A cerevisiae yeast strain producing breast milk-like fat and its construction method and application

Abstract

The present invention relates to a strain of Saccharomyces cerevisiae with a fat composition similar to that of breast milk, and a construction method and application thereof. The Saccharomyces cerevisiae engineered bacteria of the present invention uses Saccharomyces cerevisiae as a host bacterium, and obtains the Saccharomyces cerevisiae engineered bacteria by knocking out its own natural fatty acid desaturase and integrating and expressing a heterologous fatty acid desaturase into the host bacterium, while strengthening the synthetic pathway of acetyl-CoA, a precursor of fatty acid synthesis. The present invention strengthens the relevant genes of the fatty acid synthetic pathway to achieve the effect of high-yield fatty acids with a fatty acid composition similar to that of breast milk, so that the fatty acid composition produced by Saccharomyces cerevisiae is close to that of breast milk, mainly in the ratio of C16:0, C18:1 and C18:2.

Description

Technical Field

[0001] The invention belongs to the technical field of biological metabolism, and in particular refers to a brewer's yeast strain with a composition similar to breast milk fat, and a construction method and application thereof. Background Art

[0002] Breast milk is the best food for infants and young children. It provides an ideal and balanced diet for infants and young children and can protect infants and prevent the occurrence of diseases. Breastfeeding is the best way to feed infants. However, due to some reasons, breast milk cannot be used for feeding. Infant formula milk powder suitable for infants with breast milk as the gold standard has become an ideal product to replace breast milk. The fatty acid composition and content in breast milk have always been a hot topic in related research. Infant formula milk powder is close to the composition of breast milk by adding or extracting certain components from animal and vegetable oils / milk fats. With the continuous deepening and refinement of research, animal and vegetable oils / milk fats can no longer meet people's needs due to their inherent composition and cannot be changed according to people's needs. There is great potential for industrial production strains to produce specific lipid compositions through genetic engineering, which can produce products that meet people's needs. At the same time, the use of genetic engineering methods to construct genetically engineered strains to synthesize products from scratch has many advantages, such as low cost, no restrictions on raw materials, simple extraction process, no seasonality, short production time, and little environmental pollution, which has attracted the favor of many scholars.

[0003] At present, animal milk and vegetable oil are mainly used to simulate breast milk fatty acids and their composition, which is largely constrained by the composition and time and space of animal milk and vegetable oil. Microbial fermentation has sustainable and green social and economic benefits. The use of microbial fermentation to produce breast milk-like fatty acid components is a method of synthesizing breast milk lipids with great potential. Due to the large difference between the fatty acid composition in microorganisms and breast milk, there are currently no reports on the use of microbial fermentation to synthesize strains with breast milk-like fatty acid composition using glucose as a substrate. Therefore, this study aims to construct a recombinant strain of Saccharomyces cerevisiae that can synthesize breast milk-like fatty acid composition for metabolic modification.

[0004] Saccharomyces cerevisiae is also known as baker's yeast or budding yeast. Saccharomyces cerevisiae is the yeast with the widest relationship with humans. As a food safety strain, it has been used to make foods such as bread and steamed buns, and in the brewing industry. In recent years, scholars have begun to study the use of Saccharomyces cerevisiae to produce natural products, such as artemisinic acid and notoginseng saponins. Saccharomyces cerevisiae has the advantages of high safety, low pathogenicity, high stress resistance, and a low probability of phage contamination. Therefore, it also plays an important role in the field of genetic engineering. However, the fatty acid composition of Saccharomyces cerevisiae itself is quite different from that of breast milk. Summary of the invention

[0005] In order to solve the above technical problems and obtain an engineered strain for producing a fatty acid composition similar to that of breast milk, the present invention provides a strain that uses Cre / loxp technology to integrate a heterologous fatty acid desaturation metabolic pathway into brewer's yeast, and strengthens the related genes of the fatty acid synthesis pathway to achieve the effect of high production of fatty acids with a fatty acid composition similar to that of breast milk, so that the fatty acid composition produced by brewer's yeast is close to that of breast milk, mainly in the ratio of C16:0, C18:1 and C18:2.

[0006] The first purpose of the present invention is to provide an engineered Saccharomyces cerevisiae strain having a composition similar to breast milk fat. The engineered Saccharomyces cerevisiae strain uses Saccharomyces cerevisiae as a host strain, knocks out its own natural fatty acid desaturase and integrates and expresses heterologous fatty acid desaturase into the host strain, while strengthening the synthesis pathway of acetyl-CoA, a precursor of fatty acid synthesis, to obtain the engineered Saccharomyces cerevisiae strain.

[0007] In one embodiment of the present invention, the host bacteria is selected from S.cerevisiae CEN PK2-1CMATa; ura3-52; trp1-289; leu2-3,112; his3-Δ1; MAL2-8C; SUC2; S.cerevisiae W303 MATa; ura3-1; trp1-Δ1; leu2-3,112; his3-11; ade2-1; can1-100; S.cerevisiae FY1679 MATa; ura3-52; trp1-Δ63; leu2-Δ1; his3-Δ200; GAL2 and S.cerevisiae BY4743 MATa; ura3-Δ0; met15-Δ0; leu2-Δ0; his3-Δ1; lys-Δ0.

[0008] In one embodiment of the present invention, the key enzymes in the synthesis pathway of the heterologous fatty acid desaturase include the Rust desaturase OLE1, the Caenorhabditis elegans desaturases fat-2, fat-5, fat-6 and fat-7, and the Yarrowia desaturase FAD2.

[0009] In one embodiment of the present invention, the ENTREZ GENE ID of the Rust desaturase OLE1 is 10534674; the ENTREZ GENE ID of the Caenorhabditis elegans desaturase fat-2 gene is 178293, the ENTREZ GENE ID of the fat-5 gene is 180162, the ENTREZ GENE ID of the fat-6 gene is 178122, and the ENTREZ GENE ID of the fat-7 gene is 179100; and the ENTREZ GENE ID of the Yarrowia desaturase FAD2 is 2906773.

[0010] In one embodiment of the present invention, the strengthening of the fatty acid synthesis precursor acetyl-CoA synthesis pathway is: increasing the copy number of ADH2, ACS1, ALD6 genes, and knocking out ADH1, ACH1, MLS1 genes.

[0011] In one embodiment of the present invention, the ENTREZGENE IDs of the ADH2, ACS1, ALD6, ADH1, ACH1, and MLS1 genes are 855349, 851245, 856044, 854068, 852266, and 855606, respectively.

[0012] In one embodiment of the present invention, the oleic acid synthesis pathway: amplify the ELO1 gene (ENTREZ GENE ID is 853243) expression frame and insert it into the 208a site to increase the copy number of the fatty acid elongase ELO1 gene.

[0013] The second object of the present invention is to provide the use of the engineered yeast Saccharomyces cerevisiae in the fermentation production of breast milk-like fat.

[0014] In one embodiment of the present invention, the step of fermenting and producing breast milk-like fat is as follows: inoculating the engineered bacteria of Saccharomyces cerevisiae into a fermentation medium, and fermenting at a pH of 6.0-8.0 to obtain the breast milk-like fat.

[0015] In one embodiment of the present invention, the fermentation conditions are: fermentation temperature is 20-30°C, fermentation time is 72-120h, and stirring speed is 220rpm.

[0016] In one embodiment of the present invention, the fermentation medium is a carbon source and amino nitrogen source-free sterile medium, a nitrogen source-limited YPD sterile medium, an inorganic salt sterile medium, or a nitrogen source-limited soy peptone sterile medium.

[0017] In one embodiment of the present invention, the culture medium uses glucose as the carbon source.

[0018] In one embodiment of the present invention, the inoculation rate of the engineered yeast Saccharomyces cerevisiae is 2% to 5%.

[0019] In order to synthesize breast milk-like fatty acid components in Saccharomyces cerevisiae, the present invention provides a Saccharomyces cerevisiae strain that synthesizes breast milk-like fat composition and a construction method thereof. The present invention first replaces the ADH1 gene of Saccharomyces cerevisiae with the ADH2 gene integration frame in the CEN PK2-1C Saccharomyces cerevisiae starting strain to obtain the fatty acid synthesis strain FAS-1; using FAS-1 as the starting strain, the ACS1 gene integration frame replaces the ACH1 gene in the genome to obtain the fatty acid synthesis strain FAS-2; using FAS-2 as the starting strain, the ALD6 gene integration frame replaces the MLS1 gene to obtain the fatty acid production strain FAS-3; inserting the ELO1 gene integration frame into the 208a site of the Saccharomyces cerevisiae chromosome to obtain the fatty acid synthesis strain FAS-4. In order to verify the effects of different insertion sites on gene expression and the changes in the fatty acid composition of the strain, the present invention uses FAS-4 as the starting strain, and inserts the Δ9 desaturase genes OLE1, fat-5, fat-6 and fat-7 into Saccharomyces cerevisiae YGL055W, respectively, to obtain the oleic acid high-yield strains FAS-5 to 8, respectively. Among them, the strain with the highest oleic acid content was FAS-5, so FAS-5 was used as the starting strain, and the Δ12 desaturase genes FAD2 and fat-2 were inserted into the 911b site of Saccharomyces cerevisiae to obtain the breast milk-like fatty acid synthesis strains FAS-9 and FAS-10. The results showed that the fatty acid composition of the recombinant strains expressing the heterologous gene OLE1-FAD2 combination was similar to that of breast milk, C16:0 (20% ± 2%), C18:1 (50% ± 3.8%) and C18:2 (20% ± 4%).

[0020] The above technical solution of the present invention has the following advantages compared with the prior art:

[0021] The recombinant saccharomyces cerevisiae provided by the present invention can be used to produce C16:0 fatty acid similar to breast milk by fermentation in a carbon source-free amino nitrogen source sterile culture medium with glucose as a substrate, a YPD sterile culture medium with a limited nitrogen source, an inorganic salt sterile culture medium or a soy peptone sterile culture medium with a limited nitrogen source.

[0022] (20% ± 2%), C18:1 (50% ± 3.8%) and C18:2 (20% ± 4%), the recombinant strain lays a foundation for metabolic engineering of Saccharomyces cerevisiae to synthesize breast milk lipids. The construction method of the recombinant Saccharomyces cerevisiae provided by the invention is simple, easy to use and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0024] Figure 1 This is the qualitative analysis result of the mixed standard of 37 fatty acids in Example 1 of the present invention.

[0025] Figure 2 This is the fatty acid chromatogram of S.cerevisiae CEN PK2-1C in Example 1 of the present invention.

[0026] Figure 3 This is the change in the content of FAS-1 to FAS-4 fatty acids in Example 2 of the present invention.

[0027] Figure 4 It is the fatty acid composition of FAS-5 to FAS-10 in Examples 3 and 4 of the present invention.

[0028] Figure 5 It is the fatty acid composition of FAS-11 to FAS-31 in Comparative Example 1 of the present invention. DETAILED DESCRIPTION

[0029] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0030] Detection methods involved: Gas chromatography-mass spectrometry (GC-MS) detection method: Shimadzu (GCMS-QP2010 SE), SH-Rtx-Wax column, mobile phase He, column temperature 100°C, injection volume 1μL, flow rate 1.0mL / min.

[0031] Lithium acetate transformation method: pick a single colony on the plate and culture it in the corresponding YNB medium or YPD medium overnight (30°C, 220rpm), transfer it on the next day according to the inoculation amount of 2.5%, culture it at 30°C, 220rpm for 4-7h, centrifuge it at 5000xg to obtain the bacteria, wash it twice with deionized water, add 200μL of 0.1M LiAc to resuspend it, and then divide the resuspended bacteria into 50μL / packaging competent state, centrifuge it at 12000x g, discard the supernatant, add 240μL PEG, 36μL 1M LiAc, 10μL ssDNA and transformed fragments (1-2ng) in turn, mix well and place it in a 42°C water bath (30 minutes) and a 30°C water bath (25 minutes) for post-culture, and then centrifuge it at 8000x Centrifuge at 1000 g, discard the supernatant, add 1 mL of deionized water to resuspend, and remove 50-200 μL for coating. The competent cell preparation needs to be kept at a low temperature.

[0032] The present invention provides a method for integrating a heterologous fatty acid desaturation metabolic pathway into brewer's yeast using Cre / loxp technology, and strengthening the related genes of the fatty acid synthesis pathway to achieve the effect of high-yield fatty acids with a fatty acid composition similar to that of breast milk, so that the fatty acid composition produced by brewer's yeast is close to that of breast milk, mainly in the ratio of C16:0, C18:1 and C18:2.

[0033] The first purpose of the present invention is to provide an engineered Saccharomyces cerevisiae strain having a composition similar to breast milk fat. The engineered Saccharomyces cerevisiae strain uses Saccharomyces cerevisiae as a host strain, knocks out its own natural fatty acid desaturase and integrates and expresses heterologous fatty acid desaturase into the host strain, while strengthening the synthesis pathway of acetyl-CoA, a precursor of fatty acid synthesis, to obtain the engineered Saccharomyces cerevisiae strain.

[0034] In one embodiment of the present invention, the host bacteria is selected from S.cerevisiae CEN PK2-1C MATa; ura3-52; trp1-289; leu2-3,112; his3-Δ1; MAL2-8C; SUC2; S.cerevisiae W303 MATa; ura3-1; trp1-Δ1; leu2-3,112; his3-11; ade2-1; can1-100; S.cerevisiae FY1679 MATa; ura3-52; trp1-Δ63; leu2-Δ1; his3-Δ200; GAL2 and S.cerevisiae BY4743 MATa; ura3-Δ0; met15-Δ0; leu2-Δ0; his3-Δ1; lys-Δ0.

[0035] In one embodiment of the present invention, the key enzymes in the synthesis pathway of the heterologous fatty acid desaturase include the Rust desaturase OLE1, the Caenorhabditis elegans desaturases fat-2, fat-5, fat-6 and fat-7, and the Yarrowia desaturase FAD2.

[0036] In one embodiment of the present invention, the strengthening of the fatty acid synthesis precursor acetyl-CoA synthesis pathway is: increasing the copy number of ADH2, ACS1, ALD6 genes, and knocking out ADH1, ACH1, MLS1 genes.

[0037] In one embodiment of the present invention, the oleic acid synthesis pathway: amplifies the ELO1 gene expression frame and inserts it into the 208a site to increase the copy number of the fatty acid elongase ELO1 gene.

[0038] The present invention provides the use of the engineered yeast Saccharomyces cerevisiae in the fermentation production of breast milk-like fat.

[0039] Example 1 Extraction and detection of fatty acids from recombinant Saccharomyces cerevisiae

[0040] The lipids in all recombinant saccharomyces cerevisiae strains of the present invention are extracted in the following manner. Methyl tridecanoate is added to the freeze-dried cells as an internal standard, methanol and glass beads are added for oscillation and crushing, and then the crushed solution is transferred to a new treatment bottle, chloroform is added, and the solution is placed in an ultrasonic water bath for 10 minutes, and the supernatant after ultrasonication is transferred to a new treatment bottle, and 1.5 mL of methanol / chloroform solvent is added again for extraction, and this step is repeated twice, and the obtained lipid extracts are combined, and 2.5 mL of chloroform and 3 mL of NaCl aqueous solution are added to the combined solution. The sample was shaken vigorously, centrifuged at 13000xg for 5min, the upper liquid was discarded, the lower organic phase was transferred to a new glass bottle, the organic phase was blown dry with a nitrogen blower, 1mL of sulfuric acid: methanol (5:95) solution was added, and then placed in a 90±2℃ water bath for 1.5h and taken out. After the temperature dropped to room temperature, 1mL of 0.9% NaCl and 500μL of n-hexane were added in sequence, and the solution was shaken vigorously to mix thoroughly. Then, the solution was separated by high-speed centrifugation (13000x g) or standing overnight, and the supernatant was taken to detect the composition and content of fatty acids using GC-MS. 37 kinds of fatty acid mixed standards were selected for qualitative and quantitative analysis of recombinant Saccharomyces cerevisiae fatty acids.

[0041] Example 2 Construction of fatty acid high-yield strain

[0042] According to the overlapping derivative PCR primer design method, the primers are designed so that the overlapping region of the adjacent fragments of the gene expression frame reaches 40 to 100 bp. The primers are designed to amplify the 208a site of the Saccharomyces cerevisiae CEN PK2-1C genome, the upstream and downstream homology arm fragments of the ADH1, ACH1 and MLS1 genes, and the expression frames of the genes ADH2, ACS1, ELO1 and ALD6. PCR is performed using a plasmid containing a defective tag as a template (as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3), and defective tag fragments pMHyLp-HIS, pMHyLp-TRP and pMHyLp-LEU defective tag fragments are amplified respectively. The gene integration frame is obtained by overlapping extension PCR.

[0043] (1) The upstream and downstream homology arm fragments of the ADH1 gene were amplified by primers F1 and R1; F2 and R2, the ADH2 gene expression cassette was amplified by primers F3 and R3, the pMHyLp-LEU fragment was amplified by primers F4 and R4, and the gene expression cassette was constructed by overlap extension PCR and transferred into Saccharomyces cerevisiae CEN PK2-1C to obtain strain FAS-1.

[0044] (2) The upstream and downstream homology arm fragments of the ACH1 gene were amplified by primers F5 and R5; F6 and R6, the ACS1 gene expression frame was amplified by primers F7 and R7, and the pMHyLp-TRP fragment was amplified by primers F8 and R8. The gene expression frame was constructed by overlap extension PCR and transferred into the recombinant strain FAS-1 to obtain the strain FAS-2.

[0045] (3) The upstream and downstream homology arm fragments of the MLS1 gene were amplified by primers F9 and R9; F10 and R10, the ALD6 gene expression frame was amplified by primers F11 and R11, and the pMHyLp-HIS fragment was amplified by primers F12 and R12. The gene expression frame was constructed by overlap extension PCR and transferred into the recombinant strain FAS-2 to obtain strain FAS-3.

[0046] (4) The upstream and downstream homology arm fragments of the 208a site were amplified by primers F13 and R13; F14 and R14, the ELO1 gene expression cassette was amplified by primers F15 and R15, and the pMHyLp-LEU fragment was amplified by primers F16 and R16. The gene expression cassette was constructed by overlap extension PCR and transferred into the recombinant strain FAS-3 to obtain strain FAS-4.

[0047] The method in Example 1 was used to test the FAS-1, FAS-2, FAS-3, and FAS-4 strains. The experimental results are shown in Figure 3 ,Depend on Figure 3 It was found that the total fatty acid content of the FAS-4 strain was the highest, so the FAS-4 strain was selected for subsequent experiments. In the above process, the constructed gene integration frame was transformed into the competent cells of Saccharomyces cerevisiae by the lithium acetate transformation method, and the colonies were picked for PCR verification and some PCR correct transformants were selected for sequencing verification.

[0048] Example 3 Construction of a high oleic acid producing recombinant Saccharomyces cerevisiae strain

[0049] According to the Δ9 desaturase genes published on NCBI, Puccinia graminis desaturase OLE1, Caenorhabditis elegans fat-5, fat-6 and fat-7, codon optimization was performed according to the codon preference of Saccharomyces cerevisiae and full gene synthesis was performed. Primers were designed to amplify the upstream and downstream homology arms of the YGL055W integration site of the Saccharomyces cerevisiae CEN PK2-1C genome, and the promoter P TEF1 ,P TDH1 ,P PGK1 ,P PYK ,P SED1 ,P ADH1 and P GPD and terminator T ADH1 ,T DNM1 ,TTPS1 ,T TDH3 ,T SLX5 ,T ATP5 and T CYC1 .

[0050] The corresponding gene fragments were amplified using the fully synthesized OLE1, fat-5, fat-6 and fat-7 plasmids as templates. The defective expression frame fragment was amplified using the plasmid pMHyLp-TRP containing the defective tag as a template.

[0051] The upstream and downstream homology arm fragments of the YGL055W site were amplified by primers F16 and R16; F17 and R17, and the OLE1 gene was amplified by primers F18-F20 and R18-R20. TEF1 and terminator T ADH1 The fat-5 gene was amplified by primers F18, F21, F22 and R20-R22, and the promoter P TEF1 and terminator T ADH1 The fat-6 gene was amplified by primers F18, F23, F24 and R20, R23, R24, and the promoter P TEF1 and terminator T ADH1 The fat-7 gene was amplified by primers F18, F25, F26 and R20, R25, R26, and the promoter P TEF1 and terminator T ADH1 fragment; the pMHyLp-TRP fragment was amplified by primers F27 and R27, and the gene expression cassette was constructed by overlap extension PCR and transferred into the recombinant strain FAS-4 to obtain strains FAS-5 to FAS-8.

[0052] The method in Example 1 was used to detect FAS-5 to FAS-8 strains. The experimental results are shown in Figure 4 ,from Figure 4 It can be found that the FAS-5 strain has the highest relative content of oleic acid, so the FAS-5 strain was selected for subsequent experiments. In the above process, the constructed gene integration frame was transformed into the competent cells of Saccharomyces cerevisiae by the lithium acetate transformation method, and the colonies were picked for PCR verification and some PCR-correct transformants were selected for sequencing verification.

[0053] Example 4 Construction of a recombinant Saccharomyces cerevisiae strain with similar breast milk fatty acid composition

[0054] According to the Δ12 desaturase gene Caenorhabditis elegans fat-2 and Yarrowia lipolytica desaturase FAD2 published on NCBI, codon optimization was performed according to the codon preference of Saccharomyces cerevisiae and full gene synthesis was performed. Primers were designed to amplify the upstream and downstream homologous arms of the 911b integration site of the Saccharomyces cerevisiae CEN PK2-1C genome, and the promoter P TEF1 ,P TDH1 ,P PGK1 ,P PYK ,P SED1 ,P ADH1 and P GPD and terminator T ADH1 ,T DNM1 ,T TPS1 ,T TDH3 ,T SLX5 ,T ATP5 and T CYC1 .

[0055] The corresponding gene fragments were amplified using the fully synthesized fat-2 and FAD2 plasmids as templates. The defective expression frame fragment was amplified using the plasmid pMHyLp-LEU containing the defective tag as a template for PCR.

[0056] The upstream and downstream homology arm fragments of the 911b site were amplified by primers F28 and R28; F29 and R29, and the promoter P was amplified by primers F30 and R30. TDH1 The terminator T was obtained by amplifying the fragment with primers F31 and R31. TDH3 The fat-2 gene was amplified by primers F32 and R32, the pMHyLp-HIS fragment was amplified by primers F33 and R33, and the gene expression cassette was constructed by overlap extension PCR and transferred into Saccharomyces cerevisiae FAS-5 to obtain strain FAS-9. The upstream and downstream homology arm fragments of the 911b site were amplified by primers F28 and R28; F29 and R29, and the promoter P was amplified by primers F34 and R34. TDH1 The fragment was amplified by primers F35 and R35 to obtain the terminator T TDH3 The FAD2 gene was amplified by primers F36 and R36, the pMHyLp-HIS fragment was amplified by primers F37 and R37, and the gene expression cassette was constructed by overlap extension PCR and transferred into Saccharomyces cerevisiae FAS-5 to obtain strain FAS-10.

[0057] The FAS-9 and FAS-10 strains were tested using the method in Example 1. The experimental results are shown in Figure 4 ,from Figure 4It can be found that the fatty acid composition of the FAS-10 strain is similar to that of breast milk, C16:0 (20% ± 2%), C18:1 (50% ± 3.8%) and C18:2 (20% ± 4%). In the above process, the constructed gene integration frame was transformed into the competent cells of Saccharomyces cerevisiae by the lithium acetate transformation method, and the colonies were picked for PCR verification and some PCR correct transformants were selected for sequencing verification.

[0058] Example 5 Recombinant Saccharomyces cerevisiae fermentation to produce fatty acids

[0059] All recombinant Saccharomyces cerevisiae strains in the present invention are fermented and extracted in the following manner: The recombinant Saccharomyces cerevisiae strains are streaked on SD plates (lacking the amino acids corresponding to the defective type) and cultured at 30° C. until a single colony grows.

[0060] Pick a single colony to the seed culture medium (any culture medium including a carbon source and amino nitrogen source-free sterile culture medium with glucose as the carbon source, a YPD sterile culture medium with a limited nitrogen source, an inorganic salt sterile culture medium or a soy peptone sterile culture medium with a limited nitrogen source can be used as the fermentation medium), and culture at 30°C and 220rpm for 16 to 20 hours until the cells reach the mid-logarithmic growth stage.

[0061] The seed culture solution is inoculated into the fermentation medium (any medium can be selected as the fermentation medium, which is a sterile medium without amino nitrogen source with glucose as carbon source, a sterile YPD medium with limited nitrogen source, a sterile inorganic salt medium, or a sterile soy peptone medium with limited nitrogen source) at an initial inoculum of 3-5%, and cultured at 30°C and 220rpm for 72h. After 72h, the fermentation is stopped, the bacterial solution is transferred to a 50mL centrifuge tube, centrifuged at 6000rpm at room temperature for 10min, the medium is discarded, and the culture is placed in a freeze dryer for freeze drying for later use.

[0062] Comparative Example:

[0063] S.cerevisiae CEN PK2-1C was replaced with S.cerevisiae W303; S.cerevisiae FY1679 and S.cerevisiae BY4743, and the fatty acid synthesis pathway was strengthened. The specific steps were the same as in Example 2 to obtain strains FAS-11 to FAS-13; the heterologous Δ9 desaturase gene was expressed. The specific steps were the same as in Example 3 to obtain strains FAS-14 to FAS-25; the heterologous Δ12 desaturase gene was expressed. The specific steps were the same as in Example 4 to obtain strains FAS-26 to FAS-31.

[0064] The strain obtained in the comparative example was fermented to produce fatty acids according to the steps of Example 5. The experimental results are shown in Figure 5As can be seen from the figure, the similarity between the fatty acid composition of the strain obtained in the comparative example of the present invention and the fatty acid of breast milk is lower than that in the embodiment.

[0065] The sequences of the primers used in the examples of the present invention are as follows:

[0066]

[0067]

[0068]

[0069]

[0070] SEQ ID NO.1:

[0071]

[0072] SEQ ID NO.2:

[0073] ATTAATTTCACAGGTAGTTCTGGTCCATTGGTGAAAGTTTGCGGCTTGCAGAGCACAGAGGCCGCAGAATGTGCTCTAGATTCCGATGCTGACTTGCTGGGTATTATATGTGTGCCCAATAGAAAGAGAACAATTGACCCGGTTATTGCAAGGAAAATTTCAAGTCTTGTAAAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAACCTAAGGAGGATGTTTTGGCTCTGGTCAATGATTACGGCATTGATATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGAATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTTCACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATTTCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAAAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGATTAAATGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACAAAATAGCAAATTTCGTCAAAAA

[0074] SEQ ID NO.3:

[0075]

[0076] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A strain of Saccharomyces cerevisiae engineered to produce a composition similar to breast milk fat. It is characterized in that The brewer's yeast engineering bacteria is based on Saccharomyces cerevisiae S. cerevisiae CEN PK2-1C is the host bacteria, increasing ADH2 , ACS1 , ALD6 Gene copy number, knockout ADH1 , ACH1 , MLS1 Gene, amplification ELO1 Gene expression cassette inserted into 208a site to increase fatty acid elongase ELO1 Gene copy number, integrated expression of Δ9 desaturase gene OLE1 and Δ12 desaturase genes FAD2 ; Said ADH2 , ACS1 , ALD6、ADH1 , ACH1 , MLS1 The ENTREZ GENE IDs of the genes are 855349, 851245, 856044, 854068, 852266, and 855606; ELO1 The ENTREZ GENE ID of the gene is 853243; the Δ9 desaturase gene OLE1 The ENTREZ GENE ID is 10534674; the Δ12 desaturase gene FAD2 The ENTREZ GENEID is 2906773.

2. Use of the engineered yeast Saccharomyces cerevisiae according to claim 1 in the fermentation production of breast milk-like fat.

3. The use according to claim 2, It is characterized in that The step of producing breast milk-like fat by fermentation is as follows: inoculating the engineered yeast Saccharomyces cerevisiae into a fermentation medium, and fermenting under a pH value of 6.0-8.0 to obtain the breast milk-like fat.

4. The use according to claim 3, It is characterized in that The fermentation medium is a carbon source-free, amino nitrogen source-free sterile medium, a YPD sterile medium with limited nitrogen source, an inorganic salt sterile medium or a soybean peptone sterile medium with limited nitrogen source.

5. The use according to claim 3, It is characterized in that The inoculation rate of the brewer's yeast engineering bacteria is 2% to 5%.

Images