Antigen-binding proteins and their uses

Abstract

The present invention discloses an antigen-binding protein, a nucleic acid encoding the antigen-binding protein of the present invention, a vector comprising the nucleic acid of the present invention, a cell comprising the antigen-binding protein, nucleic acid or vector of the present invention, and a method for preparing the cell of the present invention. The present invention also discloses a conjugate or composition comprising the antigen-binding protein of the present invention, and a method for preventing and / or treating a disease by using the antigen-binding protein or cell of the present invention, and a method for detecting the presence of a disease in a subject.

Description

[0001] This international patent application claims the benefit of Chinese patent application No. 202111043194.X filed on September 7, 2021, the entire contents of which are incorporated herein by reference for all purposes. Technical Field

[0002] The present invention relates to antigen binding proteins, in particular T cell receptors (TCRs), and their uses, in particular in preventing, treating or detecting HPV-positive conditions. Background Art

[0003] Globally, cervical cancer ranks fourth in incidence among female cancers. Almost all cases of cervical cancer are linked to infection with high-risk HPV, with HPV16 being the most common type, accounting for 60% of all high-risk HPV. HPV infection can also lead to cancers such as head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, vulvar cancer, and penile cancer. Currently, there is a lack of effective treatment for HPV infection and the malignancies it causes. Preventive vaccines induce the body to produce specific neutralizing antibodies to resist new viral infections, but they cannot eliminate existing HPV infections. Therapeutic vaccines, currently in clinical trials, can mitigate precancerous lesions to a certain extent, but are unlikely to be effective in treating advanced tumors.

[0004] TCR-T uses corresponding experimental techniques to clone TCRs that can specifically recognize specific HLA-tumor antigen peptide complexes, and then delivers the TCR gene coding sequence to more T cells through gene delivery methods such as lentivirus to give these T cells new antigen recognition specificity. Patient-derived T cells are transduced with TCR genes in vitro and amplified in large quantities, and can effectively recognize tumor cell-specific antigens. These T cells are infused back into the patient and can specifically kill tumor cells and exert anti-tumor activity. Since both intracellular and extracellular antigens can be recognized by TCR after presentation via HLA, TCR-T can target most tumor-specific antigens, especially those that can recognize antigens within tumor cells (about 90% of all antigens). Therefore, TCR-T has the potential to be used in the treatment of almost all tumors, especially various solid tumors.

[0005] The E6 and E7 proteins of the HPV16 virus are important oncogenes that drive the development and progression of cervical cancer. Almost all HPV16-positive tumor cells stably express these two antigens. Effectively identifying and killing E6 and E7-positive tumor cells could effectively treat HPV-related cervical cancer. Previous studies have found that the E6 and E7 antigens of the HPV16 virus can be effectively presented by HLA molecules, making them potential antigenic targets for specific TCRs. Therefore, there is a need to develop TCR products that specifically target HPV16, particularly the HPV16 E7 antigen. SUMMARY OF THE INVENTION

[0007] The present disclosure provides novel antigen binding proteins that specifically bind to HPV16 E7 antigen, particularly HPV16 E7 11-19 Epitope or a complex of said epitope and MHC molecule, such as HPV16 E7 11-19 The antigen-binding protein of the present invention can be in the form of a TCR or an antigen-binding fragment thereof. The antigen-binding protein of the present invention can bind to the target antigen peptide with high affinity, has good expression stability, and can mediate the specific killing of antigen-positive target cells by effector cells.

[0008] Accordingly, in one aspect, the present disclosure provides an antigen binding protein comprising a T cell receptor (TCR) α chain variable region and a TCR β chain variable region, wherein the TCR α chain variable region comprises a CDR3 having the following amino acid sequence: AVISAGTALI (SEQ ID NO: 3), or a functional variant formed by inserting, deleting or substituting one or several amino acids, wherein the antigen binding protein binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope and an MHC molecule.

[0009] On the other hand, the present disclosure provides an antigen binding protein comprising a T cell receptor (TCR) α chain variable region and a TCR β chain variable region, wherein the TCR β chain variable region comprises a CDR3 having the following amino acid sequence: ASSLGWRGGLYTEAF (SEQ ID NO: 8), or a functional variant formed by inserting, deleting or substituting one or several amino acids, wherein the antigen binding protein binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope and an MHC molecule.

[0010] On the other hand, the present disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) α chain variable region and a TCR β chain variable region, wherein the TCR α chain variable region comprises a CDR3 having the following amino acid sequence: AVISAGTALI (SEQ ID NO: 3), or a functional variant formed by inserting, deleting or substituting one or several amino acids; and the TCR β chain variable region comprises a CDR3 having the following amino acid sequence: ASSLGWRGGLYTEAF (SEQ ID NO: 8), or a functional variant formed by inserting, deleting or substituting one or several amino acids, wherein the antigen-binding protein binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope and an MHC molecule.

[0011] In some embodiments, the MHC molecule is of the HLA-A*02 type, such as HLA-A*02:01, HLA-A*02:03, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, HLA-A*02:10, or HLA-A*02:11.

[0012] In some embodiments, the TCR α chain variable region comprises a CDR3 having an amino acid sequence as shown in SEQ ID NO: 3, and / or the TCR β chain variable region comprises a CDR3 having an amino acid sequence as shown in SEQ ID NO: 8.

[0013] In some embodiments, the TCR α chain variable region comprises CDR1, CDR2 and CDR3 having the amino acid sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively, or functional variants formed by inserting, deleting or substituting one or several amino acids; and / or the TCR β chain variable region comprises β chain CDR1, CDR2 and CDR3 having the amino acid sequences shown in SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8, respectively, or functional variants formed by inserting, deleting or substituting one or several amino acids.

[0014] On the other hand, the present disclosure provides an antigen binding protein comprising a T cell receptor (TCR) α chain variable region and a TCR β chain variable region, wherein the TCR α chain variable region comprises CDR1, CDR2 and CDR3 having amino acid sequences as shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively; and / or the TCR β chain variable region comprises β chain CDR1, CDR2 and CDR3 having amino acid sequences as shown in SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8, respectively.

[0015] In some embodiments, the TCR α chain variable region comprises CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively; and the TCR β chain variable region comprises β chain CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8, respectively.

[0016] In some embodiments of the antigen binding proteins of the present disclosure, the TCR alpha chain variable region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95% or 100% sequence identity to SEQ ID NO:4, and / or the TCR beta chain variable region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95% or 100% sequence identity to SEQ ID NO:9.

[0017] In some embodiments, the TCR alpha chain variable region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:4, and the TCR beta chain variable region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:9.

[0018] In some embodiments, the TCR α chain variable region comprises the amino acid sequence shown in SEQ ID NO: 4, and / or the TCR β chain variable region comprises the amino acid sequence shown in SEQ ID NO: 9. In some embodiments, the TCR α chain variable region comprises the amino acid sequence shown in SEQ ID NO: 4, and the TCR β chain variable region comprises the amino acid sequence shown in SEQ ID NO: 9.

[0019] In some embodiments, the TCR alpha chain variable region is contained on a first polypeptide and the TCR beta chain variable region is contained on a second, different polypeptide. In some embodiments, the TCR alpha chain variable region and the TCR beta chain variable region are contained on a single polypeptide.

[0020] In some embodiments, the antigen binding protein is soluble or membrane bound.

[0021] In some embodiments, the antigen binding protein is selected from a TCR, a chimeric antigen receptor (CAR), an Fc polypeptide, or an antigen binding fragment thereof.

[0022] In some embodiments, the antigen binding protein is a TCR or an antigen binding fragment thereof, and the antigen binding protein further comprises a TCR constant region or a fragment thereof.

[0023] In some embodiments, the TCR constant region is a murine constant region or a human constant region.

[0024] In some embodiments, the TCR constant region includes a TCR α chain constant region and / or a TCR β chain constant region; preferably, the TCR α chain constant region and / or the TCR β chain constant region contain at least one cysteine ​​mutation relative to the wild-type sequence to form a disulfide bond between the TCR α chain and the TCR β chain.

[0025] In some embodiments, the TCR alpha chain constant region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 14-19, and / or the TCR beta chain constant region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 21-30.

[0026] In some embodiments, the TCR alpha chain constant region comprises the amino acid sequence shown in SEQ ID NO: 19, and the TCR beta chain constant region comprises the amino acid sequence shown in SEQ ID NO: 26.

[0027] In some embodiments, the fragment of the TCR constant region is the extracellular segment of the TCR constant region.

[0028] In some embodiments, the antigen binding protein further comprises a transmembrane region and / or a cytoplasmic region.

[0029] In some embodiments, the antigen binding protein comprises a TCR alpha chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 32-37; and / or a TCR beta chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 38-47. In some embodiments, the antigen binding protein comprises a TCR alpha chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 32-37; and a TCR beta chain comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 38-47.

[0030] In some embodiments, the antigen binding protein further comprises an intracellular signaling domain. In some embodiments, the antigen binding protein further comprises one or more antigen binding domains that bind to other antigens or epitopes.

[0031] In some embodiments, the antigen binding protein is isolated or purified.

[0032] In yet another aspect, the present disclosure provides nucleic acids encoding the antigen binding proteins of the present disclosure.

[0033] In some embodiments, the nucleic acid comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 5, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 10. In some embodiments, the nucleic acid comprises the amino acid sequence set forth in SEQ ID NO: 5 and the nucleotide sequence set forth in SEQ ID NO: 10.

[0034] In some embodiments, the nucleic acid further comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 20, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 31. In some embodiments, the nucleic acid further comprises the nucleotide sequence set forth in SEQ ID NO: 20 and the nucleotide sequence set forth in SEQ ID NO: 31.

[0035] In another aspect, the present disclosure provides a vector comprising a nucleic acid of the present disclosure.

[0036] In some embodiments, the vector is selected from the group consisting of a lentiviral vector, a retroviral vector, a plasmid, a DNA vector, an mRNA vector, a transposon-based vector, and an artificial chromosome.

[0037] In yet another aspect, the present disclosure provides a cell comprising the antigen binding protein, nucleic acid, or vector according to the present disclosure.

[0038] In some embodiments, the cell is selected from lymphocytes (e.g., T cells, NK cells), monocytes (e.g., PBMCs), and stem cells. In some embodiments, the stem cell is a lymphoid progenitor cell or an induced pluripotent stem cell (iPSC).

[0039] In some embodiments, the cell is a T cell. In some embodiments, the T cell does not express endogenous TCR.

[0040] In another aspect, the present disclosure provides a method for preparing the cell of the present disclosure, comprising the step of transducing or transfecting the cell with the vector of the present disclosure.

[0041] In some embodiments, the method further comprises the step of expanding and / or activating the cells before or after the transduction or transfection.

[0042] In another aspect, the present disclosure provides a conjugate comprising the antigen binding protein of the present disclosure and an active agent coupled or conjugated to the antigen binding protein.

[0043] In some embodiments, the active agent is selected from a detectable label, an immunostimulatory molecule, and a therapeutic agent; preferably, the detectable label is selected from biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, a nucleic acid probe, a contrast agent, and a fluorescent, phosphorescent or chemiluminescent molecule; preferably, the immunostimulatory molecule is selected from a cytokine, a chemokine, a platelet factor, and a complement initiator; preferably, the therapeutic agent is selected from an immunomodulator, a radioactive compound, an enzyme, a chemotherapeutic agent, and a toxin.

[0044] In another aspect, the present disclosure provides a composition comprising the antigen-binding protein, nucleic acid, vector, or cell of the present disclosure. Preferably, the composition further comprises a pharmaceutically acceptable carrier or excipient.

[0045] In some embodiments, the composition further comprises a second therapeutic agent, preferably, the second therapeutic agent is selected from an antibody, a chemotherapeutic agent, and a small molecule drug.

[0046] In yet another aspect, the present disclosure provides a method of treating or preventing an HPV-positive condition in a subject, comprising administering to the subject an effective amount of an antigen binding protein of the present disclosure.

[0047] In another aspect, the present disclosure provides a method of treating or preventing an HPV-positive condition in a subject, comprising administering to the subject an effective amount of a cell of the present disclosure.

[0048] In some embodiments of the disclosed treatment methods, the cells are autologous or allogeneic to the subject.

[0049] In some embodiments, the method comprises the following steps: (i) isolating a sample containing cells from the subject; (ii) transducing or transfecting the cells with a vector disclosed herein; and (iii) administering the cells obtained in step (ii) to the subject. In some embodiments, the method further comprises the step of knocking out the endogenous TCR in the cells after step (i) and before step (ii).

[0050] In some embodiments, the HPV-positive condition is selected from HPV infection, HPV precancer, and HPV cancer. Preferably, the cancer is selected from cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

[0051] In some embodiments, the method further comprises administering a second therapeutic agent, preferably, the second therapeutic agent is selected from an antibody, a chemotherapeutic agent, and a small molecule drug.

[0052] In some embodiments of the disclosed treatment methods, the subject has an HLA-A*02 allele, such as an HLA-A*02:01, HLA-A*02:03, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, HLA-A*02:10, or HLA-A*02:11 allele.

[0053] In another aspect, the present disclosure provides a method for detecting (e.g., diagnosing) an HPV-positive condition in a subject, wherein the method comprises (i) contacting a sample obtained from the subject with an antigen-binding protein, cell, or conjugate of the present disclosure; and (ii) detecting the presence of an HPV antigen in the sample, wherein the presence of the HPV antigen indicates the HPV-positive condition. In some embodiments, the HPV-positive condition is selected from HPV infection, HPV precancer, and HPV cancer. Preferably, the cancer is selected from cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

[0054] In another aspect, the present disclosure provides a kit comprising the antigen-binding protein or conjugate according to the present disclosure, wherein the kit is used to detect the presence of a positive epitope in a test sample, wherein the epitope is an epitope comprising YMLDLQPET (SEQ ID NO: 11).

[0055] In a specific embodiment, the kit is for detecting (e.g., diagnosing) an HPV-positive condition in a subject, comprising an antigen-binding protein or conjugate of the present disclosure. In some embodiments, the HPV-positive condition is selected from HPV infection, HPV precancer, and HPV cancer. The cancer is preferably selected from cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

[0056] In another aspect, the present disclosure provides use of an antigen binding protein, nucleic acid, vector, cell or composition of the present disclosure in the preparation of a medicament for treating or preventing an HPV-positive condition in a subject.

[0057] In yet another aspect, the present disclosure provides an antigen binding protein, nucleic acid, vector, cell or composition of the present disclosure for use in treating or preventing an HPV-positive disorder in a subject.

[0058] In another aspect, the present disclosure provides use of the antigen-binding protein or conjugate of the present disclosure in preparing a kit for detecting (e.g., diagnosing) the presence of a positive epitope in a test sample, wherein the epitope is an epitope comprising YMLDLQPET (SEQ ID NO: 11), for example, for detecting (e.g., diagnosing) an HPV-positive condition in a subject.

[0059] In another aspect, the present disclosure provides an antigen-binding protein or conjugate of the present disclosure, which is used to detect (e.g., diagnose) the presence of a positive epitope in a test sample, wherein the epitope is an epitope comprising YMLDLQPET (SEQ ID NO: 11), for example, detecting (e.g., diagnosing) an HPV-positive condition in a subject.

[0060] In some embodiments of the uses of the present disclosure, the HPV-positive condition is selected from HPV infection, HPV precancer, and HPV cancer. Preferably, the cancer is selected from cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer. In some embodiments, the cancer is HPV16 positive. In some embodiments, the subject has an HLA-A*02:01 allele, such as HLA-A*02:01, HLA-A*02:03, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, HLA-A*02:10, or HLA-A*02:11 allele. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 The screening process and initial characterization of HPV16 E7-specific TCRs are shown. (A) Screening and cloning of HPV16 E7-specific TCRs; (B) Flow cytometry confirmed that the HPV16 E7-specific TCR (CRTE7A2) specifically recognizes HPV16 E7 presented by HLA-A*02:01. 11-19 Epitope.

[0062] Figure 2 The binding affinity of CRTE7A2 to the target antigen peptide (YMLDLQPET) (SEQ ID NO: 11) determined by flow cytometry is shown. KITE-439 was used as a control.

[0063] Figure 3 Shown are the phenotypes of CRTE7A2 and KITE-439 TCR-T cells determined by flow cytometry.

[0064] Figure 4 Figure 2 shows the specific killing of antigen-positive tumor cells by CRTE7A2 TCR-T cells. (A) Killing effect of CRTE7A2 TCR-T cells on positive and negative target cells; (B) Killing effect of CRTE7A2 TCR-T cells on antigen-positive tumor cells. KITE-439 TCR-T cells were used as a control.

[0065] Figure 5 The specific killing effect of CRTE7A2 TCR-T cells on antigen-positive tumor cells was shown as determined by IFN-γ secretion assay.

[0066] Figure 6 The results show that CRTE7A2 TCR-T cells specifically secrete IFN-γ in response to antigen-positive tumor cells. KITE-439 TCR-T cells were used as a control.

[0067] Figure 7 Figure 2 shows the specific IFN-γ secretion of CRTE7A2 TCR-T cells against antigen-positive target cells as determined by ELISpot assay. Each group was repeated at least twice.

[0068] Figure 8 Antigen-specific proliferation of CRTE7A2 TCR-T cells is shown.

[0069] Figure 9 The results showed that CRTE7A2 TCR-T cells have anti-tumor activity against Hela cell xenografts in vivo. Detailed Description of the Invention

[0071] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, the terms used herein are as in Janeway CA Jr, Travers P, Walport M et al., Immunobiology, 5th edition, New York: Garland Science (2001) and "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, HGW, Nagel, B. and Definitions as described in H., ed. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland.

[0072] It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, the terms "a," "an," "one or more," and "at least one" can be used interchangeably. Similarly, the terms "comprising," "including," and "having" can be used interchangeably.

[0073] When the term "comprising" is used herein and in the appended claims, it does not exclude other elements. For the purposes of the present invention, the term "consisting of" is considered to be a preferred embodiment of the term "comprising". If a group is defined hereinafter as comprising or containing at least a certain number of embodiments, it should also be understood to disclose a group that preferably consists only of these embodiments.

[0074] In one aspect, the present disclosure provides an antigen binding protein comprising a T cell receptor (TCR) α chain variable region and a TCR β chain variable region, wherein the TCR α chain variable region comprises a CDR3 having the following amino acid sequence: AVISAGTALI (SEQ ID NO: 3), or a functional variant formed by inserting, deleting or substituting one or several amino acids, wherein the antigen binding protein binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope and an MHC molecule.

[0075] On the other hand, the present disclosure provides an antigen binding protein comprising a T cell receptor (TCR) α chain variable region and a TCR β chain variable region, wherein the TCR β chain variable region comprises a CDR3 having the following amino acid sequence: ASSLGWRGGLYTEAF (SEQ ID NO: 8), or a functional variant formed by inserting, deleting or substituting one or several amino acids, wherein the antigen binding protein binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope and an MHC molecule.

[0076] On the other hand, the present disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) α chain variable region and a TCR β chain variable region, wherein the TCR α chain variable region comprises a CDR3 having the following amino acid sequence: AVISAGTALI (SEQ ID NO: 3), or a functional variant formed by inserting, deleting or substituting one or several amino acids; and the TCR β chain variable region comprises a CDR3 having the following amino acid sequence: ASSLGWRGGLYTEAF (SEQ ID NO: 8), or a functional variant formed by inserting, deleting or substituting one or several amino acids, wherein the antigen-binding protein binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of the epitope and an MHC molecule.

[0077] As used herein, the term "antigen binding protein" refers to a protein or polypeptide comprising at least one TCR alpha chain CDR3 (CDR3α) and / or at least one TCR beta chain CDR3 (CDR3β) as disclosed herein and capable of binding to the antigenic target HPV E7. Further contemplated herein are antigen binding proteins comprising at least one CDR1α, CDR2α, CDR1β, CDR2β, alpha chain variable region, beta chain variable region, alpha chain and / or beta chain, or combinations thereof, optionally in combination with other protein domains or portions listed herein.

[0078] As used herein, the term "functional variant" refers to a polypeptide that has significant sequence identity to a parent polypeptide and retains the biological activity of the parent polypeptide. Functional variants encompass, for example, variants of the polypeptides or proteins described herein that retain the ability to specifically bind to the HPV16 E7 antigen to a degree similar to that of the parent polypeptide, to the same degree as that of the parent polypeptide, or to a greater degree than that of the parent polypeptide. The amino acid sequence of the functional variant may, for example, have at least about 50%, 75%, 80%, 90%, 95%, 96%, 97%, 98%, 98.2%, 98.4%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity to the amino acid sequence of the parent polypeptide.

[0079] The term "epitope" generally refers to a site on an antigen, typically a (poly)peptide that a binding domain recognizes. The term "binding domain" refers in its broadest sense to an "antigen binding site," i.e., a domain that characterizes a molecule that binds to / interacts with a specific epitope on an antigen target. An antigen target can comprise a single epitope, but typically comprises at least two epitopes, and depending on the size, conformation, and type of the antigen, the antigen target can comprise any number of epitopes. The term "epitope" generally includes linear epitopes and conformational epitopes. A linear epitope is a continuous epitope contained in the primary sequence of amino acids, and it typically includes at least 2 amino acids or more amino acids. A conformational epitope is formed by non-continuous amino acids that are arranged side by side by the folding of the target antigen, and particularly the target (poly)peptide.

[0080] In the context of the present invention, the term "binding domain" refers in particular to the variable region of the TCR alpha and / or beta chain, in particular CDR3alpha and CDR3beta of the TCR.

[0081] As used herein, the term "T cell receptor" or "TCR" includes native TCRs as well as TCR variants, fragments, and constructs. Thus, the term includes heterodimers, multimers, and single-chain constructs comprising a TCR α chain and a TCR β chain; optionally comprising other domains and / or portions, as long as the antigen binding protein retains its ability to recognize its antigen target (preferably in complex with HLA-A*02).

[0082] In its native form, the TCR exists as a complex of several proteins on the surface of the T cell. The T cell receptor consists of two (separate) protein chains, which are produced by independent T cell receptor α and β (TCRα and TCRβ) genes and are called α chain and β chain. Each chain of the TCR has an N-terminal immunoglobulin-like (Ig)-variable (V) region / domain, an Ig-constant (C) region / domain, a transmembrane / cell membrane spanning region that anchors the chain in the plasma membrane, and a short cytoplasmic tail at the C-terminus.

[0083] Antigen specificity is conferred by the variable regions of the α and β chains. Both variable regions of the TCR α and β chains contain three hypervariable or complementarity-determining regions (CDR1α / β, CDR2α / β, and CDR3α / β) surrounded by framework (FR) regions. CDR3 is the primary determinant of antigen recognition and specificity (i.e., the ability to recognize and interact with a specific antigen), while CDR1 and CDR2 primarily interact with the MHC molecules that present the antigenic peptide.

[0084] Natural TCR recognizes antigenic peptides that are bound to major histocompatibility complex (MHC) molecules at the surface of antigen-presenting cells ("presented / displayed on MHC molecules"). Antigenic peptides presented on MHC molecules are also referred to herein as "complexes of epitopes and MHC molecules," "epitope-MHC complexes," or "target antigen peptide-MHC complexes." There are two different classes of MHC molecules: MHC I and MHC II, which present peptides from different cell compartments. MHC class I molecules are expressed on the surface of all nucleated cells in the human body and display peptides or protein fragments from intracellular compartments to cytotoxic T cells. In humans, MHC is also known as human leukocyte antigen (HLA). There are three main types of MHC class I: HLA-A, HLA-B, and HLA-C. Once the TCR binds to its specific epitope-MHC complex, the T cell is activated and exerts biological effector functions.

[0085] As will be discussed in detail below, the TCRs provided herein are advantageously able to (specifically) recognize HPV16 E7 antigens, in particular HPV16 E7 11-19 Epitope or a complex of said epitope and MHC molecule, such as HPV16 E7 11-19 Complex of epitope with HLA-A*02.

[0086] In some embodiments of the antigen binding proteins of the present disclosure, the MHC molecule is of the HLA-A*02 type, such as HLA-A*02:01, HLA-A*02:03, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, HLA-A*02:10, or HLA-A*02:11.

[0087] In some embodiments, the TCR α chain variable region comprises a CDR3 having an amino acid sequence as shown in SEQ ID NO: 3, and / or the TCR β chain variable region comprises a CDR3 having an amino acid sequence as shown in SEQ ID NO: 8.

[0088] As previously mentioned, the CDR1 and CDR2 of the TCR α and β chains are believed to be primarily involved in MHC recognition. There is a limited "pool" of CDR1 and CDR2 sequences known to be involved in HLA-A*02-restricted antigen recognition, and it is contemplated that the CDR3 domain of the present invention can, in principle, be combined with any of the CDR1 and CDR2 sequences set forth in SEQ ID NOs: 1-2 and 6-7, provided that the antigen-binding protein retains its ability to recognize the antigen target (preferably in complex with HLA-A*02) to a degree similar to, the same as, or even greater than that of the TCRs evaluated in the accompanying Examples. Examples of useful CDR1 and CDR2 domains include CDR1α comprising or consisting of the sequence set forth in SEQ ID NO: 1, CDR2α comprising or consisting of the sequence set forth in SEQ ID NO: 2, CDR1β comprising or consisting of the sequence set forth in SEQ ID NO: 6, and CDR2β comprising or consisting of the sequence set forth in SEQ ID NO: 7.

[0089] In some embodiments, the TCR α chain variable region comprises CDR1, CDR2 and CDR3 having the amino acid sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively, or functional variants formed by inserting, deleting or substituting one or several amino acids; and / or the TCR β chain variable region comprises β chain CDR1, CDR2 and CDR3 having the amino acid sequences shown in SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8, respectively, or functional variants formed by inserting, deleting or substituting one or several amino acids.

[0090] In another aspect, the present disclosure provides an antigen-binding protein comprising a T cell receptor (TCR) α chain variable region and a TCR β chain variable region, wherein the TCR α chain variable region comprises CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; and / or the TCR β chain variable region comprises β chain CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively. In some embodiments, the TCR α chain variable region comprises CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; and the TCR β chain variable region comprises β chain CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

[0091] In some embodiments of the antigen binding proteins of the present disclosure, the TCR alpha chain variable region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:4.

[0092] In some embodiments of the antigen binding proteins of the present disclosure, the TCR β chain variable region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:9.

[0093] As used herein, the term "sequence identity" refers to the extent to which two (nucleotide or amino acid) sequences have the same residue at the same position in an alignment, and is typically expressed as a percentage. Preferably, identity is determined over the entire length of the sequences being compared. Thus, two copies of exactly the same sequence have 100% identity, but sequences that are less highly conserved and have deletions, additions, or substitutions may have a lower degree of identity. Those skilled in the art will recognize that several algorithms can be used to determine sequence identity using standard parameters, such as Blast (Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402), Blast2 (Altschul et al. (1990) J. Mol. Biol. 215: 403-410), Smith-Waterman (Smith et al. (1981) J. Mol. Biol. 147: 195-197), and ClustalW.

[0094] Thus, the amino acid sequence of SEQ ID NO: 4 or 9 can be used as a "subject sequence" or "reference sequence," while a TCR α chain or β chain variable region amino acid sequence that differs therefrom can be used as a "query sequence."

[0095] In some embodiments, the TCR α chain variable region comprises the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the TCR β chain variable region comprises the amino acid sequence set forth in SEQ ID NO: 9.

[0096] In some embodiments, the TCR alpha chain variable region is contained on a first polypeptide and the TCR beta chain variable region is contained on a second, different polypeptide. In some embodiments, the TCR alpha chain variable region and the TCR beta chain variable region are contained on a single polypeptide.

[0097] In some embodiments, the antigen binding protein is soluble or membrane bound.

[0098] The antigen-binding proteins of the present invention can be provided in a soluble form, for example, in the form of a soluble TCR. Soluble TCR (sTCR) can be used as a diagnostic tool and a carrier or "adapter" for specifically targeting therapeutic agents or effector cells to, for example, cancer cells expressing an antigen target recognized by a soluble TCR. A soluble TCR is typically a fragment or construct comprising a TCR α chain and / or β chain or its variable region or CDR, and optionally it is stabilized by a disulfide bond or covalently linked by a suitable linker. Typically, a soluble TCR does not include, for example, a transmembrane region.

[0099] The antigen binding proteins of the present invention can also be provided in a membrane-bound form, for example, in the form of a membrane-bound TCR. Typically, a membrane-bound TCR includes a transmembrane region to anchor it to the cell membrane.

[0100] In some embodiments, the antigen binding protein is selected from a TCR, a chimeric antigen receptor (CAR), an Fc polypeptide, or an antigen binding fragment thereof.

[0101] In some embodiments, the antigen binding protein is a TCR or an antigen binding fragment thereof, and the antigen binding protein further comprises a TCR constant region or a fragment thereof.

[0102] As used herein, the term "constant region" can be a human constant region or derived from another species, thereby creating a "chimeric" TCR. For example, the human α and / or β chains can be replaced with their murine counterparts ("murinization"), which have been found to enhance surface expression of the human TCR by supporting preferential pairing of the TCR α and β chains and to enhance more stable binding to the CD3 co-receptor.

[0103] In some embodiments, the TCR constant region is a murine constant region or a human constant region.

[0104] It has been reported that the addition of disulfide bonds in the constant region can promote the correct pairing of TCRα and β chains (Kuball J et al. Blood. 2007 Mar 15; 109(6): 2331-8). Therefore, the present invention also contemplates the addition of one or more cysteine ​​modifications in the constant region to form a disulfide bond between the TCRα chain and the TCRβ chain.

[0105] In some embodiments, the TCR constant region includes a TCR α chain constant region and / or a TCR β chain constant region; preferably, the TCR α chain constant region and / or the TCR β chain constant region contain at least one cysteine ​​mutation relative to the wild-type sequence to form a disulfide bond between the TCR α chain and the TCR β chain.

[0106] In some embodiments, the cysteine ​​mutation is at one or more of the following positions: position 48 of the wild-type human TCR α chain constant region, position 48 of the wild-type mouse TCR α chain constant region, position 57 of the wild-type human TCR β chain constant region, and position 57 of the wild-type mouse TCR β chain constant region.

[0107] The sequence of the wild-type TCR constant region can be found in the public database of the International Immunogenetics Information System (IMGT), such as the constant domain sequence of the TCR molecule α chain is "TRAC*01", and the constant domain sequence of the TCR molecule β chain is "TRBC1*01" or "TRBC2*01".

[0108] To facilitate the description of the position of the cysteine ​​mutation, the position of the wild-type TCR constant region amino acid sequence in the present invention is numbered according to the nomenclature of the International Immunogenetics Information System (IMGT). For example, if an amino acid in the TCRα chain constant region (TRAC) is numbered 48 in the position listed in IMGT, it will be described herein as the 48th amino acid in the TCRα chain constant region (TRAC); if an amino acid in the TCRβ chain constant region (TRBC) is numbered 57 in the position listed in IMGT, it will be described herein as the 57th amino acid in the TCRβ chain constant region (TRBC), and so on. Herein, the position numbering of the amino acid sequences of the variable regions TRAV and TRBV follows the position numbering listed in IMGT. If an amino acid in TRAV is numbered 46 in the position listed in IMGT, it will be described herein as the 46th amino acid in TRAV, and so on. In the present invention, if the sequence position numbering of other amino acids is specially specified, it shall be as specified.

[0109] In some embodiments, the TCR α chain constant region further comprises an LVL mutation or an LIV mutation, such that the constant region (and / or transmembrane region) comprises the amino acid sequence L L VI VL For example, when the TCRα chain comprises a human constant region, the human constant region may comprise an LVL mutation such that the constant region (and / or transmembrane region) comprises the amino acid sequence L L VI VL When the TCRα chain comprises a murine constant region, the murine constant region may comprise an LIV mutation such that the constant region (and / or transmembrane region) comprises the amino acid sequence L L V IV LRIL.

[0110] In some embodiments, the TCR alpha chain constant region comprises an amino acid sequence having at least 80%, at least 85%, at least 90% at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 14-19, and / or the TCR beta chain constant region comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 21-30.

[0111] In some embodiments, the TCR alpha chain constant region comprises the amino acid sequence shown in SEQ ID NO: 19, and the TCR beta chain constant region comprises the amino acid sequence shown in SEQ ID NO: 26.

[0112] In some embodiments, the fragment of the TCR constant region is the extracellular segment of the TCR constant region.

[0113] In some embodiments, the antigen-binding proteins is a TCR comprising α chain and β chain. In some cases, TCR α chain and / or β chain can include a leader sequence. For example, the leader sequence of TCR α chain can have the amino acid sequence (MISLRVLLVILWLQLSWVWSQ) as shown in SEQ ID NO: 12. The leader sequence of TCR β chain can have the amino acid sequence (MGPGLLCWALLCLLGAGLV) as shown in SEQ ID NO: 13. The leader sequence of TCR α chain can be encoded by the nucleotide sequence (ATGATATCCTTGAGAGTTTTACTGGTGATCCTGTGGCTTCAGTTAAGCTGGGTTTGGAGCCAA) shown in SEQ ID NO: 48. The leader sequence of TCR β chain can be encoded by the nucleotide sequence (ATGGGCCCCGGGCTCCTCTGCTGGGCACTGCTTTGTCTCCTGGGAGCAGGCTTAGTG) shown in SEQ ID NO: 49.

[0114] In some embodiments, the antigen binding protein further comprises a transmembrane region and / or a cytoplasmic region.

[0115] In some embodiments, the antigen binding protein comprises a TCR alpha chain comprising an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs: 32-37; and / or a TCR beta chain comprising an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs: 38-47.

[0116] In some embodiments, the antigen binding protein further comprises an intracellular signaling domain. In some embodiments, the antigen binding protein further comprises one or more antigen binding domains that bind to other antigens or epitopes.

[0117] In some embodiments, the antigen binding protein is isolated or purified.

[0118] As used herein, the term "isolated or purified" means that the antigen-binding protein has been identified, separated and / or recovered from the components of its production environment so that the "isolated or purified" antigen-binding protein is free of or substantially free of other contaminant components from its production environment that may interfere with its therapeutic or diagnostic use. Contaminant components may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. Thus, an "isolated or purified" antigen-binding protein can be prepared by at least one purification step that removes or substantially removes these contaminant components. In another aspect, the present disclosure provides nucleic acids encoding the antigen-binding proteins of the present disclosure.

[0119] In some embodiments, the nucleic acid comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:5, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:10. In some embodiments, the nucleic acid further comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:20, and / or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:31.

[0120] In another aspect, the present disclosure provides a vector comprising a nucleic acid of the present disclosure.

[0121] As used herein, the term "vector" is a nucleic acid molecule used as a medium for transferring (exogenous) genetic material to a host cell, in which the nucleic acid molecule as a vector can be, for example, replicated and / or expressed. The term "vector" encompasses, but is not limited to, plasmids, viral vectors (including retroviral vectors, slow viral vectors, adenoviral vectors, vaccinia virus vectors, polyoma virus vectors, and adenovirus-associated vectors (AAV)), bacteriophages, phagemids, cosmids, and artificial chromosomes (including BACs and YACs). The vector itself is typically a nucleotide sequence, typically a DNA sequence comprising an insert (transgene) and a larger sequence as a vector "skeleton." Engineered vectors are typically included in the starting point (if stable expression of polynucleotides is desired) for autonomous replication in the host cell, a selective marker, and a restriction enzyme cleavage site (such as a multiple cloning site, MCS). The vector can additionally include a promoter, a genetic marker, a reporter gene, a targeting sequence, and / or a protein purification tag. As known to those skilled in the art, a large amount of suitable vectors are known to those skilled in the art, and many are commercially available. Examples of suitable vectors are provided in J. Sambrook et al., Molecular Cloning: A Laboratory Manual (4th ed.), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2012), which is incorporated herein by reference in its entirety.

[0122] In some embodiments, the vector is preferably selected from the group consisting of a lentiviral vector, a retroviral vector, a plasmid, a DNA vector, an mRNA vector, a transposon-based vector, and an artificial chromosome.

[0123] In yet another aspect, the present disclosure provides a cell comprising the antigen binding protein, nucleic acid, or vector according to the present disclosure.

[0124] As used herein, the term "cell" refers to any type of cell capable of expressing the antigen-binding proteins of the present invention. The cell can be a eukaryotic cell, for example, a plant (not having the potential to develop into a plant), an animal, a fungus or an algae, or can be a prokaryotic cell, for example, a bacterium or a protozoan. The cell can be a cultured cell or a primary cell, i.e., directly isolated from an organism, such as a human. The cell can be an adherent cell or a suspension cell, i.e., a cell grown in suspension. Suitable host cells are known in the art and include, for example, DH5α Escherichia coli cells, Chinese hamster ovary cells, monkey VERO cells, COS cells, HEK293 cells, etc. For the purpose of producing the antigen-binding proteins of the present invention, the cell is preferably a mammalian cell. Most preferably, the host cell is a human cell.

[0125] In some embodiments, the cell is selected from lymphocytes (such as T cells, NK cells), monocytes (such as PBMCs) and stem cells. As used herein, the term "stem cell" is a stem cell for expressing antigen-binding proteins (particularly TCR) of the present disclosure. For example, stem cells can be lymphocyte progenitor cells, induced pluripotent stem cells (iPSCs) or hematopoietic stem cells (HSCs). In some embodiments, stem cells do not include embryonic stem cells obtained by destroying human embryos, and / or do not include totipotent stem cells for developing and forming individual animals. Gene transfer to stem cells does not usually result in TCR expression on the cell surface, because the stem cell surface does not express CD3 molecules. However, when stem cells differentiate into lymphoid precursors (lymphoid precursors) that migrate to the thymus, the expression of CD3 molecules will start expressing the introduced TCR molecules on the surface of thymocytes.

[0126] In some embodiments, the stem cell is a lymphoid progenitor cell or an induced pluripotent stem cell (iPSC).

[0127] In some embodiments, the cell is a T cell. The T cell can be any T cell, such as a cultured T cell, for example, a primary T cell or a T cell from a cultured T cell line, such as Jurkat, SupT1, etc., or a T cell obtained from a mammal. If obtained from a mammal, the T cell can be obtained from many sources, including but not limited to blood, bone marrow, lymph nodes, thymus, or other tissues or liquids. The T cell can also be enriched or purified. Preferably, the T cell is a human T cell. More preferably, the T cell is a T cell separated from people. The T cell can be any type of T cell and can be a T cell at any stage of development, including but not limited to CD4+ / CD8+ double positive T cells, CD4+ helper T cells, such as Th1 and Th2 cells, CD4+T cells, CD8+T cells (e.g., cytotoxic T cells), tumor infiltrating lymphocytes (TIL), memory T cells (e.g., central memory T cells and effector memory T cells), naive T cells, etc. In some embodiments, the T cell does not express endogenous TCR.

[0128] It is envisaged that effector cells expressing an antigen binding protein (e.g., TCR) as described herein bind with high avidity to their antigen target (preferably HPV16 E7 presented by antigen presenting cells on HLA-A*02). 11-19Epitope). The term "avidity" or "binding affinity" refers to the ability of cells expressing antigen-binding proteins (particularly T cells expressing TCR as described herein) to respond to a given concentration of ligand in vitro, and is believed to be related to the in vivo effector capacity of cells expressing antigen-binding proteins (such as TCR). By definition, cells expressing antigen-binding proteins (such as TCR) with high binding affinity respond to very low antigen doses in in vitro tests, while such cells with lower binding affinity require a higher amount of antigen before reaching an immune response similar to that of cells expressing antigen-binding proteins (such as TCR) with high affinity. Therefore, binding affinity can be considered as a quantitative determinant of the activation threshold of cells expressing antigen-binding proteins (such as TCR). This is measured by exposing such cells to different amounts of cognate antigens in vitro. Cells expressing antigen-binding proteins (such as TCR) with high binding affinity respond to low antigen doses. For example, a TCR-expressing cell is generally considered to bind its antigen target with "high" binding affinity if it secretes at least about 200 pg / mL or more (e.g., 200 pg / mL or more, 300 pg / mL or more, 400 pg / mL or more, 500 pg / mL or more, 600 pg / mL or more, 700 pg / mL or more, 1000 pg / mL or more, 5,000 pg / mL or more, 7,000 pg / mL or more, 10,000 pg / mL or more, or 20,000 pg / mL or more) interferon gamma (IFN-γ) when co-cultured with antigen-negative HLA-*02-expressing target cells.

[0129] In another aspect, the present disclosure provides a method for preparing the cell of the present disclosure, comprising the step of transducing or transfecting the cell with the vector of the present disclosure.

[0130] As used herein, the term "transfection" is a process in which a nucleic acid molecule or polynucleotide (including a vector) is intentionally introduced into a target cell. An example is RNA transfection, which is the process of introducing RNA (e.g., in vitro transcribed RNA, ivtRNA) into a host cell. This term is primarily used for non-viral methods in eukaryotic cells. The term "transduction" is typically used to describe viral-mediated transfer of nucleic acid molecules or polynucleotides. Transfection of animal cells typically involves opening a transient pore or "hole" in the cell membrane to allow the uptake of material. Transfection can be performed using calcium phosphate, by electroporation, by cell extrusion, or by mixing cationic lipids with materials to produce liposomes that fuse with the cell membrane and deposit their cargo inside. Exemplary techniques for transfecting eukaryotic host cells include lipid vesicle-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (calcium phosphate / DNA co-precipitation), microinjection, and electroporation.

[0131] In some embodiments, the method further comprises the step of expanding and / or activating the cells before or after the transduction or transfection.

[0132] In another aspect, the present disclosure provides a conjugate comprising the antigen binding protein of the present disclosure and an active agent coupled or conjugated to the antigen binding protein.

[0133] In some embodiments, the active agent is selected from a detectable label, an immunostimulatory molecule, and a therapeutic agent. Preferably, the detectable label is selected from biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, a nucleic acid probe, a contrast agent, and a fluorescent, phosphorescent, or chemiluminescent molecule. Preferably, the immunostimulatory molecule is selected from a cytokine (such as IL-2 and IFN-γ), a chemokine (such as IL-8), a platelet factor (such as platelet factor 4), and a complement initiator. Preferably, the therapeutic agent is selected from an immunomodulator, a radioactive compound, an enzyme, a chemotherapeutic agent, and a toxin. Other suitable therapeutic agents include small molecule cytotoxic agents, i.e., compounds with the ability to kill mammalian cells with a molecular weight of less than 700 daltons. Such compounds may also contain toxic metals that can have cytotoxic effects. In addition, it should be understood that these small molecule cytotoxic agents also include prodrugs, i.e., compounds that decay or are converted to release cytotoxic agents under physiological conditions. Examples of such agents include cisplatin, maytansine derivatives, rachelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, pyroximate, temozolomide, topotecan, trimetrexate glucuronide, auristatin E, vincristine, and doxorubicin; peptide cytotoxins, i.e., proteins or fragments thereof that have the ability to kill mammalian cells; for example, ricin, diphtheria toxin, Pseudomonas bacterial exotoxin A, DNA e and RNase; radionuclides, i.e., unstable isotopes of elements that emit one or more alpha or beta particles or gamma rays while decaying, for example, iodine-131, rhenium-186, indium-111, yttrium-90, bismuth-210 and -213, actinium-225 and astatine-213; chelating agents that can be used to promote the binding of these radionuclides to molecules or polymers thereof; or heterologous protein domains, allologous protein domains, viral / bacterial protein domains, viral / bacterial peptides.

[0134] In another aspect, the present disclosure provides a composition comprising the antigen-binding protein, nucleic acid, vector, or cell of the present disclosure. Preferably, the composition further comprises a pharmaceutically acceptable carrier or excipient.

[0135] The term "composition" particularly refers to a composition suitable for administration to humans. However, the term also generally encompasses compositions suitable for administration to non-human animals. The composition and its components (i.e., the active agent and optional carrier or excipient) are preferably pharmaceutically acceptable, i.e., capable of eliciting the desired therapeutic effect in the recipient without causing any undesirable local or systemic effects. The pharmaceutically acceptable compositions of the present invention may, for example, be sterile. Specifically, the term "pharmaceutically acceptable" may mean approved by a regulatory agency or other recognized pharmacopoeia for use in animals, more particularly in humans.

[0136] The term "excipient" includes fillers, binders, disintegrants, coating agents, adsorbents, antiadherents, glidants, preservatives, antioxidants, flavorings, coloring agents, sweeteners, solvents, cosolvents, buffers, chelating agents, viscosity imparting agents, surfactants, diluents, wetting agents, carriers, diluents, preservatives, emulsifiers, stabilizers and tension regulators. It is known to those skilled in the art that suitable excipients are selected to prepare compositions of the present invention. Exemplary carriers for compositions of the present invention include saline, buffered saline, glucose and water. Usually, the selection of suitable excipients especially depends on the desired dosage form of the activating agent used, the disease to be treated and the compositions.

[0137] Depending on the active agent employed (e.g., soluble TCR), the compositions of the present disclosure may be prepared in various forms, such as solid, liquid, gaseous, or lyophilized forms, particularly in the form of ointments, creams, transdermal patches, gels, powders, tablets, solutions, aerosols, granules, pills, suspensions, emulsions, capsules, syrups, liquids, elixirs, extracts, tinctures, or fluid extracts, or in a form particularly suitable for the desired method of administration. Processes known in the art for producing pharmaceuticals are shown in the 22nd edition of Remington's Pharmaceutical Sciences (Ed. Maack Publishing Co, Easton, Pa., 2012), and may include, for example, conventional mixing, dissolving, granulating, sugar-coating, grinding, emulsifying, encapsulating, embedding, or lyophilizing processes. Compositions comprising, for example, host cells or soluble TCRs as described herein are typically provided in liquid form and preferably contain a pharmaceutically acceptable buffer.

[0138] In some embodiments, the compositions of the present disclosure further comprise a second therapeutic agent, preferably, the second therapeutic agent is selected from an antibody, a chemotherapeutic agent, and a small molecule drug.

[0139] Preferred examples of the second therapeutic agent include known anticancer drugs such as cisplatin, maytansine derivatives, rachelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, sorfimer sodium photofrin II, temozolomide, topotecan, trimetreate glucuronate, auristatin E, E), vincristine and doxorubicin; and peptide cytotoxins, such as ricin, diphtheria toxin, Pseudomonas bacterial exotoxin A, DNA enzymes and RNA enzymes; radionuclides, such as iodine-131, rhenium-186, indium-111, iridium-90, bismuth-210 and 213, actinium-225 and astatine-213; prodrugs, such as antibody-directed enzyme prodrugs; immunostimulants, such as IL-2, chemokines such as IL-8, platelet factor 4; antibodies or fragments thereof, such as anti-CD3 antibodies or fragments thereof; complement activators; heterologous protein domains, homologous protein domains, viral / bacterial protein domains and viral / bacterial peptides.

[0140] In yet another aspect, the present disclosure provides a method of treating or preventing an HPV-positive condition in a subject, comprising administering to the subject an effective amount of an antigen binding protein of the present disclosure.

[0141] In another aspect, the present disclosure provides a method of treating or preventing an HPV-positive condition in a subject, comprising administering to the subject an effective amount of a cell of the present disclosure.

[0142] As used herein, the term "treatment" includes therapeutic or prophylactic treatment in a subject in need thereof. "Therapeutic or prophylactic treatment" includes prophylactic treatment intended to completely prevent clinical and / or pathological manifestations or therapeutic treatment intended to ameliorate or alleviate clinical and / or pathological manifestations. Thus, the term "treatment" also includes ameliorating or preventing a disease.

[0143] As used herein, the term "effective amount" means an amount of a therapeutic agent that, when administered to a subject for the treatment or prevention of a disease, is sufficient to achieve such treatment or prevention. The "effective amount" may vary depending on the compound, the disease and its severity, and the age, weight, etc. of the subject to be treated. A "therapeutically effective amount" refers to an effective amount for therapeutic treatment. A "prophylactically effective amount" refers to an effective amount for preventive treatment.

[0144] Therapeutic efficacy and toxicity can be determined by standard procedures such as ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population) in cell cultures or experimental animals. The dose ratio between therapeutic and toxic effects is the therapeutic index and can be expressed as the ratio of ED50 / LD50. Pharmaceutical compositions that exhibit a large therapeutic index are preferred.

[0145] Those skilled in the art can determine the exact dosage of the antigen-binding proteins or cells administered using known techniques. Suitable dosages provide a sufficient amount of the active agent of the present invention, and are preferably therapeutically effective, i.e., sufficient to cause, for example, a therapeutic or preventive response in a subject or animal within a reasonable timeframe. For example, the dosage of an antigen-binding protein of the present invention, such as a TCR, should be sufficient to bind to cancer antigens or detect, treat or prevent cancer within a period of about 2 hours or longer, such as 12 hours to 24 hours or longer (e.g., 1 month, 2 months, 3 months, 6 months, 12 months, 24 months, etc.) from the time of administration. In certain embodiments, the time period can be even longer. As known in the art, for therapeutic purposes (such as alleviating the acute onset of the disease), route of administration, time and frequency, time and frequency of administration of the formulation, age, weight, general health, sex, diet, severity of the disease state, drug combination, reaction sensitivity and adjustment of tolerance / response to treatment may be necessary.

[0146] Many assays for determining the dosage to be administered are known in the art. For the purposes of the present invention, assays can be used to determine the starting dose to be administered to a mammal, comprising administering a given dose of T cells expressing an antigen-binding protein (e.g., TCR) of the present invention to a group of mammals (each of which is administered a different dose of T cells), and then comparing the extent of target cell lysis or IFN-γ secreted by such T cells. After administering a certain dose, the extent of target cell lysis or IFN-γ secretion can be determined by methods known in the art. The dosage of the antigen-binding protein or cell of the present invention is also determined by the presence, nature, and extent of any adverse side effects that may accompany the administration of the antigen-binding protein or cell of the present invention. Typically, the attending physician decides the dosage of the antigen-binding protein or cell of the present invention administered to each individual patient, taking into account a variety of factors such as age, weight, general health, diet, sex, active agent to be administered, route of administration, and severity of the condition being treated. In some embodiments of the methods of treatment disclosed herein, the number of cells administered per infusion can, for example, range from about 1×10 6 to about 1×10 12 In some embodiments, less than 1 x 10 6 cells.

[0147] It will be appreciated that treatment may require a single administration of a therapeutically effective dose or multiple administrations of a therapeutically effective dose of an active agent of the invention. For example, depending on the formulation, half-life, and clearance rate of the particular composition, some compositions may be administered every 3 to 4 days, weekly, or once every two weeks, or once in a month.

[0148] The compositions of the present disclosure can be applied in a variety of ways. Typically, administration is accomplished parenterally. Parenteral delivery methods include topical, intra-arterial, intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, intrauterine, intravaginal, sublingual, or intranasal administration.

[0149] The terms "subject," "individual," "animal," or "patient" are used interchangeably herein to refer to any subject in need of treatment, particularly a mammalian subject. Generally, mammalian subjects include humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, dairy cows, and the like. However, it will be readily understood that the TCRs, nucleic acids, vectors, host cells, and pharmaceutical compositions provided herein are specifically contemplated for use in treating human subjects, particularly those that are HLA-A*02 positive, e.g., HLA-A*02:01, HLA-A*02:03, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, HLA-A*02:10, or HLA-A*02:11 positive.

[0150] In some embodiments of the disclosed treatment methods, the cells are autologous or allogeneic to the subject.

[0151] In some embodiments, the method comprises the following steps: (i) isolating a sample containing cells from the subject; (ii) transducing or transfecting the cells with a vector disclosed herein; and (iii) administering the cells obtained in step (ii) to the subject. In some embodiments, the method further comprises a step of knocking out the endogenous TCR in the cells after step (i) and before (ii). In some embodiments, the method further comprises administering a second therapeutic agent, preferably, the second therapeutic agent is selected from antibodies, chemotherapeutics, and small molecule drugs. Preferred examples of the second therapeutic agent are as described above.

[0152] In some embodiments of the disclosed methods of treatment, the HPV-positive condition is selected from the group consisting of HPV infection, HPV precancer, and HPV cancer. The cancer can be any cancer, including acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer, breast cancer, anal cancer, anal canal cancer or anorectal cancer, eye cancer, intrahepatic bile duct cancer, joint cancer, cervical cancer, gallbladder cancer or pleural cancer, nasal cancer, nasal cavity cancer or middle ear cancer, oral cancer, vaginal cancer, vulvar cancer, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, gastrointestinal cancer, Carcinoid tumors, gliomas, Hodgkin's lymphomas, hypopharyngeal cancer, renal cancer, laryngeal cancer, liver cancer, lung cancer, malignant mesothelioma, melanoma, multiple myeloma, nasopharyngeal cancer, non-Hodgkin's lymphoma, oropharyngeal cancer, ovarian cancer, penile cancer, pancreatic cancer, peritoneal cancer, omental cancer and mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, kidney cancer, skin cancer, small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, ureteral cancer and bladder cancer. Preferred cancers are HPV16 positive cancers. Although the most common cancers associated with HPV16 infection include cervical cancer, oropharyngeal cancer, anal cancer, anal canal cancer, rectal and anal cancer, vaginal cancer, vulvar cancer and penile cancer, the methods of the present invention can be used to treat any HPV16 positive cancer, including those occurring in other anatomical regions. Preferably, the cancer is selected from cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, penile cancer.

[0153] In another aspect, the present disclosure provides a method for detecting (e.g., diagnosing) an HPV-positive condition in a subject, wherein the method comprises (i) contacting a sample obtained from the subject with an antigen-binding protein, cell, or conjugate of the present disclosure; and (ii) detecting the presence of an HPV antigen in the sample, wherein the presence of the HPV antigen indicates the HPV-positive condition. HPV-positive conditions can, for example, be selected from HPV infection, HPV precancer, and HPV cancer. The cancer is as defined above.

[0154] In some embodiments, the sample obtained from the subject can be a blood sample, a urine sample, a tissue sample, or a cell sample. In certain embodiments, the method is performed in vitro. In some embodiments, the method comprises (i) contacting the sample obtained from the subject with a conjugate of the present disclosure, wherein the conjugate comprises a detectable label; and (ii) detecting the presence of HPV antigens in the sample by detecting the detectable label. Examples of detectable labels include, but are not limited to, biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, a nucleic acid probe, a contrast agent, and a fluorescent, phosphorescent, or chemiluminescent molecule; preferably an enzyme or a catalytically active fragment thereof, a radionuclide, a fluorescent, phosphorescent, or chemiluminescent molecule.

[0155] In another aspect, the present disclosure provides a kit comprising the antigen-binding protein or conjugate of the present disclosure, wherein the kit is used to detect the presence of a positive epitope in a test sample, wherein the epitope is an epitope comprising YMLDLQPET (SEQ ID NO: 11).

[0156] In some embodiments, the kit is a kit for detecting (e.g., diagnosing) an HPV-positive condition in a subject, comprising an antigen-binding protein or conjugate of the present disclosure. HPV-positive conditions can, for example, be selected from HPV infection, HPV precancer, and HPV cancer. The cancer is as defined above.

[0157] In some embodiments, the conjugate comprises a detectable label. Examples of detectable labels include, but are not limited to, biotin, streptavidin, an enzyme or catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, a nucleic acid probe, a contrast agent, and a fluorescent, phosphorescent, or chemiluminescent molecule; preferably, an enzyme or catalytically active fragment thereof, a radionuclide, a fluorescent, phosphorescent, or chemiluminescent molecule. In some embodiments, the kit may further comprise instructions for use of the kit.

[0158] In another aspect, the present disclosure provides use of an antigen binding protein, nucleic acid, vector, cell or composition of the present disclosure in the preparation of a medicament for treating or preventing an HPV-positive condition in a subject.

[0159] In yet another aspect, the present disclosure provides an antigen binding protein, nucleic acid, vector, cell or composition of the present disclosure for use in treating or preventing an HPV-positive disorder in a subject.

[0160] In another aspect, the present disclosure provides use of the antigen-binding protein or conjugate of the present disclosure in preparing a kit for detecting the presence of a positive epitope in a test sample, wherein the epitope is an epitope comprising YMLDLQPET (SEQ ID NO: 11).

[0161] In some embodiments, the present disclosure provides use of the antigen binding protein or conjugate of the present disclosure in the preparation of a kit for detecting (eg, diagnosing) an HPV-positive condition in a subject.

[0162] In another aspect, the present disclosure provides an antigen-binding protein or conjugate of the present disclosure, which is used to detect the presence of a positive epitope in a test sample, wherein the epitope is an epitope comprising YMLDLQPET (SEQ ID NO: 11), for example, detecting (e.g., diagnosing) an HPV-positive condition in a subject.

[0163] In some embodiments of the uses of the present disclosure, the subject has an HLA-A*02:01 allele, such as an HLA-A*02:01, HLA-A*02:03, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, HLA-A*02:10, or HLA-A*02:11 allele. In some embodiments, the HPV-positive condition is selected from the group consisting of HPV infection, HPV precancer, and HPV cancer. Preferably, the cancer is selected from the group consisting of cervical cancer, head and neck cancer, oropharyngeal cancer, esophageal adenocarcinoma, anal cancer, anal canal cancer, rectal cancer, vaginal cancer, vulvar cancer, and penile cancer.

[0164] The present invention is further described by the following specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, were carried out according to conventional conditions in the art, for example, the conditions described in Sambrook and Russeii et al., Molecular Cloning: A Laboratory Manual (3rd Edition) (2001), CSHL Press, or according to the conditions recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following examples are all commercially available.

[0165] Example 1: Screening of HPV16 E7-specific TCRs

[0166] After obtaining ethical approval and informed consent from patients, postoperative tumor tissue was obtained from patients with HPV16-positive cervical cancer (HLA-A*02:01), and tumor-infiltrating lymphocytes (TILs) were cultured and expanded. After TILs were fully expanded, flow cytometry single-cell sorting was used to separate CD8 and HLA-A*02:01 / HPV16 E7 cells. 11-19 Tetramer staining strongly positive cells. The sorted CD8+ / tetramer+ cells were extracted for mRNA extraction, reverse transcription amplification to obtain TCRα chain and β chain variable region (V region) genes; the obtained TCRα chain and β chain V region genes were further constructed into a lentiviral vector containing the TCR constant region (C region) gene. The cloned vectors can express the complete TCRα chain and β chain ( Figure 1 A).

[0167] Various candidate TCR pairs were introduced into established T cell reporter cell lines, and the antigen specificity and affinity of the TCR pairs were confirmed by antigen-specific activation experiments. Using the above cloning and confirmation strategy, we obtained a TCR that specifically recognizes HPV16 E7 presented by HLA-A*02:01. 11-19 TCR of epitope (YMLDLQPET, SEQ ID NO: 11): CRTE7A2 ( Figure 1 B).

[0168] The amino acid sequence of the variable region of CRTE7A2 and its coding sequence are shown in Tables 1 and 2, respectively, and the CDR sequences of its α and β chain variable regions are shown in Table 3. The constant region sequence of the recombinant TCR is shown in Table 4. The amino acid sequences of the α and β chains of the recombinant TCR are shown in Table 5.

[0169] Table 1. Amino acid sequences of the variable regions of CRTE7A2

[0170]

[0171]

[0172] Table 2. Variable region coding sequences of CRTE7A2

[0173]

[0174] Table 3. CDR sequences of the α and β chain variable regions of CRTE7A2

[0175] α chain β chain CDR1 NSASQS (SEQ ID NO: 1) SGHDT (SEQ ID NO: 6) CDR2 VYSSGN (SEQ ID NO: 2) YYEEEE (SEQ ID NO: 7) CDR3 AVISAGTALI (SEQ ID NO: 3) ASSLGWRGGLYTEAF (SEQ ID NO: 8)

[0176] Table 4. Sequences of the constant regions of the α and β chains of recombinant TCRs

[0177]

[0178]

[0179]

[0180] Table 5. Amino acid sequences of the α and β chains of recombinant TCRs

[0181]

[0182]

[0183]

[0184] The α and β chain variable regions of CRTE7A2 were fused with the murine constant regions (SEQ ID NO: 19 (α chain) and SEQ ID NO: 26 (β chain)) and constructed in tandem into a lentiviral vector in the order of β-T2A-α for subsequent use.

[0185] Example 2: Binding affinity of CRTE7A2 to target antigen peptide

[0186] In order to confirm the affinity of CRTE7A2 for the target antigen peptide (YMLDLQPET, SEQ ID NO: 11), KITE-439, a TCR targeting HPV16 E7 developed by KitePharma, was used as a control. CRTE7A2 and KITE-439 were introduced into Jurkat cells carrying the NFAT-GFP reporter gene (Jurkat-NFAT-GFP, with endogenous TCR knocked out) using lentivirus and co-incubated with T2 cells loaded with different concentrations of target antigen peptides to detect the activation level of Jurkat cell reporter genes. The results showed that CRTE7A2 TCR-T cells had a strong reactivity to the target antigen peptide, and its reactivity was better than that of KITE-439TCR-T cells, with the EC50 of CRTE7A2 binding to the target antigen being 3.10*10 -8 The EC50 of KITE-439 binding to the target antigen is 4.85*10 -8 M( Figure 2 The above results indicate that CRTE7A2 has a high binding affinity to the target antigen peptide.

[0187] Example 3: Cell membrane expression stability of CRTE7A2

[0188] PBMCs were transduced with equal amounts of KITE-439 and CRTE7A2 lentivirus (MOI 20) and then expanded and cultured until day 9. Successful TCR transduction was confirmed using human CD3-FITC antibody. TCR-T expression was detected using anti-mouse TCRβ-APC antibody staining, and the CD4 / CD8 ratio was measured using human CD4-APC and CD8-PE-Cy7 antibodies. Flow cytometry analysis showed that the CD4 / CD8 ratio and TCR positivity of each cell were essentially the same after transduction and culture under the same transduction and culture conditions. Figure 3 The expression intensity of CRTE7A2 was significantly better than that of KITE-439, indicating that CRTE7A2TCR has better cell membrane expression stability and indicates that CRTE7A2 has the potential to have better antigen reactivity and anti-tumor activity.

[0189] Example 4: Specific cytotoxicity of CRTE7A2 TCR-T cells against antigen-positive tumor cells

[0190] T cells expressing CRTE7A2 or KITE-439 TCR were used as effector cells, and PBMCs not transduced with TCR were expanded and cultured in parallel as effector cell controls. -6 HPV16 E7 of M 11-19T2 cells (HLA-A*02:01 positive), Caski cells (HPV16 E7 positive, HLA-A*02:01 positive) and Hela-E7-0201 cells (overexpressing HPV16E7 and HLA-A*02:01) were used as HLA-antigen peptide-matched positive target cells; HPV16 E7-unloaded cells were used. 11-19 T2 cells, A375 cells (HPV16 E7-negative, HLA-A*02:01-positive), and A549 cells (HPV16 E7-negative, HLA-A*02:01-negative) expressing the peptide were used as negative target cells with an HLA-peptide mismatch. All target cells stably expressed the luciferase gene. Effector cells were incubated with different target cells for 16 hours at effector-to-target (E:T) ratios of 9:1, 3:1, and 1:1, respectively. Luciferase substrate was added to detect surviving target cells. The percentage of target cells killed was calculated based on the remaining target cells.

[0191] The results showed that CRTE7A2 TCR-T cells had a significant killing effect on positive target cells, but had no killing effect on negative target cells ( Figure 4 A), which shows that CRTE7A2 TCR-T cells have the ability to specifically kill HLA-antigen peptide-matched target cells. Comparison with KITE-439 showed that CRTE7A2 TCR-T cells showed significantly better target cell killing activity than KITE-439 ( Figure 4 B) These results indicate that CRTE7A2 TCR-T cells have a significantly more efficient and specific killing effect on antigen-positive tumor cells.

[0192] Example 5: Specific response of CRTE7A2 TCR-T cells to antigen-positive target cells

[0193] T cells expressing CRTE7A2 TCR were used as effector cells, and PBMCs not transduced with TCR were expanded and cultured in parallel as effector cell controls. -6 HPV16 E7 of M 11-19 T2 cells (HLA-A*02:01 positive), Caski cells (HPV16 E7 positive, HLA-A*02:01 positive) and Hela-E7-0201 cells (overexpressing HPV16 E7 and HLA-A*02:01) were used as HLA-antigen peptide-matched positive target cells; cells not loaded with HPV16 E7 were used. 11-19T2 cells expressing peptides, A375 cells (HPV16 E7 negative, HLA-A*02:01 positive) and A549 cells (HPV16 E7 negative, HLA-A*02:01 negative) were used as negative target cells with HLA-antigen peptide mismatch. The number of CRTE7A2 TCR-T cells was 10 5 , incubated with different target cells at a 1:1 effector cell: target cell ratio for 24 hours, and the IFN-γ secretion in the supernatant was detected using an IFN-γ ELISA kit (Thermo, Cat#88-7316-76). The results are shown in Figure 5 shown.

[0194] The results showed that CRTE7A2 TCR-T cells secreted IFN-γ to HLA-antigen peptide-matched positive target cells, but did not secrete IFN-γ to HLA-antigen peptide-mismatched negative target cells, which indicated the good specific killing effect of CRTE7A2 TCR-T cells.

[0195] TCR-T cells expressing CRTE7A2 or KITE-439 were used as effector cells; -6 HPV16 E7 of M 11-19 T2 cells (HLA-A*02:01 positive), Caski cells (HPV16 E7 positive, HLA-A*02:01 positive), and Hela-E7-0201 cells (overexpressing HPV16 E7 and HLA-A*02:01) were used as HLA-antigen peptide-matched positive target cells; the number of CRTE7A2 TCR-T cells was 10 5 , incubated with different target cells at E:T ratios of 9:1, 3:1, and 1:1 for 24 hours, and the secretion of IFN-γ in the supernatant was detected. Figure 6 The results showed that, similar to KITE-439 TCR-T cells, CRTE7A2 TCR-T cells were able to secrete high levels of IFN-γ upon stimulation with antigen-positive target cells.

[0196] Example 6: Specific IFN-γ secretion by CRTE7A2 TCR-T cells against antigen-positive target cells

[0197] Put 10 5CRTE7A2 TCR-T cells were added to ELISpot assay wells A, B, C, and D, which can capture cell-secreted IFN-γ. In different wells, the following were added: (A) 25 ng / ml PHA (T cell mitogen) as a positive control; (B) CRTE7A2 TCR-T cells as autologous cell control; (C) culture medium of CRTE7A2 as a negative control; and (D) 10 nM HPV16 E7-loaded cells. 11-19 The HLA-A*02:01 positive T2 cells of the peptide were used as experimental wells. After 16-24 hours of culture, ELISpot staining was performed. The results were as follows Figure 7 shown.

[0198] The results showed that CRTE7A2 in well A showed a brown positive reaction under PHA stimulation; wells B and C served as negative controls and had no obvious brown spots; CRTE7A2 in well D showed a brown positive reaction under 10nM HPV16 E7 stimulation. 11-19 Under the stimulation of peptide, obvious brown spots appeared. This indicates that CRTE7A2 plays an important role in the expression of HPV16E7 in HLA-A*02:01 positive T2 cells. 11-19 Under the stimulation of polypeptide, specific IFN-γ is released.

[0199] Example 7: CRTE7A2 efficiently mediates antigen-specific T cell proliferation

[0200] CRTE7A2 TCR-T cells and PBMCs not transduced with TCR were rested in serum-free lymphocyte medium XVIVO-15 (Lonza, Cat. No. BE02-060F) without IL-2 for 24 h, then stained with CFSE (C34554, Invitrogen) and loaded with 10 nM or 1 nM HPV16 E7. 11-19 After 5 days of co-culture of T2 cells with peptides, the mixed cells were stained with mouse TCRβ-APC and human CD8α-PE Cy7, and CD8 and mouse TCRβ positive cells were selected to analyze cell proliferation. T2 loaded with irrelevant peptides served as peptide controls and PBMCs not transduced with TCR served as negative controls. The results are shown in Figure 2. Figure 8 shown.

[0201] The experimental results showed that HPV16 E7 11-19 The peptide was able to specifically stimulate the proliferation of CRTE7A2 TCR-T cells, which further confirmed the antigen-specific activation of CRTE7A2 TCR-T cells.

[0202] Example 8: In vivo anti-tumor activity of CRTE7A2

[0203] A tumorigenic model (CDX model) was established in B2M knockout NDG immunodeficient mice using the cervical cancer cell line Hela-E7-A0201. Then, 5x10 6 and 10 7 CRTE7A2 TCR-T cells were infused back for 10 7 PBMC was used as a control to monitor the growth of Hela subcutaneous transplanted tumors. Figure 9 As shown in A. The results showed that CRTE7A2 TCR-T cells had a dose-dependent anti-tumor activity, 5x10 6 and 10 7 CRTE7A2 TCR-T cells can significantly inhibit the growth of tumor cells, 7 The tumor inhibition effect of 10 cells is better than that of 5x10 6 The tumor suppression effect of 5x10 cells was monitored by luciferase live imaging 21 days after TCR-T cell infusion. 6 and 10 7 The CRTE7A2 TCR-T cell infusion can also significantly inhibit the growth of tumor cells. 7 The tumor inhibition effect of 10 cells is better than that of 5x10 6 The tumor suppressor effect of cells ( Figure 9 B).

[0204] These results indicate that CRTE7A2 TCR-T cells have significant anti-tumor activity in vivo.

[0205] This application makes reference to various issued patents, published patent applications, journal articles and other publications, all of which are incorporated herein by reference. If any incorporated reference conflicts with this specification, this specification shall prevail. In addition, any specific embodiment of the present invention that falls within the scope of the prior art may be explicitly excluded from any one or more claims. Because the embodiments are considered to be known to those skilled in the art, they may be excluded, even if the exclusion is not explicitly listed in this application. Any specific embodiment of the present invention may be excluded from any claim for any reason, regardless of whether it is related to the existence of the prior art.

[0206] Although the present invention has been described with reference to specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition, method, or process step to the objective, spirit, and scope of the present invention. All such modifications are intended to be within the scope of the appended claims.

Claims

1. Use of an antigen-binding protein targeting HPV E7, a nucleic acid encoding the antigen-binding protein, a vector comprising the nucleic acid, or a cell comprising the antigen-binding protein in the preparation of a medicament for treating HPV E7-positive diseases in a subject, wherein the antigen-binding protein comprises a variable region of the T-cell receptor (TCR) α-chain and a variable region of the TCR β-chain, and wherein the variable region of the TCR α-chain comprises α-chain CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively; and the variable region of the TCR β-chain comprises β-chain CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8, respectively.

2. Use according to claim 1, wherein the antigen-binding protein binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO:11) or a complex of the epitope and an MHC molecule.

3. Use according to claim 2, wherein the MHC molecule is of the HLA-A*02 type.

4. Use according to claim 3, wherein the MHC molecule is of the HLA-A*02:01 type, HLA-A*02:03 type, HLA-A*02:05 type, HLA-A*02:06 type, HLA-A*02:07 type, HLA-A*02:10 type, or HLA-A*02:11 type.

5. Use according to any one of claims 1-4, wherein the variable region of the TCR α-chain comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO:4, and / or the variable region of the TCR β-chain comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO:

9.

6. Use according to claim 5, wherein the variable region of the TCR α-chain comprises an amino acid sequence having at least 85% sequence identity with SEQ ID NO:4, and / or the variable region of the TCR β-chain comprises an amino acid sequence having at least 85% sequence identity with SEQ ID NO:

9.

7. Use according to claim 5, wherein the variable region of the TCR α-chain comprises an amino acid sequence having at least 90% sequence identity with SEQ ID NO:4, and / or the variable region of the TCR β-chain comprises an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

9.

8. Use according to claim 5, wherein the variable region of the TCR α-chain comprises an amino acid sequence having at least 95% sequence identity with SEQ ID NO:4, and / or the variable region of the TCR β-chain comprises an amino acid sequence having at least 95% sequence identity with SEQ ID NO:

9.

9. Use according to claim 5, wherein the variable region of the TCR α chain comprises the amino acid sequence shown in SEQ ID NO: 4, and / or the variable region of the TCR β chain comprises the amino acid sequence shown in SEQ ID NO:

9.

10. Use according to any one of claims 1-9, wherein the variable region of the TCR α chain is comprised on a first polypeptide, and the variable region of the TCR β chain is comprised on a different second polypeptide.

11. Use according to any one of claims 1-9, wherein the variable regions of the TCR α chain and the TCR β chain are comprised on a single polypeptide.

12. Use according to any one of claims 1-11, wherein the antigen-binding protein is soluble or membrane-bound.

13. Use according to any one of claims 1-12, wherein the antigen-binding protein is selected from TCR, chimeric antigen receptor (CAR), Fc polypeptide, or antigen-binding fragments thereof.

14. Use according to any one of claims 1-13, wherein the antigen-binding protein is TCR or an antigen-binding fragment thereof, and the antigen-binding protein further comprises a TCR constant region or a fragment thereof.

15. Use according to claim 14, wherein the TCR constant region is a murine constant region or a human constant region.

16. Use according to claim 14 or 15, wherein the TCR constant region comprises the TCR α chain constant region and / or the TCR β chain constant region.

17. Use according to claim 16, wherein the TCR α chain constant region and / or the TCR β chain constant region comprise at least one cysteine mutation relative to the wild-type sequence to form a disulfide bond between the TCR α chain and the TCR β chain.

18. Use according to claim 17, wherein the TCR α chain constant region comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 14-19, and / or the TCR β chain constant region comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 21-30.

19. Use according to claim 18, wherein the TCR α chain constant region comprises an amino acid sequence having at least 85% sequence identity to any one of SEQ ID NOs: 14-19, and / or the TCR β chain constant region comprises an amino acid sequence having at least 85% sequence identity to any one of SEQ ID NOs: 21-30.

20. Use according to claim 18, wherein the TCR α chain constant region comprises an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 14-19, and / or the TCR β chain constant region comprises an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 21-30.

21. Use according to claim 18, wherein the TCR α-chain constant region comprises an amino acid sequence having at least 95% sequence identity with any one of SEQ ID NOs: 14-19, and / or the TCR β-chain constant region comprises an amino acid sequence having at least 95% sequence identity with any one of SEQ ID NOs: 21-30.

22. Use according to claim 18, wherein the TCR α-chain constant region comprises the amino acid sequence shown in SEQ ID NO: 19, and the TCR β-chain constant region comprises the amino acid sequence shown in SEQ ID NO:

26.

23. Use according to claim 14, wherein the fragment of the TCR constant region is the extracellular segment of the TCR constant region.

24. Use according to any one of claims 14-23, wherein the antigen-binding protein further comprises a transmembrane region and / or a cytoplasmic region.

25. Use according to claim 14, wherein the antigen-binding protein comprises the following TCR α-chain: which comprises an amino acid sequence having at least 80% sequence identity with any one selected from SEQ ID NOs: 32-37; and / or the following TCR β-chain: which comprises an amino acid sequence having at least 80% sequence identity with any one selected from SEQ ID NOs: 38-47.

26. Use according to claim 25, wherein the antigen-binding protein comprises the following TCR α-chain: which comprises an amino acid sequence having at least 85% sequence identity with any one selected from SEQ ID NOs: 32-37; and / or the following TCR β-chain: which comprises an amino acid sequence having at least 85% sequence identity with any one selected from SEQ ID NOs: 38-47.

27. Use according to claim 25, wherein the antigen-binding protein comprises the following TCR α-chain: which comprises an amino acid sequence having at least 90% sequence identity with any one selected from SEQ ID NOs: 32-37; and / or the following TCR β-chain: which comprises an amino acid sequence having at least 90% sequence identity with any one selected from SEQ ID NOs: 38-47.

28. Use according to claim 25, wherein the antigen-binding protein comprises the following TCR α-chain: which comprises an amino acid sequence having at least 95% sequence identity with any one selected from SEQ ID NOs: 32-37; and / or the following TCR β-chain: which comprises an amino acid sequence having at least 95% sequence identity with any one selected from SEQ ID NOs: 38-47.

29. Use according to claim 25, wherein the antigen-binding protein comprises the following TCR α-chain: which comprises an amino acid sequence selected from any one of SEQ ID NOs: 32-37; and / or the following TCR β-chain: which comprises an amino acid sequence selected from any one of SEQ ID NOs: 38-47.

30. Use according to any one of claims 1-29, wherein the antigen-binding protein further comprises an intracellular signaling region.

31. Use according to any one of claims 1-30, wherein the antigen-binding protein further comprises one or more antigen-binding regions that bind to other antigens or epitopes.

32. Use according to any one of claims 1-31, wherein the antigen-binding protein is isolated or purified.

33. Use according to any one of claims 1-32, wherein the nucleic acid comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:5, and / or a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

10.

34. Use according to claim 33, wherein the nucleic acid comprises a nucleotide sequence having at least 85% sequence identity with SEQ ID NO:5, and / or a nucleotide sequence having at least 85% sequence identity with SEQ ID NO:

10.

35. Use according to claim 33, wherein the nucleic acid comprises a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:5, and / or a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

10.

36. Use according to claim 33, wherein the nucleic acid comprises a nucleotide sequence having at least 95% sequence identity with SEQ ID NO:5, and / or a nucleotide sequence having at least 95% sequence identity with SEQ ID NO:

10.

37. Use according to claim 33, wherein the nucleic acid comprises the nucleotide sequence as shown in SEQ ID NO:5, and / or the nucleotide sequence as shown in SEQ ID NO:

10.

38. Use according to any one of claims 33-37, wherein the nucleic acid further comprises a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:20, and / or a nucleotide sequence having at least 80% sequence identity with SEQ ID NO:

31.

39. Use according to claim 38, wherein the nucleic acid further comprises a nucleotide sequence having at least 85% sequence identity with SEQ ID NO:20, and / or a nucleotide sequence having at least 85% sequence identity with SEQ ID NO:

31.

40. Use according to claim 38, wherein the nucleic acid further comprises a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:20, and / or a nucleotide sequence having at least 90% sequence identity with SEQ ID NO:

31.

41. Use according to claim 38, wherein the nucleic acid further comprises a nucleotide sequence having at least 95% sequence identity with SEQ ID NO:20, and / or a nucleotide sequence having at least 95% sequence identity with SEQ ID NO:

31.

42. The use according to claim 38, wherein the nucleic acid further comprises a nucleotide sequence as shown in SEQ ID NO:20, and / or a nucleotide sequence as shown in SEQ ID NO:

31.

43. The use according to any one of claims 1-42, wherein the vector is selected from retroviral vectors, DNA vectors, mRNA vectors, transposon-based vectors, and artificial chromosomes.

44. The use according to claim 43, wherein the vector is a lentiviral vector.

45. The use according to any one of claims 1-44, wherein the cell is selected from lymphocytes, monocytes, and stem cells.

46. The use according to claim 45, wherein the lymphocyte is a T cell or an NK cell.

47. The use according to claim 45, wherein the monocyte is a PBMC.

48. The use according to claim 45, wherein the stem cell is a lymphoid progenitor cell or an induced pluripotent stem cell.

49. The use according to claim 45, wherein the cell is a T cell.

50. The use according to claim 49, wherein the T cell does not express an endogenous TCR.

51. The use according to any one of claims 1-50, wherein the cell is autologous or allogeneic to the subject.

52. The use according to any one of claims 1-51, wherein the HPV E7-positive disorder is cervical cancer.

53. The use according to any one of claims 1-52, wherein the medicament is administered together with a second therapeutic agent.

54. The use according to claim 53, wherein the second therapeutic agent is selected from antibodies, chemotherapeutic agents, and small molecule drugs.

55. The use according to any one of claims 1-54, wherein the subject has the HLA-A*02 allele.

56. The use according to claim 55, wherein the subject has the HLA-A*02:01, HLA-A*02:03, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, HLA-A*02:10, or HLA-A*02:11 allele.

57. Use of an antigen-binding protein that targets HPV E7, a cell comprising the antigen-binding protein, or a conjugate comprising the antigen-binding protein and an active agent conjugated or linked to the antigen-binding protein in the preparation of a kit for detecting an HPV E7-positive disorder in a subject, wherein the antigen-binding protein comprises a variable region of the T cell receptor (TCR) α-chain and a variable region of the TCR β-chain, wherein the variable region of the TCR α-chain comprises α-chain CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively; and the variable region of the TCR β-chain comprises β-chain CDR1, CDR2, and CDR3 having amino acid sequences as shown in SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8, respectively.

58. Use according to claim 57, wherein the antigen-binding protein binds to an epitope comprising the amino acid sequence YMLDLQPET (SEQ ID NO: 11) or a complex of said epitope with an MHC molecule.

59. Use according to claim 58, wherein the MHC molecule is of the HLA-A*02 type.

60. Use according to claim 59, wherein the MHC molecule is of the HLA-A*02:01 type, HLA-A*02:03 type, HLA-A*02:05 type, HLA-A*02:06 type, HLA-A*02:07 type, HLA-A*02:10 type or HLA-A*02:11 type.

61. Use according to any one of claims 57-60, wherein the TCR α-chain variable region comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 4, and / or the TCR β-chain variable region comprises an amino acid sequence having at least 80% sequence identity with SEQ ID NO:

9.

62. Use according to claim 61, wherein the TCR α-chain variable region comprises an amino acid sequence having at least 85% sequence identity with SEQ ID NO: 4, and / or the TCR β-chain variable region comprises an amino acid sequence having at least 85% sequence identity with SEQ ID NO:

9.

63. Use according to claim 61, wherein the TCR α-chain variable region comprises an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 4, and / or the TCR β-chain variable region comprises an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

9.

64. Use according to claim 61, wherein the TCR α-chain variable region comprises an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 4, and / or the TCR β-chain variable region comprises an amino acid sequence having at least 95% sequence identity with SEQ ID NO:

9.

65. Use according to claim 61, wherein the TCR α-chain variable region comprises the amino acid sequence as shown in SEQ ID NO: 4, and / or the TCR β-chain variable region comprises the amino acid sequence as shown in SEQ ID NO:

9.

66. Use according to any one of claims 57-65, wherein the TCR α-chain variable region is comprised on a first polypeptide and the TCR β-chain variable region is comprised on a different second polypeptide.

67. Use according to any one of claims 57-65, wherein the TCR α-chain variable region and the TCR β-chain variable region are comprised on a single polypeptide.

68. Use according to any one of claims 57-67, wherein the antigen-binding protein is soluble or membrane-bound.

69. Use according to any one of claims 57-68, wherein the antigen-binding protein is selected from a TCR, a chimeric antigen receptor (CAR), an Fc polypeptide, or an antigen-binding fragment thereof.

70. Use according to any one of claims 57 - 69, wherein the antigen - binding protein is a TCR or an antigen - binding fragment thereof, and the antigen - binding protein further comprises a TCR constant region or a fragment thereof.

71. Use according to claim 70, wherein the TCR constant region is a murine constant region or a human constant region.

72. Use according to claim 70 or 71, wherein the TCR constant region comprises a TCR α - chain constant region and / or a TCR β - chain constant region.

73. Use according to claim 72, wherein the TCR α - chain constant region and / or the TCR β - chain constant region comprises at least one cysteine mutation relative to the wild - type sequence to form a disulfide bond between the TCR α - chain and the TCR β - chain.

74. Use according to claim 73, wherein the TCR α - chain constant region comprises an amino acid sequence having at least 80% sequence identity with any one of SEQ ID NOs: 14 - 19, and / or the TCR β - chain constant region comprises an amino acid sequence having at least 80% sequence identity with any one of SEQ ID NOs: 21 - 30.

75. Use according to claim 74, wherein the TCR α - chain constant region comprises an amino acid sequence having at least 85% sequence identity with any one of SEQ ID NOs: 14 - 19, and / or the TCR β - chain constant region comprises an amino acid sequence having at least 85% sequence identity with any one of SEQ ID NOs: 21 - 30.

76. Use according to claim 74, wherein the TCR α - chain constant region comprises an amino acid sequence having at least 90% sequence identity with any one of SEQ ID NOs: 14 - 19, and / or the TCR β - chain constant region comprises an amino acid sequence having at least 90% sequence identity with any one of SEQ ID NOs: 21 - 30.

77. Use according to claim 74, wherein the TCR α - chain constant region comprises an amino acid sequence having at least 95% sequence identity with any one of SEQ ID NOs: 14 - 19, and / or the TCR β - chain constant region comprises an amino acid sequence having at least 95% sequence identity with any one of SEQ ID NOs: 21 - 30.

78. Use according to claim 74, wherein the TCR α - chain constant region comprises the amino acid sequence shown in SEQ ID NO: 19, and the TCR β - chain constant region comprises the amino acid sequence shown in SEQ ID NO:

26.

79. Use according to claim 70, wherein the fragment of the TCR constant region is the extracellular segment of the TCR constant region.

80. Use according to any one of claims 70 - 79, wherein the antigen - binding protein further comprises a transmembrane region and / or a cytoplasmic region.

81. Use according to claim 70, wherein the antigen-binding protein comprises a TCR α-chain comprising an amino acid sequence having at least 80% sequence identity to any one selected from SEQ ID NOs: 32-37; and / or a TCR β-chain comprising an amino acid sequence having at least 80% sequence identity to any one selected from SEQ ID NOs: 38-47.

82. Use according to claim 81, wherein the antigen-binding protein comprises a TCR α-chain comprising an amino acid sequence having at least 85% sequence identity to any one selected from SEQ ID NOs: 32-37; and / or a TCR β-chain comprising an amino acid sequence having at least 85% sequence identity to any one selected from SEQ ID NOs: 38-47.

83. Use according to claim 81, wherein the antigen-binding protein comprises a TCR α-chain comprising an amino acid sequence having at least 90% sequence identity to any one selected from SEQ ID NOs: 32-37; and / or a TCR β-chain comprising an amino acid sequence having at least 90% sequence identity to any one selected from SEQ ID NOs: 38-47.

84. Use according to claim 81, wherein the antigen-binding protein comprises a TCR α-chain comprising an amino acid sequence having at least 95% sequence identity to any one selected from SEQ ID NOs: 32-37; and / or a TCR β-chain comprising an amino acid sequence having at least 95% sequence identity to any one selected from SEQ ID NOs: 38-47.

85. Use according to claim 81, wherein the antigen-binding protein comprises a TCR α-chain comprising an amino acid sequence selected from any one of SEQ ID NOs: 32-37; and / or a TCR β-chain comprising an amino acid sequence selected from any one of SEQ ID NOs: 38-47.

86. Use according to any one of claims 57-85, wherein the antigen-binding protein further comprises an intracellular signaling region.

87. Use according to any one of claims 57-86, wherein the antigen-binding protein further comprises one or more antigen-binding regions that bind to other antigens or epitopes.

88. Use according to any one of claims 57-87, wherein the antigen-binding protein is isolated or purified.

89. Use according to any one of claims 57-88, wherein the cell is selected from lymphocytes, monocytes, and stem cells.

90. Use according to claim 89, wherein the lymphocyte is a T cell or an NK cell.

91. Use according to claim 89, wherein the monocyte is a PBMC.

92. Use according to claim 89, wherein the stem cell is a lymphoid progenitor cell or an induced pluripotent stem cell.

93. Use according to claim 89, wherein the cell is a T cell.

94. Use according to claim 89, wherein the T cells do not express endogenous TCR.

95. Use according to any one of claims 57 - 94, wherein the active agent is selected from detectable labels, immunostimulatory molecules, and therapeutic agents.

96. Use according to claim 95, wherein the detectable label is selected from biotin, streptavidin, an enzyme or a catalytically active fragment thereof, a radionuclide, a nanoparticle, a paramagnetic metal ion, a nucleic acid probe, a contrast agent, and a fluorescent, phosphorescent or chemiluminescent molecule.

97. Use according to claim 95, wherein the immunostimulatory molecule is selected from cytokines.

98. Use according to claim 95, wherein the immunostimulatory molecule is selected from chemokines, platelet factors, and complement initiators.

99. Use according to claim 95, wherein the therapeutic agent is selected from immunomodulators, radioactive compounds, enzymes, chemotherapeutic agents, and toxins.

100. Use according to any one of claims 57 - 99, wherein the HPV E7 - positive disorder is cervical cancer.

Images