Hanseniaspora uvarum and its applications

By screening out the yeast B4 of yeast B4 of yeast, the problem of difficult degradation of organic acids in high-concentration tangerine juice was solved, and the effect of efficient acid reduction and nutritional value was achieved.

CN116179378BActive Publication Date: 2025-07-11益为益生物制造(江门)有限公司
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202211555420.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-06
Publication Date
2025-07-11
Estimated Expiration
2042-12-06

AI Technical Summary

Technical Problem

The prior art is difficult to effectively degrade citric acid, malic acid, tartaric acid and succinic acid in high-concentration tangerine juice, resulting in waste of resources and environmental pollution, and the degradation effect of existing yeast strains on the composite organic acid is not significant.

Method used

A plant of Hansenospora pseudoguilliermondii B4 was screened, which can efficiently degrade citric acid, malic acid, tartaric acid and succinic acid under fermentation conditions, and is suitable for acid-reducing treatment of juice.

Benefits of technology

The efficient degradation rate of organic acids in tangerine juice is achieved at 97%, while the total flavonoid content of the juice is increased, and the nutritional value and taste of the juice is enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179378B_ABST
    Figure CN116179378B_ABST
Patent Text Reader

Abstract

The present invention discloses a strain of Hanseniaspora uvarum and its application. The name of this Hanseniaspora uvarum is Hanseniaspora pseudoguilliermondii B4, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on September 30, 2022, with the deposit number GDMCC No: 62848. This Hanseniaspora uvarum can tolerate high concentrations of organic acids, and can not only degrade citric acid, but also degrade organic acids such as succinic acid, tartaric acid, and malic acid. The degradation rates under citric acid, malic acid, succinic acid, and tartaric acid as the sole carbon source are 47.06%, 58.93%, 81.85%, and 31.82% respectively. This Hanseniaspora uvarum can be used for acid reduction applications in occasions with low to high concentrations of organic acids, and the acid reduction rate for organic acids in citrus juice reaches more than 97%. The total flavonoid content of the juice can be increased simultaneously during the acid reduction fermentation process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of food biotechnology, and specifically relates to a strain of Hansenula sporogenes and application thereof. Technical Background

[0002] With the vigorous development of the deep processing industry of fruits and vegetables, natural products rich in organic acids or their wastes are increasing. Excessive organic acid content is not conducive to resource utilization. It is necessary to screen microorganisms with high acid reduction ability for acid reduction treatment. For example, in the tangerine peel processing industry, tangerine pulp is a by-product. The citric acid content of tangerine juice is high, and the taste of direct drinking is not ideal. Therefore, the pulp is discarded in large quantities, causing great waste of resources and environmental damage. In addition to organic acids mainly composed of citric acid, tangerine juice also contains active ingredients such as amino acids, vitamins, limonin, flavonoids and polyphenol compounds, which have good development and utilization value. However, due to its high acidity, the sugar-acid ratio is not coordinated and the taste is not good, which hinders its application and development. In order to meet the public's healthy diet concept, it is possible to achieve tangerine juice with a suitable sweet and sour ratio and good taste and flavor without adding additional sugar or diluting and blending. The biological acid reduction method can better achieve the acid reduction of tangerine juice and ensure its nutritional value than the physical and chemical acid reduction methods. Similar to citrus fruits, other acidic agricultural products and natural products with organic acids as the main components can effectively degrade their organic acids through bio-acid reduction technology to improve the quality of their resource development and make them meet market demand.

[0003] National invention patent application CN 113604369A discloses a strain of grape spore Hansen yeast, which has a certain degradation rate for low concentration organic acids, such as 29.67%, 29.76% and 7.42% for citric acid (1.487 g / L), malic acid (0.575 g / L) and tartaric acid (0.059 g / L), respectively. However, the acid-reducing effect on fruits with high organic acid content is not significant. National invention patent application CN 111334441A discloses a strain of Kalibik Mayer yeast, which has degradation rates of 51.18%, 13.32%, 17.37%, 39.63% and 66.81% for citric acid (1.16 g / L), oxalic acid (0.021 g / L), D-malic acid (0.023 g / L), L-malic acid (0.034 g / L) and tartaric acid (0.081 g / L), respectively; National invention patent application CN 111019847A and national invention application CN 108676736A disclose a strain of terrestrial Issatchenia and a strain of Pichia pastoris, respectively, which can be used for biological deacidification of high-concentration citric acid, but only show the degradation effect on citric acid, without involving the degradation effect of other organic acids. It is unknown whether it is suitable for fruits with high content of complex organic acids.

[0004] In view of the problems existing in the prior art, the present patent application aims to screen out a new strain of yeast, which also has a high acid reduction rate for high-concentration organic acids and is applicable to agricultural products and natural products containing different organic acids, such as organic acids including citric acid, malic acid, tartaric acid, and succinic acid, etc., and has a broad market prospect. Summary of the Invention

[0005] The primary object of the present invention is to provide a strain of Hanseniaspora uvarum.

[0006] Another object of the present invention is to provide the application of the above-mentioned Hanseniaspora uvarum.

[0007] To achieve the above objects, the present invention adopts the following technical solutions:

[0008] A strain of Hanseniaspora uvarum, named Hanseniaspora uvarum (Hanseniaspora pseudoguilliermondii) B4, was deposited on September 30, 2022, at the Guangdong Provincial Microbial Culture Collection Center, Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, 100th Yard, Xianlie Middle Road, Guangzhou, Guangdong Province, with the deposit number GDMCC No: 62848.

[0009] The application of the above-mentioned Hanseniaspora uvarum in acid reduction.

[0010] The acid mentioned is an organic acid, including citric acid, malic acid, tartaric acid, succinic acid, etc.

[0011] The above-mentioned Hanseniaspora uvarum is particularly suitable for preparing fruit juice to reduce the acidity in the fruit juice, thereby improving the problem of high acidity in the fruit juice; preferably, it includes the following steps:

[0012] (1) Sterilize the fruit juice to be reduced in acidity.

[0013] (2) Add the above-mentioned Hanseniaspora uvarum to the sterilized fruit juice for fermentation to obtain fruit juice with reduced acidity.

[0014] The fruit juice mentioned in step (1) is preferably citrus fruit juice.

[0015] The sterilization in step (1) includes filtration sterilization or pasteurization, with the condition of sterilization at 80 ± 5°C for 15 min.

[0016] The fermentation conditions in step (2) are: ferment at 30°C and 180 rpm for 72 - 96 h.

[0017] Compared with the existing technology, the present invention has the following advantages and beneficial effects:

[0018] The present invention uses lemon as a separation material to isolate and purify a yeast strain, Hanseniaspora uvarum B4, which can efficiently degrade citric acid. It can not only degrade citric acid, but also degrade organic acids such as succinic acid, tartaric acid, and malic acid, and can tolerate high concentrations of organic acids. The degradation rates of citric acid, malic acid, succinic acid, and tartaric acid as the sole carbon source are 47.06%, 58.93%, 81.85%, and 31.82% respectively; the addition of reducing sugar reduces the degradation of tartaric acid, but promotes the degradation of other acids. This yeast can be used for acid reduction applications in occasions with low to high concentrations of organic acids, and the acid reduction rate of organic acids in citrus juice reaches more than 97%. The acid reduction fermentation process can simultaneously increase the total flavonoid content of the juice and improve its nutritional value. Applying it to the acid reduction of citrus juice is of great significance both theoretically and practically. It can provide a feasible technical route for biological acid reduction, provide technical support for improving the quality of juice processing products, and drive the development of juice industries such as citrus fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a phylogenetic tree diagram of Hanseniaspora uvarum B4.

[0020] Figure 2 It is a photograph of the colony morphology of Hanseniaspora uvarum B4.

[0021] Figure 3 It is a photograph of the Gram-stained cell morphology (100 times) of Hanseniaspora uvarum B4.

[0022] Figure 4 It is a graph showing the change in acid content during the fermentation of Hanseniaspora uvarum B4 in a medium with a single organic acid as the sole carbon source.

[0023] Figure 5 It is a graph showing the change in acid content during the fermentation of Hanseniaspora uvarum B4 in a medium with a mixed organic acid as the sole carbon source.

[0024] Figure 6 It is a graph showing the change in acid content during the fermentation of Hanseniaspora uvarum B4 in a medium with glucose and a single organic acid as a composite carbon source. DETAILED DESCRIPTION OF THE INVENTION

[0025] The present invention will be further described in detail below with reference to specific embodiments and the accompanying drawings.

[0026] The measurement methods used in the present invention:

[0027] Measurement of total acid and pH: The total acid refers to GB / T12456 2021; the pH is measured with a pH meter (PB-10).

[0028] Measurement of acid reduction rate:

[0029]

[0030] In the formula, A0 is the total acid content of the unfermented sample; A1 is the total acid content of the fermented sample.

[0031] Determination of organic acid components:

[0032] The specific liquid chromatography conditions for the determination of organic acids are as follows: chromatographic column: COSMOSIL PBr, mobile phase A: mobile phase B volume ratio is 95:5, mobile phase A is 0.02M phosphate buffer solution with pH = 2.5, mobile phase B is methanol, liquid phase conditions: isocratic elution for 15 min, flow rate: 0.8 mL / min, injection volume: 10 μL, column temperature: 35 °C, detection wavelength: 210 nm. The mixed standard and the sample are measured in turn. A standard curve is made with the standard sample concentration against the peak area, and the content of organic acids in the sample solution is calculated by the external standard method.

[0033] Standard curve: Mixed standard solutions of L-malic acid, tartaric acid, citric acid, and succinic acid with different concentrations are prepared by dissolving them in ultrapure water respectively. After filtering through a 0.22 μm microporous membrane, they are analyzed by HPLC on the machine to obtain the regression equation and correlation coefficient of the peak area (x) and the mass concentration of organic acids (y).

[0034] Treatment of the fermentation broth: The fermentation broth is centrifuged (10000 r / min, 5 min), and the supernatant is aspirated into a volumetric flask and diluted to a suitable concentration with ultrapure water. After filtering through a 0.22 μm membrane, it is measured on the machine, and each sample is repeated 3 times.

[0035] Example 1

[0036] Screening, isolation, purification and identification of Hanseniaspora uvarum B4

[0037] Slice the whole lemon and put it into an enrichment medium with 2 g / L citric acid as the sole carbon source, and culture it for 3 days in two ways: shaking (30 °C, 180 rpm) and static (30 °C) respectively. Take 1 mL of the enriched bacterial liquid after shaking and static fermentation respectively at 10 -4 ~10 -8Gradient dilution was spread on the selective medium and placed in a vertical anaerobic culture bag for incubation at 30 °C for 2 - 3 days. Colonies with larger color development circles on the selective medium were picked and placed in a liquid medium with 20 g / L citric acid as the sole carbon source. After fermentation at 30 °C and 180 rpm for 3 days, the pH value was measured. Eight strains that could increase the pH value of the liquid medium were obtained. They were repeatedly isolated and purified on YPD solid medium. After numbering the 8 strains respectively, they were sequenced and identified. Using the DNA-EZ Reagents VAll-DNA-Fast-Out universal one-step DNA extraction solution, 2 μL of the bacterial liquid activated with YPD liquid medium was added to 50 μL of the DNA extraction solution (Sangon Biotech, product number: B642315). After a water bath at 80 °C for 5 min, PCR was carried out. The ITS sequences of the primers were amplified using the universal primers ITS4 and ITS5. The PCR amplification conditions were: pre-denaturation at 94 °C for 4 min; 94 °C for 30 s, 55 °C for 30 s, 72 °C for 48 s, for 34 cycles; extension at 72 °C for 10 min. The following sequences were obtained:

[0038] ctttctggcgtacgtgactgcggagacattagattgaattatcattgttgctcgagttct

[0039] tgtttagatcttttacaataatgtgtatctttattggagatgtgcgcttaattgcgctgc

[0040] ttcattagagtgtcgcagtagaagtagtcttgcttgaatctcagtcaacgtttacacaca

[0041] ttggagttttttactttaatttaattctttctgctttgaatcgaaaggttcaaggcaaaa

[0042] aacaaacacaaacaattttattttattataattttttaaactaaaccaaaattcctaacg

[0043] gaaattttaaaataatttaaaactttcaacaacggatctcttggttctcgcatcgatgaa

[0044] gaacgtagcgaattgcgataagtaatgtgaattgcagatactcgtgaatcattgaatttt

[0045] tgaacgcacattgcgcccttgagcattctcaagggcatgcctgtttgagcgtcatttcct

[0046] tctcaaaagataattttttattttttggttgtgggcgatactcagggttagcttgaaatt

[0047] ggagactgtttcagtcttttttaattcaacacttagcttctttggagacgctgttctcgc

[0048] tgtgatgtatttatggatttattcgttttactttacaagggaaatggtaatgtaccttag

[0049] gcaaagggttgcttttaatattcatcaagtttgacctcaaatcaggtaggattacccgct

[0050] gaacttaagcatatcataaaccgcgaaggaa。

[0051] After alignment in the NCBI gene bank using BLAST, phylogenetic tree analysis was performed using MEGA5 software. The results of the phylogenetic tree analysis of its sequences are as Figure 1 shown. Finally, a strain of Hanseniaspora pseudoguilliermondii B4 was obtained. This strain B4 grew relatively fast on YPD solid medium. After 1 day of cultivation, the colony morphology was round, with a slightly raised center point, milky white, and a slightly lighter color at the edge. The colony morphology is as Figure 2 shown; a single colony was picked onto a glass slide, and under a microscope using the Gram staining method, the cells were observed to be spindle-shaped and stained red by Gram staining, as Figure 3 shown.

[0052] The composition of the enrichment medium is as follows: 2 g of ammonium sulfate, 0.4 g of dipotassium hydrogen phosphate, 0.5 g of magnesium sulfate, 0.2 g of manganese sulfate, 0.1 g of ferrous sulfate, 0.5 g of yeast peptone, 2 g of citric acid, made up to 1 L with distilled water, and the pH was adjusted to 4.0.

[0053] The composition of the selection medium is as follows: 2 g ammonium sulfate, 0.4 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate, 0.2 g manganese sulfate, 0.1 g ferrous sulfate, 0.5 g yeast peptone, 2 g citric acid, 15 g agar powder, 10 mL of 1% bromovanillin blue ethanol solution (the solute is bromovanillin blue, the solvent is 95% ethanol solution), make up to 1 L with distilled water, and adjust the pH to 4.0.

[0054] The composition of the liquid culture medium with citric acid as the sole carbon source is as follows: 2 g ammonium sulfate, 0.4 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate, 0.2 g manganese sulfate, 0.1 g ferrous sulfate, 0.5 g yeast peptone, and 20 g citric acid, dissolved in 1 L of distilled water, and the pH was adjusted to 4.0.

[0055] The spore-forming Hansen yeast B4 was deposited on September 30, 2022 at the Guangdong Microbial Culture Collection Center located at the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, with the deposit number GDMCC No: 62848, and the test result was survival.

[0056] Example 2

[0057] Degradation of organic acids by Hansenula sporogenes B4 in a culture medium containing citric acid, malic acid, tartaric acid and succinic acid at a concentration of 10 g / L as the sole carbon source. The initial pH of the culture medium was adjusted to 4.0 for fermentation.

[0058] The specific operation is as follows: the seed liquid of Hansenella spore B4 is inoculated with 2% (v / v) inoculation into the liquid culture medium with citric acid, malic acid, tartaric acid and succinic acid as the sole carbon source, respectively, and fermented at 30°C and 180rpm for 4 days, and the acid content is detected every 1 day. The preparation method of the liquid culture medium is: 2g of ammonium sulfate, 0.4g of dipotassium hydrogen phosphate, 0.5g of magnesium sulfate, 0.2g of manganese sulfate, 0.1g of ferrous sulfate, 10g of yeast peptone, 10g of organic acid, dissolved with distilled water, pH adjusted to 4.0, and then fixed to 1L with distilled water; 50mL is dispensed into a 150mL conical flask, sterilized at 121°C for 20min, and after cooling, 1mL of a mixed solution of vitamin B1 and vitamin C (the concentration of the two vitamins is 0.5mg / mL each) is added.

[0059] The results are as follows Figure 4 As shown, in the culture medium with organic acid as the only carbon source, Hansenula sporogenes B4 can utilize a single organic acid for growth. After 4 days of fermentation, the degradation rates of citric acid, malic acid, succinic acid and tartaric acid were 47.06%, 58.93%, 81.85% and 31.82%, respectively.

[0060] Example 3

[0061] The degradation effect of Hanseniaspora uvarum B4 in a medium with 30 g / L citric acid as the sole carbon source. The initial pH of the medium was adjusted to 4.0 for fermentation.

[0062] The specific operation is as follows. The seed liquid of Hanseniaspora uvarum B4 was inoculated into the medium with 30 g / L citric acid as the sole carbon source at an inoculation amount of 2% (v / v), and fermented at 30 °C and 180 rpm for 4 days, after which the acid content was detected. The preparation method of the medium is as follows: 2 g of ammonium sulfate, 0.4 g of dipotassium hydrogen phosphate, 0.5 g of magnesium sulfate, 0.2 g of manganese sulfate, 0.1 g of ferrous sulfate, 10 g of yeast peptone, 30 g of citric acid, dissolved in 1 L of distilled water, the pH was adjusted to 4.0, aliquoted 50 mL into 150 mL conical flasks, sterilized at 121 °C for 20 min, and after cooling, 1 mL of a mixed solution of vitamin B1 and vitamin C (each 0.5 mg / mL) was added.

[0063] After 4 days of fermentation, the citric acid content in the fermentation broth was 2.93 g / L, and the acid reduction rate was as high as 89.94%, indicating that this Hanseniaspora uvarum B4 can efficiently degrade citric acid.

[0064] Example 4

[0065] The degradation effect of Hanseniaspora uvarum B4 on organic acids in a medium with a mixture of four organic acids, namely citric acid, malic acid, tartaric acid and succinic acid, as the carbon source. The initial pH of the medium was adjusted to 4.0 for fermentation.

[0066] The specific operation is as follows: The seed liquid of Hanseniaspora uvarum B4 was inoculated into the liquid medium with the mixed organic acids as the sole carbon source at an inoculation amount of 2% (v / v), and fermented at 30 °C and 180 rpm for 4 days. The acid content was detected every 1 day. The preparation method of the medium is as follows: 2 g of ammonium sulfate, 0.4 g of dipotassium hydrogen phosphate, 0.5 g of magnesium sulfate, 0.2 g of manganese sulfate, 0.1 g of ferrous sulfate, 10 g of yeast peptone, 5 g of citric acid, 5 g of malic acid, 5 g of tartaric acid, 5 g of succinic acid, dissolved in 1 L of distilled water, the pH was adjusted to 4.0, aliquoted 50 mL into 150 mL conical flasks, sterilized at 121 °C for 20 min, and after cooling, 1 mL of a mixed solution of vitamin B1 and vitamin C (each 0.5 mg / mL) was added.

[0067] In the medium with the mixture of four organic acids, the degradation rate order of the organic acids is citric acid > succinic acid > malic acid > tartaric acid, and the maximum degradation rates are 71.06%, 60.72%, 35.12% and 26.24% ( Figure 5 ).

[0068] Example 5

[0069] The degradation effect of Hanseniaspora uvarum B4 on organic acids in a medium with 10 g / L glucose and 10 g / L single organic acid (citric acid, malic acid, succinic acid, and tartaric acid) as a complex carbon source, and the initial pH of the medium was adjusted to 4.0 for fermentation.

[0070] The specific operation is as follows: The seed liquid of Hanseniaspora uvarum B4 was inoculated into the medium with glucose and organic acid as a complex carbon source at an inoculation amount of 2% (v / v), and fermented at 30 °C and 180 rpm for 4 days. The acid content was detected every 1 day. The preparation method of the medium is as follows: 2 g of ammonium sulfate, 0.4 g of dipotassium hydrogen phosphate, 0.5 g of magnesium sulfate, 0.2 g of manganese sulfate, 0.1 g of ferrous sulfate, 10 g of yeast peptone, 10 g of organic acid, 10 g of glucose, dissolved in 1 L of distilled water, the pH was adjusted to 4.0, dispensed into 50 mL in a 150 mL conical flask, sterilized at 121 °C for 20 min, and after cooling, 1 mL of a mixed solution of vitamin B1 and vitamin C (0.5 mg / mL each) was added.

[0071] The results are as Figure 6 shown. When there is glucose as a complex carbon source, the degradation of tartaric acid by Hanseniaspora uvarum B4 is inhibited, and the degradation rates of citric acid, malic acid, and succinic acid after 4 days of fermentation are 48.05%, 64.71%, and 85.12% respectively.

[0072] Example 6

[0073] The application of Hanseniaspora uvarum B4 in reducing the acid content of Xinhui tangerine juice is as follows: In the tangerine juice, 5% (v / v) of the seed liquid of Hanseniaspora uvarum B4 was inoculated, and oscillating fermentation was carried out at a temperature of 30 °C, a liquid loading of 20%, and a rotation speed of 180 rpm for 84 h, and the acid reduction rate, pH, and total flavonoid increment of the tangerine juice were measured.

[0074] After fermentation, the total acid of the tangerine juice changed from 13.61 g / L to 0.19 g / L, and the acid reduction rate (calculated based on the total acid) reached 98.62%. The pH changed from 3.13 to 6.02, and the total flavonoid changed from 105.63 g / 100 g to 125.37 g / 100 g, with an increment of 18.69%.

[0075] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A Hanseniaspora uvarum, characterized in that: The name of the Hansen yeast with spores is Hansen yeast with spores ( Hanseniaspora pseudoguilliermondii ) B4, was deposited on September 30, 2022 at the Guangdong Microbial Culture Collection Center, Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, with the deposit number GDMCC No: 62848.

2. Use of Hanseniaspora uvarum according to claim 1 in acid reduction, characterized in that: The acids mentioned above are citric acid, malic acid, tartaric acid and succinic acid.

3. Use of the Hanseniaspora uvarum according to claim 1 in the preparation of citrus juice, characterized in that It includes the following steps: (1) Sterilize the fruit juice whose acidity is to be reduced; (2) Add Hanseniaspora uvarum described in claim 1 to the sterilized fruit juice for fermentation to obtain the fruit juice with reduced acidity.

4. The application of Hanseniaspora uvarum according to claim 3 in the preparation of citrus fruit juice, characterized in that: The sterilization described in step (1) is filtration sterilization; The fermentation conditions described in step (2) are: ferment at 30 °C and 180 rpm for 72 - 96 h.

5. The application of Hanseniaspora uvarum according to claim 3 in the preparation of citrus fruit juice, characterized in that: The sterilization described in step (1) is pasteurization, and the pasteurization conditions are sterilize at 80 ± 5 °C for 15 min; The fermentation conditions described in step (2) are: ferment at 30 °C and 180 rpm for 72 - 96 h.

Citation Information

Patent Citations

  • Pichia fermentans capable of degrading citric acid, and application thereof

    CN108676736A

  • Issatchenkia terricola and application thereof in citric acid degradation

    CN111019847A

  • Meyerozyma caribbica strain and application thereof

    CN111334441A

  • Wickerhamomyces anomalus strain for whole-process green production of fruit wine, and application of wickerhamomyces anomalus strain

    CN112094761A

  • Hanseniaspora uvarum and application thereof

    CN113604369A