probe; the LIFR-F upstream primer, the LIFR-R downstream primer, and the LIFR-P probe are used to detect colorectal cancer-related methylation markers as described above.

[0014] In some embodiments, the corresponding nucleotide sequences of the LIFR-F upstream primer, the LIFR-R downstream primer, and the LIFR-P probe are designed based on the nucleotide sequence of the methylation site of the LIFR gene after sulfite modification; the nucleotide sequence of the methylation site of the LIFR gene after sulfite modification is shown in SEQ ID NO.7.

[0015] In some embodiments, the primer-probe combination is selected from any one or more of combinations a1)-a5): a1) LIFR-F4, LIFR-R1, and LIFR-P2; a2) LIFR-F4, LIFR-R2, and LIFR-P2; a3) LIFR-F4, LIFR-R3, and LIFR-P2; a4) LIFR-F1, LIFR-R4, and LIFR-P2; a5) LIFR-F4, LIFR-R4, and LIFR-P2; wherein the nucleotide sequence of LIFR-F1 is as shown in SEQ ID NO.1, the nucleotide sequence of LIFR-R4 is as shown in SEQ ID NO.2, the nucleotide sequence of LIFR-P2 is as shown in SEQ ID NO.3, the nucleotide sequence of LIFR-F4 is as shown in SEQ ID NO.8, the nucleotide sequence of LIFR-R1 is as shown in SEQ ID NO.9, the nucleotide sequence of LIFR-R2 is as shown in SEQ ID NO.10, and the nucleotide sequence of LIFR-R3 is as shown in SEQ ID NO.11.

[0016] This invention discloses a kit comprising the primer-probe combination as described above.

[0017] In some embodiments, a positive control is also included; the positive control includes a plasmid containing a nucleotide sequence of a methylation site of the LIFR gene after sulfite modification, and / or a colorectal cancer cell line; the nucleotide sequence of the methylation site of the LIFR gene after sulfite modification is shown in SEQ ID NO.7.

[0018] In some embodiments, the vector plasmid containing the nucleotide sequence of the methylation site after sulfite modification of the LIFR gene is selected from pUC57, pUC57-Kan, pUC57-Simple, pUC57-mini, pUC18, and pUC19.

[0019] In some embodiments, the colorectal cell lines are selected from positive cell lines SW48, HCT116, LoVo, SW480, and SW620. All positive cell lines are derived from the American Type Culture Collection (ATCC).

[0020] In some implementations, primer pairs and probes for a quality control gene are also included; the quality control gene is actin.

[0021] Further, the quality control gene is β-actin. The primer pair for the quality control gene is a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.4, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5, and the nucleotide sequence of the probe for the quality control gene is shown in SEQ ID NO.6.

[0022] In some implementations, a negative cell line is also included; said negative cell line is 293T. The negative cell line is derived from the American Type Culture Collection (ATCC).

[0023] In some implementations, a negative control is also included; the negative control is normal human genetic DNA.

[0024] In some embodiments, the reporter fluorescent group of the quality control gene probe and the reporter fluorescent group of the LIFR-P probe are each independently selected from one or more of FAM, VIC, CY5, CY3, JOE, and HEX; the reporter quencher group of the quality control gene probe and the reporter quencher group of the LIFR-P probe are each independently selected from one or more of MGB, BHQ1, BHQ2, and TAMRA.

[0025] In some implementations, the results of qPCR using the LIFR-F upstream primer, the LIFR-R downstream primer, and the LIFR-P probe are further defined as follows: if the Ct value of LIFR is >38, the result is determined to be negative for cg08392199 methylation, and the corresponding evaluation result is negative for colorectal cancer; if the Ct value of LIFR is ≤38, the result is determined to be positive for cg08392199 methylation, and the corresponding evaluation result is positive for colorectal cancer.

[0026] In some implementations, the result determination criteria also include: Ct≤36 for the quality control gene, indicating that the amount of DNA template loaded is within the allowable range and the result is reliable; Ct>36 for the quality control gene, indicating that the amount of DNA template loaded is outside the allowable range and the result is unreliable.

[0027] The quality control gene is actin.

[0028] Furthermore, the quality control gene is β-actin.

[0029] In some embodiments, the qPCR is real-time fluorescent qPCR, with the following reaction conditions: 96°C pre-denaturation for 3 minutes; 15 cycles: 95°C denaturation for 15 seconds, 70°C annealing and extension for 20 seconds, 64°C annealing and extension for 20 seconds, and 72°C extension for 10 seconds; 35 cycles: 95°C denaturation for 15 seconds, 70°C annealing and extension for 20 seconds, 60°C annealing and extension for 34 seconds, and 72°C extension for 10 seconds; and fluorescence signal is detected during annealing in all 35 cycles.

[0030] In some implementations, the final concentration of each primer in the qPCR is 0.2–0.3 μM, and the final concentration of the probe is 0.2 μM.

[0031] In some implementations, the qPCR amplification system is as follows: 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of 50×Rox II, final concentration of each primer 0.2–0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to a final volume of 40 μL.

[0032] In some implementations, other reagents required for the qPCR reaction are also included, such as polymerase, buffer, and dNTPs.

[0033] In some embodiments, the polymerase is 2×Premix Ex Taq (Probe qPCR); the buffer is 50×Rox II. 2×Premix Ex Taq (Probe qPCR) contains dNTPs.

[0034] The CpG methylation site cg08392199 of the LIFR gene in this invention is previously unreported. Furthermore, the LIFR site in this invention exhibited the highest specificity for colorectal cancer during TCGA database screening, ranking first. In multi-tumor comparisons, it showed high methylation in colorectal cancer, but lower methylation levels in other tumors (lung cancer, gastric cancer, squamous cell carcinoma of the lung, adenocarcinoma of the lung, and esophageal cancer, etc.), indicating good colorectal cancer specificity for this site. Therefore, this invention provides a novel DNA methylation biomarker for colorectal cancer detection kits.

[0035] The clinical sample for this invention is patient stool, which is convenient to collect, requires a small amount, and is non-invasive to patients. It uses fluorescent qPCR detection technology, and the results directly detect changes during the qPCR process. The entire detection process has been optimized, resulting in fast detection speed and simple steps. Compared with existing methods, it has better sensitivity and more specificity, making it more suitable for early screening of colorectal cancer.

[0036] This invention also relates to the application of a colorectal cancer-related methylation marker in the preparation of a primer-probe combination, wherein the colorectal cancer-related methylation marker includes the CpG methylation site cg08392199 of the LIFR gene; the primer-probe combination is used to detect the colorectal cancer-related methylation marker.

[0037] This invention also relates to the application of a colorectal cancer-related methylation biomarker in the preparation of a kit, and the application of the kit in the preparation of products for detecting colorectal cancer. The colorectal cancer-related methylation biomarker includes the CpG methylation site cg08392199 of the LIFR gene; the kit includes a primer-probe combination; the primer-probe combination is used to detect the colorectal cancer-related methylation biomarker.

[0038] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0039] 1. This invention provides a novel DNA methylation marker in the LIFR gene, which differs from the methylation region of other methods and is a methylation site reported for the first time. Furthermore, this site exhibits high sensitivity and high specificity in the detection of colorectal cancer, with a sensitivity of 91% and a specificity of 100%, while the specificity of other inventions is between 80% and 97%.

[0040] 2. The LIFR site in this invention showed high methylation in colorectal cancer in multi-tumor comparison in the TCGA database, but the methylation level was low in other tumors (lung cancer, gastric cancer, squamous cell carcinoma of the lung, adenocarcinoma of the lung, and esophageal cancer, etc.), indicating that the site has good specificity.

[0041] 3. The test sample of the kit of the present invention is patient feces, which is convenient to collect, requires a small amount, and is non-invasive to patients.

[0042] 4. This invention uses qPCR detection technology, which has the advantages of high sensitivity and specificity of qPCR.

[0043] 5. This invention uses a single-gene, single-primer-pair detection method, targeting nucleic acid fragments of no more than 200 bp. The technology is simple, easy to operate, greatly reduces detection costs, and is easy to promote and apply.

[0044] 6. This invention optimizes the entire detection process. Compared with existing methods, it uses less reagent in the nucleic acid extraction process, simplifies the operation, reduces reagent costs, and ensures the performance requirements of clinical testing.

[0045] This invention overcomes the problems of low sensitivity and insufficient specificity of single-site detection in existing early colorectal cancer detection technologies, and has high sensitivity and specificity for colorectal cancer.

[0046] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0047] Figure 1 This is a comparison chart of LIFR methylation levels across multiple cancer types. On the horizontal axis, "cancer" after the underline represents cancerous tissue, and "normal" represents adjacent tissue.

[0048] Figure 2 This is a box plot analyzing the differences between cancerous tissue and adjacent normal tissue. T represents cancerous tissue; N represents adjacent normal tissue. Detailed Implementation

[0049] The present invention will be further illustrated below with reference to the accompanying drawings, providing some non-limiting embodiments. However, it should be understood that these descriptions are merely illustrative and not intended to limit the scope of the invention. Furthermore, descriptions of common knowledge and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.

[0050] Example 1: Site Screening Process

[0051] The key and challenge of this invention lies in finding novel, previously unreported sites that can both ensure screening specificity and improve detection sensitivity. During the research and development process, methylation numbers were analyzed in nearly 13,000 tumors across more than 30 tumor types using a database. The specific steps are as follows:

[0052] 1. 453 samples (408 tumor samples and 45 normal samples) from the Colorectal adenocarcinoma (COADREAD) database of The Cancer Genome Atlas (TCGA) were selected. A Wilcoxon rank-sum test was performed on 485,578 loci, with threshold conditions set as follows: p-value < 0.01, mean β ≥ 0.2, and Δβ ≥ 0.2. 19,862 loci met the threshold conditions.

[0053] 2. The methylation sites selected in the previous step were compared and analyzed in more than 30 tumors. The area under the ROC curve and the coordinate axis (AUC) were calculated, and the sites were sorted in descending order to select the top 10 sites (see Table 1).

[0054] Table 1. Ranking of highly specific sites in colorectal cancer

[0055]

[0056] 3. The 10 methylation sites with good specificity in colorectal cancer identified in the previous step were further analyzed by comparing the AUC values ​​of cancerous tissue and adjacent tissue. Sites with an AUC ≥ 0.95 and significant differences in methylation levels between cancerous and adjacent tissues were selected, ultimately identifying the cg08392199 site in the LIFR gene (AUC = 0.95, P.value = 1.36E-54, methylation level in cancerous tissue 0.58, methylation level in adjacent tissue 0.23). Further, the methylation levels of the selected cg08392199 (LIFR) site were compared between cancerous and adjacent tissues in multiple cancer types. Figure 1 The results clearly show that this site has good specificity in colorectal cancer, and there are significant differences between cancerous tissue and adjacent tissue.

[0057] Example 2 Probe Primer Design and Screening

[0058] This invention uses plasmids containing nucleotide sequences of methylation sites after sulfite modification of the LIFR gene, and DNA from the positive cell line SW48 and the negative cell line 293T as templates to construct a real-time fluorescent qPCR detection system for LIFR gene methylation. VIC is used as the fluorescent signal detection target. The detection system is optimized by improving primer combinations and fluorescent probes for LIFR gene methylation, thereby achieving rapid and accurate detection. The specific steps are as follows:

[0059] The plasmid is a synthetic plasmid obtained by inserting a pre-designed target gene sequence fragment into a molecular cloning vector plasmid via GenScript. The target gene sequence includes the nucleotide sequence of the methylation site after sulfite modification of the LIFR gene.

[0060] The nucleotide sequence of the methylation site after sulfite modification of the LIFR gene (SEQ ID No. 7, LIFR-SL(cg08392199) contains the cg08392199 site):

[0061] LIFR-SL(cg08392199):

[0062] GCGGAGTAGGGGAGTCGCGGAGTTTCGAGCGGGGTTTTTAGGGGCGGTTCGGGCGGGGTGGGGTAGCGTTTTTAGTTTTGCGGAGCGTTTTAGGGGAGTGATTTCGGAGAGCGTCGTTTCGGGTTTCGTCGTTTTTCGCGCGTTTTTGGGTTATTTTCGTGTT TTGGGGGACGCGGATTTTAGCGTTTAGAATTTTTGTTTTACGTAGGGTAGTGAGTTTTGAGGTTAGAGGTTATTTGGGGGATGGGAGGGAGTTTGAAATGTTTTTTTTTCGGAGAGGTGATTTGTTAGGTGATTTCGTGTTTTTTTGTTTTAATTTTTTTTTA

[0063] The molecular cloning vector plasmid used was pUC57.

[0064] Both the positive cell line SW48 and the negative cell line 293T were derived from the American Type Culture Collection (ATCC).

[0065] 1. For the detection of LIFR gene methylation, 16 pairs of primers and 2 probes were designed using Primer 5 software. Actin (ACTB) was used as a quality control gene (or internal reference gene) for positive cell lines, negative cell lines, tissue or fecal samples (e.g., Examples 2, 3, and 4). Primers ACTB-F and ACTB-R were used as quality control primers, and probe ACTB-P was used as a quality control probe. Commonly used actin includes β-actin, but is not limited to β-actin; α-actin, γ-actin, etc., can also be used.

[0066] Quality control gene forward primer (ACTB-F): 5'-GGTGTTTAAGATAGTGTTGTGGGTG-3' (SEQ ID NO.4)

[0067] Quality control gene reverse primer (ACTB-R): 5'-CACACTCCAAAACCGCTTTACA-3' (SEQ ID NO.5)

[0068] The probe for the quality control gene (ACTB-P) is: 5'-ACCTCATAACCTTATCACAC-3' (SEQ ID NO.6)

[0069] 2. Using 2×10 3 Using the synthesized plasmid as a template, real-time fluorescence qPCR amplification (total volume 40 μL) was performed using different primer and probe combinations according to the following amplification system:

[0070] 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final concentration of the probe (0.2 μM), and DNA template were added, and water was added to bring the total volume to 40 μL.

[0071] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the real-time fluorescence qPCR amplification were from TAKARA.

[0072] The reaction conditions for real-time fluorescence qPCR are as follows:

[0073] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0074] The primer-probe combinations and detection results are shown in Table 2. Five primer-probe combinations for LIFR (combinations 20, 24, 28, 29, and 32) were selected for a second round of probe-primer screening in positive and negative cell lines.

[0075] Table 2. Primer and probe screening results

[0076]

[0077]

[0078] 3. Using 10 ng of DNA from positive cell line SW48 and negative cell line 293T as templates, qPCR amplification was performed using the five LIFR primer and probe combinations selected in the previous step. The qPCR system and reaction conditions were the same as in the previous step.

[0079] The primer-probe combinations and detection results are shown in Table 3. Combination 29 (LIFR-F1, LIFR-R4 and LIFR-P2) was highly methylated in colorectal cancer positive cell lines and unmethylated in colorectal cancer negative cell lines. Furthermore, the amplification curve of this primer-probe combination was "S"-shaped and the fluorescence signal was strong.

[0080] Table 3. Results of Detection of Cell DNA Using Optimal Primers and Probes

[0081] Primer-probe combination Positive cell line results Negative cell line results 20 29.59 38.14 24 29.55 No Ct 28 29.97 No Ct 29 29.05 No Ct 32 29.77 29.96

[0082] Preferred probe primers for LIFR:

[0083] LIFR-F1: 5'-GGAGCGTTTTAGGGGAGTGATT-3' (SEQ ID NO.1)

[0084] LIFR-R4: 5'-CTCTAACCTCAAAACTCACTACCCT-3'(SEQ ID NO.2)

[0085] LIFR-P2: (SEQ ID NO.3, cg08392199 is circled in a box)

[0086] The other sequences in Table 2 are as follows:

[0087] LIFR-F4: 5'-AGTGATTTCGGAGAGCGTCGTTTC-3' (SEQ ID NO.8)

[0088] LIFR-R1: 5'-CCCCCAAATAACCTCTAACC-3' (SEQ ID NO.9)

[0089] LIFR-R2: 5'-CATCCCCCAAATAACCTCTAACC-3' (SEQ ID NO.10)

[0090] LIFR-R3: 5'-ACTCCCTCCCATCCCC-3' (SEQ ID NO.11)

[0091] LIFR-P1: 5'-AGCGTTTAGAATTTTTGTTTTAC-3' (SEQ ID NO.12)

[0092] LIFR-F2: 5'-GGGGAGTGATTTCGGAGAGCGTCG-3' (SEQ ID NO.13)

[0093] LIFR-F3: 5'-CGTGTTTTGGGGGACG-3' (SEQ ID NO.14)

[0094] 4. Sensitivity analysis: The plasmid template was diluted from 10,000 copies to 1 copy, and then detected separately. The results showed that the qPCR method of the present invention has high sensitivity. The primers can detect the corresponding plasmid sample with 5 copies / 40 μL (as shown in Table 4).

[0095] Table 4 Results of plasmid serial dilution

[0096]

[0097] Example 3: Tissue and fecal sample testing

[0098] 1. Using organizations as samples

[0099] Colorectal cancer and adjacent tissue specimens removed surgically or endoscopically were selected, and the methylation level of the LIFR gene was quantitatively detected. The specimens consisted of 11 pairs of paired colorectal cancer and adjacent tissues. The preferred primer-probe combination and real-time fluorescence qPCR reaction system of this invention were used to detect the cancerous tissue and its paired adjacent tissue samples.

[0100] Step 1, Sample processing, DNA extraction and transformation:

[0101] DNA was extracted from tissue cells using a cell DNA extraction kit (purchased from QIAGEN). For specific procedures, please refer to the kit's instruction manual.

[0102] Step 2, sulfite modification:

[0103] The extracted cellular DNA was modified with sulfite using the EZ DNA methylation kit (purchased from ZYMO RESEARCH). For specific procedures, please refer to the kit instructions.

[0104] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0105] 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template (>10 ng) were added, and water was added to bring the volume to 40 μL. The sulfite-modified cellular DNA obtained in step 2 was used as the template.

[0106] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0107] The reaction conditions for real-time fluorescence qPCR are as follows:

[0108] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0109] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0110] In real-time fluorescence qPCR amplification, the fluorescence signal of the reaction system is detected. If the number of cycles (Ct) required for the fluorescence signal of the internal reference gene (actin) to reach the set threshold is ≤36, it indicates that the amount of sample DNA loaded is within the allowable range, and the result is reliable. Under valid detection conditions, if the number of cycles (Ct) required for the fluorescence signal of the LIFR gene to reach the set threshold is ≤38, the sample test result is "positive"; if the CT value of the LIFR gene is >38, the sample test result is "negative".

[0111] The test results (Table 5) show that the sensitivity of LIFR site detection in tissue samples of the present invention is 100%. Figure 2 This indicates that there are significant differences in methylation expression of the LIFR gene between cancerous and adjacent normal tissues.

[0112] Table 5. Results of cancer tissue sample testing

[0113] Sample number ACTB LIFR Result determination 1 26.88 30.54 Positive 2 28.08 29.74 Positive 3 28.53 31.26 Positive 4 26.69 29.01 Positive 5 28.74 31.57 Positive 6 27.96 33.77 Positive 7 26.16 29.35 Positive 8 28.53 29.81 Positive 9 28.66 30.83 Positive 10 28.13 30.12 Positive 11 27.94 28.71 Positive

[0114] 2. Using feces as a sample

[0115] Eighty-seven stool samples were selected, of which 45 were diagnosed with colorectal cancer, 18 with advanced adenomas, and 24 were normal upon colonoscopy. The methylation level of the LIFR gene was quantitatively detected. Using the preferred primer-probe combination and qPCR reaction system of this invention, stool samples from 45 clinical colorectal cancer patients, 18 patients with advanced adenomas, and 24 healthy individuals were analyzed. Sample information is shown in Tables 6-8.

[0116] Table 6 Clinical diagnostic information of fecal samples for colorectal cancer

[0117]

[0118]

[0119]

[0120] Table 7 Clinical diagnostic information from stool samples of advanced adenomas

[0121]

[0122]

[0123] Table 8 Clinical diagnostic information of fecal samples for colorectal cancer

[0124] serial number Clinical diagnosis Sample type NF-001 healthy people fecal samples NF-002 healthy people fecal samples NF-003 healthy people fecal samples NF-004 healthy people fecal samples NF-005 healthy people fecal samples NF-006 healthy people fecal samples NF-007 healthy people fecal samples NF-008 healthy people fecal samples NF-009 healthy people fecal samples NF-010 healthy people fecal samples NF-011 healthy people fecal samples NF-012 healthy people fecal samples NF-013 healthy people fecal samples NF-014 healthy people fecal samples NF-015 healthy people fecal samples NF-016 healthy people fecal samples NF-017 healthy people fecal samples NF-018 healthy people fecal samples NF-019 healthy people fecal samples NF-020 healthy people fecal samples NF-021 healthy people fecal samples NF-022 healthy people fecal samples NF-023 healthy people fecal samples NF-024 healthy people fecal samples

[0125] Experimental procedure:

[0126] Step 1: Collect 1g of fecal sample into 4mL of fecal preservation solution (ZYMO RESEARCH, R1101), vortex to mix, centrifuge at 5000rpm for 10min, collect the supernatant, and perform another centrifugation. Take 1mL of the processed fecal supernatant, add lysis buffer and proteinase K, incubate at 70℃ for 10min, centrifuge, add isopropanol, centrifuge again, remove the supernatant, add elution buffer to obtain crude DNA. Then purify the crude DNA using purification magnetic beads.

[0127] Step 2: Perform sulfite conversion on the extracted DNA sample (EZ DNA methylation Kit, purchased from ZYMO RESEARCH);

[0128] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0129] 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template >10 ng were added, and water was added to bring the volume to 40 μL. The sulfite-modified DNA obtained in step 2 was used as the template.

[0130] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0131] The qPCR reaction conditions are as follows:

[0132] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0133] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0134] The fluorescence signal of the reaction system in qPCR amplification is detected. If the number of cycles (Ct) required for the fluorescence signal of the internal reference gene (actin) to reach the set threshold is ≤36, it indicates that the amount of DNA loaded is within the allowable range and the result is reliable. Under valid detection conditions, if the number of cycles (Ct) required for the fluorescence signal of the LIFR gene to reach the set threshold is ≤38, the sample test result is "positive"; if the CT value of the LIFR gene is >38, the sample test result is "negative".

[0135] Detection results (Table 9): Among 87 stool samples (45 cases of colorectal cancer, 18 cases of advanced adenoma, and 24 normal samples), the detection rate of LIFR loci in the stool DNA samples of the 45 colorectal cancer patients was 91% (41 / 45), the detection rate of LIFR loci in the stool DNA samples of the 18 patients with advanced adenoma was 56% (10 / 18), and the detection rate of LIFR loci in the stool DNA samples of the 24 normal individuals was 0%.

[0136] (0 / 24).

[0137] Therefore, the kit of the present invention has a sensitivity of 56% and a specificity of 100% for detecting advanced adenomas, and a sensitivity of 91% and a specificity of 100% for detecting colorectal cancer.

[0138] Table 9. Results of fecal sample testing

[0139]

[0140] Comparative Example 1

[0141] Based on the screening results in the Cancer Genome Atlas database (Table 1), the cg12587766 locus and the cg08392199 locus in this invention both belong to the LIFR gene. Therefore, primers and probes were designed for cg12587766 (LIFR), and the sequences are as follows:

[0142] LIFR-7766-F:5'-GGGGATTTCGTTCGGGG-3'(SEQ ID NO.15)

[0143] LIFR-7766-R:5'-AACCCCGAAACGACGACC-3'(SEQ ID NO.16)

[0144] LIFR-7766-P:5'-CGTCGCGTTTATTC-3'(SEQ ID NO.17)

[0145] We used a selected primer-probe combination and a real-time fluorescence qPCR reaction system to detect fecal samples from colorectal cancer patients.

[0146] The steps are as follows:

[0147] Forty-one stool samples were selected, of which 16 were colon cancer, 9 were advanced adenomas, and 16 were normal, as determined by colonoscopy. The methylation levels of relevant genes were quantitatively detected.

[0148] Step 1: Collect 1g of fecal sample into 4mL of fecal preservation solution (ZYMO RESEARCH, R1101), vortex to mix, centrifuge at 5000rpm for 10min, collect the supernatant, and perform another centrifugation. Take 1mL of the processed fecal supernatant, add lysis buffer and proteinase K, incubate at 70℃ for 10min, centrifuge, add isopropanol, centrifuge again, remove the supernatant, add elution buffer to obtain crude DNA. Then purify the crude DNA using purification magnetic beads.

[0149] Step 2: Perform sulfite conversion on the extracted DNA sample (EZ DNAmethylation Kit, purchased from ZYMO RESEARCH).

[0150] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0151] 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template >10 ng were added, and water was added to bring the volume to 40 μL. The sulfite-modified DNA obtained in step 2 was used as the template.

[0152] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0153] The qPCR reaction conditions are as follows:

[0154] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0155] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0156] The fluorescence signal of the reaction system in qPCR amplification is detected. If the number of cycles (Ct) required for the fluorescence signal of the internal reference gene (actin) to reach the set threshold is ≤36, it indicates that the amount of DNA loaded is within the allowable range and the result is reliable. Under valid detection conditions, if the number of cycles (Ct) required for the fluorescence signal of the LIFR gene to reach the set threshold is ≤38, the sample test result is "positive"; if the CT value of the LIFR gene is >38, the sample test result is "negative".

[0157] The test results (Table 10) show that the positive detection count of cg08392199 (LIFR), the site used in this invention, in colorectal cancer and advanced adenoma is higher than that of cg12587766 (LIFR). Therefore, cg12587766 (LIFR) is not a preferred site.

[0158] Table 10 Comparative detection results of cg08392199 (LIFR) and cg12587766 (LIFR) in fecal samples.

[0159]

[0160] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. Use of a primer probe combination for detecting a methylation marker of colorectal cancer in the manufacture of a product for detecting colorectal cancer, characterized in that, The methylation marker is any combination of the CpG methylation site cg08392199 and a sequence of the LIFR gene or a fragment thereof; The primer probe combination comprises an LIFR-F upstream primer, an LIFR-R downstream primer and an LIFR-P probe; the LIFR-F upstream primer is LIFR-F1, the LIFR-R downstream primer is LIFR-R4, and the LIFR-P probe is LIFR-P2; wherein the nucleotide sequence of LIFR-F1 is shown as SEQ ID NO. 1, the nucleotide sequence of LIFR-R4 is shown as SEQ ID NO. 2, and the nucleotide sequence of LIFR-P2 is shown as SEQ ID NO.

3.

2. The use of the primer probe combination of claim 1 in the preparation of a kit for detecting methylation markers of colorectal cancer. The kit further comprises a positive control; the positive control comprises a plasmid containing a nucleotide sequence of a methylation site of the LIFR gene after sulfite modification and / or a colorectal cancer cell line; the nucleotide sequence containing the methylation site of the LIFR gene after sulfite modification is shown as SEQ ID NO. 7; the plasmid containing the nucleotide sequence of the methylation site of the LIFR gene after sulfite modification is selected from one of pUC57, pUC57-Kan, pUC57-Simple, pUC57-mini, pUC18, and pUC19; and the colorectal cancer cell line is selected from one of positive cell lines SW48, HCT116, LoVo, SW480, and SW620. It further comprises a primer pair of a quality control gene and a probe of the quality control gene; The quality control gene is beta-actin; the primer pair of the quality control gene comprises a positive control gene forward primer and a negative control gene reverse primer; the nucleotide sequence of the positive control gene forward primer is shown as SEQ ID NO. 4, the nucleotide sequence of the negative control gene reverse primer is shown as SEQ ID NO. 5, and the nucleotide sequence of the probe of the quality control gene is shown as SEQ ID NO.

6.

3. The use of the kit of claim 2 in the preparation of a product for detecting colorectal cancer.

Images