Aspergillus okinawaensis strain yz-1 and application thereof

Abstract

The application discloses an Aspergillus luchuensis YZ-1 and application thereof, and belongs to the field of microorganism safety.The application separates a new strain from a black tea in Guilin, Guangxi, identifies the strain by ITS, beta tubulin and calmodulin, and the identification result is Aspergillus luchuensis, and the preservation number is CCTCC NO: M 20221462.It is verified by experiments that the strain can inhibit various bacteria and fungi, the water extract and fermentation liquor of the strain can significantly inhibit the growth of Aspergillus flavus, the fermentation liquor has a strong inhibiting effect on the growth of Aspergillus flavus, and the strain has a strong adsorbing effect on aflatoxin B1.Therefore, the Aspergillus luchuensis disclosed by the application has important application value in preventing and controlling mold pollution in grain crops and food.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial safety, in particular to a strain of Aspergillus okinawaensis YZ-1 and its application. BACKGROUND

[0002] Foodborne microorganisms are the first major hazard affecting food safety, and are a global threat. Some microorganisms in stored grain can cause moldy changes in grain and its products under certain conditions. Due to the fast reproduction speed and strong metabolic capacity of microorganisms, the initial damage caused by microorganisms is not easy to be detected, and thus the moldy changes caused by microorganisms can lead to a serious decrease in the quality of grain, and even lead to the complete loss of the edible value of grain. Therefore, we must not ignore the damage of microorganisms to the safety of stored grain.

[0003] The Food and Agriculture Organization (FAO) of the United Nations estimates that nearly 25% of the global food supply is affected by aflatoxin contamination. Aflatoxins (AFT) are secondary metabolites produced by Aspergillus flavus and Aspergillus parasiticus, which have very strong toxicity and carcinogenicity. Many scholars have researched microorganisms and their metabolites to inhibit Aspergillus flavus and published papers. Generally, more research is conducted on bacteria, such as lactic acid bacteria, Bacillus subtilis, and actinomycetes. More research on the inhibition of Aspergillus flavus by fungi is conducted on yeast, such as the inhibition of Aspergillus flavus by non-Saccharomyces cerevisiae studied by Li Li in the doctoral thesis (Li Li. Inhibition of Aspergillus flavus by probiotics and the mechanism of toxin production [D]. Chinese Academy of Agricultural Sciences). The inhibitory substances mainly exist in the fermentation broth and volatile gases. Gao Junjie et al. (Gao Junjie, Yuan Xiaofeng, Liu Wenhong, et al. Isolation and screening of Fritillaria thunbergii Miq. endophytic fungi and preliminary study on the properties of Aspergillus sp. BJ7 strain with antibacterial activity [J]. Chinese Medicine Science and Technology, 2012, 19(2): 3.) isolated and screened Fritillaria thunbergii Miq. endophytic fungi and preliminarily studied the antibacterial activity. The antibacterial experiment found that the metabolites of Fritillaria thunbergii Miq. endophytic fungi had inhibitory effects on G + , G - Bacteria have universal antibacterial effects, but the inhibition rate is not explained, and the inhibition of fungi is not explained.

[0004] More than 20 aflatoxins and their derivatives are known, namely B1, B2, B2a, G1, G2, G2a, M1, M2, etc. AFB1 is the most toxic among them. Previous studies have found that the toxicity of AFB1 is 416 times, 68 times and 10 times that of melamine, white arsenic and KCN, respectively. Since AFB1 is harmful to humans and animals, it is necessary to take effective detoxification methods to control their pollution in food. Several strategies for removing AFB1 in food and feed have been reported, including physical methods such as heating, radiation and plasma degradation, and chemical methods such as ozone, hydrogen peroxide and citric acid treatment. Physical methods are widely used in the food industry due to their convenience, speed and efficiency, but they have the disadvantages of high equipment cost, possible changes in material properties and radiation pollution. Chemical methods mainly use chemical reagents to react with AFB1 molecules to destroy their toxic structure and achieve detoxification. This method is simple and low in cost, but it may cause secondary pollution and damage to the nutritional components of the product. Microbial detoxification is the most promising method due to its strong specificity, low pollution and ability to ensure food safety and nutrition.

[0005] Currently, microbial detoxification methods mainly have two aspects: one is to use microbial cells to adsorb AFB1, which is mainly related to the composition of the cell wall. The most studied are lactic acid bacteria and yeast; the other is that some microorganisms can produce metabolic products (mainly extracellular enzymes) to degrade AFB1. However, the types of microorganisms that can be used for AFB1 detoxification are relatively few, and there are problems such as large environmental condition influence on AFB1 adsorption and low adsorption efficiency. Therefore, it is necessary to explore new microbial strains for AFB1 detoxification to solve the current problems. SUMMARY

[0006] The purpose of the present application is to provide a strain of Aspergillus luchuensis YZ-1 and its application, to solve the problems existing in the prior art. The strain has good inhibitory effect on various bacteria and fungi, and has strong adsorption function of aflatoxin B1, and has wide application prospect in the field of food safety and food safety.

[0007] To achieve the above purpose, the present application provides the following solutions:

[0008] The present application provides a strain of Aspergillus luchuensis YZ-1, the preservation number of which is CCTCC NO: M 20221462, the preservation time is September 20, 2022, the preservation unit is China Center for Type Culture Collection, and the preservation address is Wuhan, China. Wuhan University.

[0009] The application also provides the application of the Aspergillus okinawaensis YZ-1 or its mycelium or metabolite in preventing and treating bacteria and fungi.

[0010] The application also provides the application of the Aspergillus okinawaensis YZ-1 or its mycelium or metabolite in preparing a bacteriophage for preventing and treating bacteria and fungi.

[0011] Preferably, the bacteria include Cronobacter sakazakii, Burkholderia gladioli, Escherichia coli, Listeria monocytogenes, Salmonella and Pseuduinonasaeruginosa; and the fungi include Aspergillus flavus, Penicillium and Botrytis cinerea.

[0012] The application also provides the application of the Aspergillus okinawaensis YZ-1 or its mycelium in adsorbing aflatoxin B1.

[0013] The application also provides the application of the Aspergillus okinawaensis YZ-1 or its mycelium in preparing a bacteriophage for adsorbing aflatoxin B1.

[0014] The application also provides a bacteriophage for inhibiting bacteria and fungi, which comprises the Aspergillus okinawaensis YZ-1.

[0015] Preferably, the bacteriophage comprises water extract of mycelium of the Aspergillus okinawaensis YZ-1 or sterile mycelium fermentation liquor.

[0016] More preferably, the preparation method of the water extract of mycelium is as follows:

[0017] The Aspergillus okinawaensis YZ-1 mycelium is freeze-dried and ground into powder in liquid nitrogen, the powder and water are extracted at a mass-volume ratio of 1:30 for 2 hours, and the extraction is repeated twice for 30 minutes each time to obtain the water extract of Aspergillus okinawaensis, which is concentrated on a rotary evaporator and freeze-dried to obtain the water extract powder.

[0018] The preparation method of the sterile mycelium fermentation liquor is as follows:

[0019] The lens cleaning paper is folded in half and placed in a separatory funnel to filter the Aspergillus okinawaensis mycelium cultured for 2 days to obtain the sterile mycelium fermentation liquor, which is freeze-dried and concentrated by 5 times, filtered with a 0.22 μm water filter membrane to obtain the concentrated sterile mycelium fermentation liquor.

[0020] The application also provides a bacterial agent for adsorbing aflatoxin B1, comprising the Aspergillus okinawaensis YZ-1.

[0021] Preferably, the bacterial agent comprises the Aspergillus okinawaensis YZ-1.

[0022] More preferably, the adsorption component of the Aspergillus okinawaensis YZ-1 for aflatoxin B1 is the cell wall of the bacterial body.

[0023] More preferably, the preparation method of the bacterial cell wall is as follows: the Aspergillus okinawaensis YZ-1 stored at-80℃ is activated and cultured using PDA medium, the culture temperature is 25℃±1℃, and the culture time is 5d-7d; the Aspergillus okinawaensis spores grown in the solid for 5d-7d are counted using a hemocytometer, and are inoculated in the PDB medium at a density of 2-5×10 5 / mL, and are placed in a 28℃ shaking bed for culture at 180rpm for 4-6d; the cultured bacterial liquid is poured into a separating funnel with lens paper to filter the bacterial body, the bacterial body is washed with PBS for 3 times to obtain the Aspergillus okinawaensis bacterial body; the Aspergillus okinawaensis bacterial body is freeze-dried, is broken by liquid nitrogen grinding to obtain Aspergillus okinawaensis bacterial powder, the bacterial powder is dissolved in a PBS solution, and is centrifuged at 5000r·min -1 for 15min to obtain the Aspergillus okinawaensis cell wall.

[0024] The application discloses the following technical effects:

[0025] (1) The strain separated and obtained in the application is identified by ITS, beta tubulin and calmodulin, which is more accurate and efficient than single gene identification to the species.

[0026] (2) The Aspergillus okinawaensis YZ-1 separated and obtained in the application has a strong inhibitory effect on a plurality of bacteria and fungi, the bacteria include Cronobacter sakazakii, Burkholderia gladioli, Escherichia coli, Listeria monocytogenes, Salmonella and Pseudomonas aeruginosa, and the fungi include Aspergillus flavus, Penicillium and Botrytis cinerea.

[0027] (3) The Aspergillus okinawaensis YZ-1 used in the application has strong adsorption effect on aflatoxin, and the adsorption efficiency can reach 98.33±0.51%, and the concentration of adsorbed AFB1 is high, and 65.29±1.53% can still be removed at 16000ppb for 72h.

[0028] (4) The adsorption condition of Aspergillus okinawaensis YZ-1 on aflatoxin B1 in the application is wide, and it still has strong adsorption effect in artificial gastric juice and artificial small intestinal juice. Aspergillus okinawaensis has strong inhibition effect on various fungi such as Aspergillus flavus, and has strong adsorption effect on aflatoxin B1, and is a potential strain with economic value and broad application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0030] Figure 1 It is a 7-day colony morphology chart and 4x microscope chart of Aspergillus okinawaensis YZ-1 in the application; A is a 7-day colony morphology chart of Aspergillus okinawaensis; B is a 4x microscope chart of 7-day colony of Aspergillus okinawaensis;

[0031] Figure 2 It is a phylogenetic tree chart of Aspergillus okinawaensis YZ-1 in the application;

[0032] Figure 3 It is a bacterial inhibition chart of Aspergillus okinawaensis YZ-1 in the application;

[0033] Figure 4 It is a mold inhibition chart of Aspergillus okinawaensis YZ-1 in the application; A is the inhibition of Aspergillus okinawaensis on Aspergillus flavus, B is the inhibition of Aspergillus okinawaensis on Penicillium, and C is the inhibition of Aspergillus okinawaensis on Botrytis;

[0034] Figure 5 It is a mold inhibition chart of Aspergillus okinawaensis YZ-1 in the application; A is the inhibition of Aspergillus okinawaensis on Aspergillus flavus, B is the inhibition of Aspergillus okinawaensis on Penicillium, and C is the inhibition of Aspergillus okinawaensis on Botrytis;

[0035] Figure 6 It is a mold inhibition chart of Aspergillus okinawaensis YZ-1 in the application; A is the inhibition of Aspergillus okinawaensis on Aspergillus flavus, B is the inhibition of Aspergillus okinawaensis on Penicillium, and C is the inhibition of Aspergillus okinawaensis on Botrytis;

[0036] Figure 7 Figure 1 is a chart of the inhibition of Aspergillus flavus by different treatment methods of the Aspergillus okinawaensis YZ-1 sterile body fermentation liquid of the present application; A is a control group; B is a sterile body fermentation stock solution; C is a protease treatment group; D is a trypsin treatment group; E is a group with pH adjusted to 5.8; F is a 100°C heating group;

[0037] Figure 8 Figure 2 is a chart of the removal of different concentrations of AFB1 in the liquid culture process of Aspergillus okinawaensis YZ-1 in Example 7;

[0038] Figure 9 Figure 3 is a chart of the removal efficiency of different components of Aspergillus okinawaensis YZ-1 on AFB1 in Example 8;

[0039] Figure 10 Figure 4 is a chart of the adsorption efficiency of Aspergillus okinawaensis YZ-1 on different concentrations of AFB1 in Example 9;

[0040] Figure 11 Figure 5 is a chart of the stability of the Aspergillus okinawaensis YZ-1 and AFB1 combination in Example 10;

[0041] Figure 12 Figure 6 is a chart of the adsorption efficiency of Aspergillus okinawaensis YZ-1 at different temperatures in Example 11;

[0042] Figure 13 Figure 7 is a chart of the adsorption efficiency of Aspergillus okinawaensis YZ-1 at different pH values in Example 12;

[0043] Figure 14 Figure 8 is a chart of the adsorption efficiency of Aspergillus okinawaensis YZ-1 in artificial gastric juice and artificial small intestinal juice in Example 13;

[0044] Figure 15 Figure 9 is a chart of the effect of the cell wall of Aspergillus okinawaensis YZ-1 on adsorption efficiency in Example 14;

[0045] Figure 16 Figure 10 is a chart of the FTIR spectra of Aspergillus okinawaensis YZ-1 before and after adsorption of AFB1 in Example 15. DETAILED DESCRIPTION

[0046] Various exemplary embodiments of the present application will now be described in detail, which should be considered in a descriptive sense only and not for purposes of limitation to the present application, as understood by persons of ordinary skill in the art. The detailed description sets forth various exemplary embodiments of the present application according to the best of the present inventor's knowledge and understanding.

[0047] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where a range of values is provided, it is understood that each intervening value, to the upper and lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.

[0048] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the present specification will control.

[0049] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples herein. The description and examples are illustrative only.

[0050] With respect to the use of "comprising", "including", "containing", "having" and "ensing" and the like, these terms are used in the sense of "open ended" and are intended to mean including but not limited to.

[0051] Example 1 Isolation and identification of Aspergillus okinawaensis

[0052] I. Isolation of Aspergillus okinawaensis

[0053] 1. Black tea was purchased from a Guilin, Guangxi, China farmers market. The tea was gently crushed and spread onto the surface of PDA media under sterile conditions; after 5 days a punch was used to take a small piece of the mycelium from the edge of the colony and placed onto fresh PDA; this was repeated until no other mycelium was visible to the naked eye and a primary purified strain was obtained; the mycelium was scraped from the solid media using a sterile forceps and placed into a 100 mL conical flask containing 50 mL of sterile water and small glass beads, this was placed into a 180 rpm shaker for 2 hours and filtered using double layer sterile lens paper to obtain a spore suspension, this was diluted to 10 6 cfu / mL using sterile water in triplicate, diluted 10 5 fold and plated onto PDA and placed into a 25 °C incubator for 7 days, single colonies were scraped and the above procedure was repeated to obtain a 10 6 cfu / mL spore suspension which was placed into a 4 °C refrigerator for storage.

[0054] 2. Observe the morphology of Aspergillus ryukyu using a microscope.

[0055] 3. Results

[0056] (1) Morphological identification

[0057] like Figure 1 As shown, the colony has a velvety texture, with the basal hyphae initially green and later turning brown, while the reverse side is colorless; the conidia have large heads, initially spherical, later becoming sparsely radial, with spherical or nearly spherical vesicles, and the sporulation structure is single or double-layered, with spherical conidia and rough walls.

[0058] (2) 18S rDNA identification

[0059] PCR amplification was performed using the DNA of the isolated strain as a template. The isolated beads were identified by the (ITS)1-5.8S rRNA-ITS2 gene, the β-tubulin gene, and the calmodulin gene. The primers for the amplification of the three genes are as follows:

[0060] (ITS)1-5.8S rRNA-ITS2 gene sequence:

[0061] ITS1: 5′-TCC GTA GGT GAA CCT GCG G-3′);

[0062] ITS2: 5′-TCC TCC GCT TAT TGA TAT GC-3′);

[0063] β-tubulin gene sequence:

[0064] βt2a: 5′-GGT AAC CAA ATC GGT GCT GCT TTC-3′;

[0065] βt2b: 5′-ACC CTC AGT GTA GTG-ACC CTT GGC-3′;

[0066] Calmodulin gene sequence:

[0067] CF1L: 5′-GCC GAC TCT TTG ACY GAR GAR-3′;

[0068] CF4: 5′-TTT YTG CAT CAT RAG YTG GAC-3′.

[0069] The amplification conditions are: (1) pre-denaturation: 95°C for 5 minutes; (2) denaturation: 95°C for 45 seconds; (3) annealing: 60°C for 45 seconds; (4) extension: 72°C for 1.5 minutes; (5) repeat steps (2)-(4) for 32 times; (6) final extension: 72°C for 5 minutes.

[0070] The PCR reaction system (50 μl system) includes 25 μl 2x Taq Master Mix (Novoprotein, China), 2 μl upstream primer (10 mol / L), 2 μl downstream primer (10 mol / L), 2 μl DNA template and 19 μl ddH2O.

[0071] The 18S rDNA sequence of the strain is compared and analyzed with the corresponding sequence in the National Center for Biotechnology Information (NCBI) GeneBank database. The partial sequence of 18S rDNA, as shown in the sequence table SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, has 100% sequence similarity with Aspergillus luchuensis after comparison, and the phylogenetic tree constructed therefrom is shown in Figure 2 The above identification result shows that the strain is Aspergillus luchuensis, numbered YZ-1.

[0072] The Aspergillus luchuensis YZ-1 has been preserved in the China Center for Type Culture Collection on September 20, 2022, at the address of Wuhan University, Wuhan, China, with the preservation number of CCTCC NO: M 20221462.

[0073] SEQ ID NO. 1 is as follows:

[0074] gggggggatcctacctgatccgaggtcacctggaaaaatggttggaaaacgtcggcaggcgccggccaatcctacagagcatgtgacaaagccccatacgctcgaggatcggacgcggtgccgccgctgcctttcgggcccgtccccccggagagggggacggcgacccaacacacaagccgggcttgagggcagcaatgacgctcggacaggcatgccccccggaataccagggggcgcaatgtgcgttcaaagactcgatgattcactgaattctgcaattcacattagttatcgcatttcgctgcgttcttcatcgatgccggaaccaagagatccattgttgaaagttttaactgattgcattcaatcaactcagactgcacgctttcagacagtgttcgtgttggggtctccggcgggcacgggcccggggggcaaaggcgcccccccggcggccgacaagcggcgggcccgccgaagcaacagggtataatagacacggatgggaggttgggcccaaaggacccgcactcggtaatgatccttccgcaggttacccttacggaag

[0075] SEQ ID NO. 2 is as follows:

[0076] ttctgccctggattggggatggataacatcatctctcaagctatctcggcttgagttcagatgttatttatcgggtatatagctatcgggttaagaacacgtctaacaactcaacaggcagaccatctctggcgagcacggccttgacggctccggtgtgtaagtgcaactttttcacacctctcaattggtcgacaatgtggaaaggattgggtttcctgacacgcaggatagttacaatggcacctccgacctccagctggagcgcatgaacgtctacttcaacgaggttagatcacaccgtccctgagttttttcacgacaatatcatcaatgtcctgaccacttcagcaggctagcggtaacaagtatgtcccccgtgccgtcctcgtcgatctcgagcccggtaccatggacgctgtccgtgccggtcccttcggccagctcttccgtcccgacaacttcgtcttcggccagtccggtgctggtaacaactgggccaagggtcactaaccctgaggggta

[0077] SEQ ID NO. 3 is as follows:

[0078] ctccctcttttgtgagtgctccctgaataaacccccgatcactcaaattgatgacctatcatgaccggctcataatgctaatgtattctcgaactcaataggacaaggatggcgatggtgggtggaattctgtcccctttacgttttacccgtagcgcccgatccgaccgcgggatttcgacagccatttccccatcgatctgaatcattatactgatgtaatctggaaataggccagatcaccaccaaggagctcggcactgtgatgcgctccctcggccagaacccctccgagtctgagcttcaggacatgatcaacgaggttgacgctgacaacaacggaacgatcgacttccccggtatgtgatagatctacgcctgtagggcgggaatgccgtatgggttgtgattgacttttgccgccagaattccttaccatgatggctcgtaagatgaaggacaccgactccgaggaggaaatccgcgaggctttcaaggtcttcgaccgcgacaacaatggtttcatctccgccgcggagttgcgccacgtcatgacctccattggcgagaagctcactgacgacgaagtcgatgagatgatccgtgaggctgaccaggatggtgatggccgcatcgactgtatgtttcccattcttgatatgcccgtgatatagcatgctaactctgctaccagacaacgagttcgtccagctctgaaatggcaaaaaaa

[0079] The following examples further illustrate the inhibitory effect of Aspergillus okinawaensis on bacteria and molds.

[0080] Example 2 Inhibition of bacteria by Aspergillus okinawaensis YZ-1

[0081] I. Preparation of spores of Aspergillus okinawaensis

[0082] (1) The Aspergillus okinawaensis cake stored in a -80°C refrigerator was inoculated into PDA medium and subcultured twice in succession.

[0083] (2) The spores of Aspergillus okinawaensis grown on PDA for 6-7 days after two subcultures were counted on a hemocytometer.

[0084] Method for obtaining Aspergillus ryukyu spores: Add a small amount of sterile distilled water to the above PDA medium, gently scrape the fresh mold spores on the surface with a sterile spreader, filter with lens paper to remove hyphae, and put them into sterile centrifuge tubes to obtain Aspergillus ryukyu spore suspension. Dilute the spore suspension with sterile water to an appropriate concentration and count them with a hemocytometer.

[0085] II. Preparation of the Confrontation Plate

[0086] Five μL of the obtained Aspergillus ryukyu spores were spotted at four symmetrical locations on a TSA culture plate (90 mm) at a distance greater than 2 cm from the center. The plate was then placed in a 25°C incubator and grown for 2 days.

[0087] III. Activation of the test bacteria

[0088] Cronobacter sakazakii, Burkholderia gladioli, Escherichia coli, Listeria monocytogenes, Salmonella, and Pseudomonas aeruginosa, stored at -80℃ in the laboratory, were activated overnight in TSB at 37℃ with a shaker at 180 rpm, and then activated a second time.

[0089] IV. The confrontation between Aspergillus ryuko and bacteria

[0090] Two μL of bacteria with an OD density adjusted to 0.5 were spotted in the center of a 2-day-old Aspergillus ryukiae solid culture medium as the experimental group. Two μL of bacteria with an OD density adjusted to 0.5 were spotted in the center of a blank TSA culture medium as the control group. After 18 hours, photos were taken and the inhibition rate was measured and calculated using calipers.

[0091] The method for calculating the antibacterial rate is shown in equation (I):

[0092]

[0093] V. Results

[0094] The inhibitory effect of Aspergillus ryuki on bacteria is as follows: Figure 3 As shown, *Aspergillus ryukiatus* exhibits significant inhibitory effects against *Cronobacter sakazakii*, *Burkholderia gladioli*, *Escherichia coli*, *Listeria monocytogenes*, *Salmonella*, and *Pseudomonas aeruginosa* after 18 hours. Currently, no studies have been found on the antibacterial effects of *Aspergillus ryukiatus*. In this invention, *Aspergillus ryukiatus* shows an inhibition rate of 40% against both Gram-negative and Gram-positive bacteria after 18 hours, demonstrating strong antibacterial potential.

[0095] Example 3 Inhibition of mold by Aspergillus okinawaensis YZ-1

[0096] I. Preparation of spore solution of Aspergillus okinawaensis, Aspergillus flavus, Botrytis cinerea and Penicillium spores

[0097] The preparation method is shown in step (2) of Example 2.

[0098] II. Cross method confrontation

[0099] The obtained fungal spore solution was counted by a hemocytometer and the density was adjusted to 2 x 10 7 , respectively. 5 μL of pathogenic fungi was spotted in the center of PDA medium (90 mm), and two plates were used for each group, one as a control and the other as an experimental group, and the experiment was repeated three times in parallel. 5 μL of Aspergillus okinawaensis was spotted at the cross position of the experimental group which was more than 2 cm away from the pathogenic fungi. The diameters of the test fungi of the experimental and control groups were measured at 3 d, 5 d and 7 d, and the inhibition rate was calculated.

[0100] The calculation method of the inhibition rate is shown in formula (II):

[0101]

[0102] III. Results

[0103] The results of the inhibition of fungi by Aspergillus okinawaensis are shown in Table 1, and the inhibition rate of pathogenic fungi by Aspergillus okinawaensis was 77%-81% at 7 d, which showed a strong inhibitory effect on pathogenic fungi. Aspergillus okinawaensis has a strong inhibitory effect on mold, and has a broad application prospect for controlling mold toxin pollution. Figure 4 Example 4 Inhibitory effect of different components of Aspergillus okinawaensis on Aspergillus flavus

[0104] I. Effect of volatile gas of Aspergillus okinawaensis on Aspergillus flavus

[0105] Aspergillus okinawaensis and Aspergillus flavus spores were obtained, respectively, and the method and counting method were the same as step (2) of Example 2. 5 μL of Aspergillus okinawaensis and Aspergillus flavus was spotted in the center of PDA medium (60 mm) for cross culture, and the culture condition was 25℃ in an incubator for 5 d.

[0106] II. Effect of water extract of Aspergillus okinawaensis on Aspergillus flavus

[0107] (1) After freeze-drying of Aspergillus okinawaensis, the powder was ground with liquid nitrogen, and extracted for 2 h at a ratio of 1:30 of the fungus and water, and ultrasonicated for 30 min at 300 W. The extraction was repeated twice to obtain the water extract of Aspergillus okinawaensis, which was concentrated 5 times by a rotary evaporator and freeze-dried to obtain the freeze-dried powder of the water extract.

[0108]

[0109] ​(2) The water extract freeze-dried powder was dissolved with water to prepare a water extract stock solution with a concentration of 100 mg / mL, and filtered with a 0.22 μm water filter membrane to remove bacteria;

[0110] (3) The PDA medium containing 2.5 mg / mL water extract was prepared: high-temperature sterilization at 121°C, and then 2.5 mg / mL water extract was added when the temperature dropped to a non-scalding state without coagulation;

[0111] (4) 5 μL of Aspergillus flavus was spotted in the center of the PDA medium containing 2.5 mg / mL water extract, and incubated in a 25°C incubator for 5 days to observe the effect of the water extract of Aspergillus okinawaensis on Aspergillus flavus.

[0112] III. Effect of 80% ethanol extract of Aspergillus okinawaensis on Aspergillus flavus

[0113] (1) After the Aspergillus okinawaensis was freeze-dried, it was ground into powder with liquid nitrogen, and then extracted for 2 h at a mass-volume ratio of 1:30 of the fungus and 80% ethanol, and ultrasonicated for 30 min at 300 W. The extraction was repeated twice to obtain the water extract of Aspergillus okinawaensis. The water extract was concentrated 5 times with a rotary evaporator, and then freeze-dried to obtain the 80% ethanol extract freeze-dried powder;

[0114] (2) The 80% ethanol extract freeze-dried powder was dissolved with a DMSO-containing water solution to prepare an 80% ethanol extract stock solution with a concentration of 40 mg / mL, and filtered with a 0.22 μm organic filter membrane to remove bacteria;

[0115] (3) The PDA medium containing 2.5 mg / mL 80% ethanol extract was prepared: high-temperature sterilization at 121°C, and then 2.5 mg / mL 80% ethanol extract of Aspergillus okinawaensis was added when the temperature dropped to a non-scalding state without coagulation;

[0116] (4) 5 μL of Aspergillus flavus was spotted in the center of the PDA medium containing 2.5 mg / mL 80% ethanol extract, and incubated in a 25°C incubator for 5 days to observe the effect of the 80% ethanol extract of Aspergillus okinawaensis on Aspergillus flavus.

[0117] IV. Effect of Aspergillus okinawaensis fermentation broth on Aspergillus flavus

[0118] (1) The spores of Aspergillus okinawaensis were obtained by the step (2) in Example 2, and then added to PDB at a final concentration of 5 × 10 5 / mL to culture at 28°C on a shaker for 2-3 days. The bacteria were removed by filtration to obtain a bacteria-free fermentation broth, which was freeze-dried and concentrated 5 times to obtain the Aspergillus okinawaensis fermentation concentrate;

[0119] (2) Take 5 μL of Aspergillus flavus and point it in the center of PDA medium containing 2.5 mg / mL 80% ethanol extract, and place it in a 25°C incubator for 5 days of static culture. Observe the effect of Aspergillus fermentum on Aspergillus flavus.

[0120] V. Control group

[0121] The control group is divided into two, one is a solid medium containing only PDA, and the other is a PDA medium containing 0.5% DMSO. Take 5 μL of the above obtained Aspergillus flavus spore solution and point it in the center of the control medium, respectively, and place it in a 25°C incubator for 5 days of static culture.

[0122] VI. Results

[0123] The results of the inhibition of Aspergillus flavus by different components of Aspergillus fermentum YZ-1 are shown in Table 1. The calculation method of the inhibition of Aspergillus flavus by different components is the same as that in Example 3. Figure 5

[0124] The results show that 80% ethanol extract and volatile gas have no inhibitory effect on Aspergillus flavus, and Aspergillus fermentum water extract and fermentation broth have good inhibitory effect on Aspergillus flavus. The inhibition rates of water extract and fermentation broth on Aspergillus flavus on the 5th day are 33.3% and 46.2%, respectively. Therefore, Aspergillus fermentum inhibits the growth of Aspergillus flavus by the combined action of the mycelium and fermentation products, and has potential application value for controlling Aspergillus flavus pollution.

[0125] Example 5 Inhibition of Aspergillus flavus by Aspergillus fermentum YZ-1 sterile body fermentation concentrate

[0126] I. Method for obtaining Aspergillus fermentum fermentation broth

[0127] Aspergillus fermentum spores were obtained by step (2) in Example 2. Aspergillus fermentum spores were added to PDB at a final concentration of 5 x 10 5 / mL and cultured at 28°C on a shaker for 2 days. The mycelium was removed by filtration to obtain sterile body fermentation broth. The fermentation stock solution was freeze-dried and concentrated 5 times. The experimental group was added with 10%, 20%, and 30% concentrated fermentation broth, respectively.

[0128] II. Obtaining Aspergillus flavus spores

[0129] The method for obtaining Aspergillus flavus spores is the same as that for obtaining Aspergillus fermentum spores in step (2) in Example 2.

[0130] III. Inhibition of Aspergillus flavus by Aspergillus fermentum sterile body fermentation broth

[0131] Take 5 μL of the obtained Aspergillus flavus spores and point it in the center of each group of medium, respectively, and place it in a 25°C incubator for 5 days of static culture. Observe the inhibitory effect of Aspergillus fermentum fermentation broth at different concentrations on Aspergillus flavus on the 3rd and 5th days. ​

[0132] IV. Results

[0133] The inhibitory effect of different concentrations of sterile body fermentation broth on Aspergillus flavus is shown in Table 1. As can be seen from the inhibition results, the inhibition effect increases with the increase of the concentration of the fermentation broth, and has a dose-dependent effect. The inhibition rate of the 30% group for 3d is 46.6%, and the inhibition rate for 5d is 40%. Figure 6

[0134] Example 6 Inhibition of Aspergillus flavus by different treatment methods of Aspergillus okinawaensis YZ-1 sterile body fermentation broth

[0135] I. Different treatment methods

[0136] (1) Sterile body fermentation stock solution: The fermentation broth of Aspergillus okinawaensis cultured for 2d was filtered to remove mycelium, and then the fermentation broth was filtered to remove bacteria as the sterile body fermentation broth of Aspergillus okinawaensis;

[0137] (2) Enzyme treatment group: The sterile body fermentation broth was treated with protease (1 mg / mL) and trypsin (1 mg / mL) at 37°C for 2h. The pH of the sterile body fermentation broth was adjusted to the optimum pH of the protease and trypsin (pH = 8) during the treatment, and then adjusted back to the original pH of the fermentation broth after the treatment;

[0138] (3) pH adjusted to 5.8 group: The sterile body fermentation broth of Aspergillus okinawaensis was adjusted to the same pH value of 5.8 as the control PDB;

[0139] (4) 100°C heating group: The sterile body fermentation broth of Aspergillus okinawaensis was heated at 100°C for 30min.

[0140] II. Inhibition of Aspergillus flavus by different treatment methods of Aspergillus okinawaensis YZ-1 sterile body fermentation broth

[0141] 1mL of PDB (control group), sterile body fermentation broth of Aspergillus okinawaensis, and sterile body fermentation broth of Aspergillus okinawaensis treated by the above different methods were added to a 24-well plate, respectively;

[0142] 10μL of Aspergillus flavus spores obtained were added to the 24-well plate and cultured in a 25°C incubator for 48h to observe the results, and the results are shown in Table 2. Wherein A: control group; B: sterile body fermentation stock solution; C: protease treatment group; D: trypsin treatment group; E: pH adjusted to 5.8 group; F: 100°C heating group; the inhibition rate of Aspergillus flavus by different treatment methods was calculated by detecting the OD value by a microplate reader; Figure 8

[0143] The inhibition rate calculation method is shown in formula (III):

[0144]

[0145] The inhibition results are shown in Table 3. Figure 7 ​​As shown: the calculated sterile body fermentation liquor of Aspergillus flavus inhibition rate was 83%, protease treatment group on Aspergillus flavus inhibition rate was 55%, trypsin treatment group on Aspergillus flavus inhibition rate was 54%, pH to 5.8 group on Aspergillus flavus inhibition rate was 76%, 100 DEG C heating group on Aspergillus flavus inhibition rate was 61%; thus it can be illustrated that the component of inhibiting Aspergillus flavus in the fermentation liquor of Aspergillus shahii is protein substance. Subsequently, the effective bacteriostatic protein can be extracted to control Aspergillus flavus, and the application adds a new strain and control method for controlling Aspergillus flavus.

[0146] The following examples are further illustrated in terms of the removal efficiency and adsorption efficiency of Aspergillus flavus B1 by Aspergillus shahii.

[0147] Example 7 Removal of different concentrations of AFB1 by Aspergillus shahii YZ-1 in liquid culture process

[0148] I. Preparation of Aspergillus shahii spores same as example 2.

[0149] II. Preparation of AFB1 stock solution

[0150] Dissolve AFB1 standard into methanol to a concentration of 1 mg / mL, and dilute AFB1 to a concentration of 40 ug / mL when needed, and filter sterilize with 0.22 μm organic filter membrane as stock solution.

[0151] III. Inoculate Aspergillus shahii spores into PDB to make the final spore concentration 5x10 5 / mL, and add 40 μg / mL of AFB1 to make the initial concentration of AFB1 in the culture solution 100 ppb, 500 ppb, 1000 ppb, 2000 ppb, 4000 ppb respectively, and place in a 28 DEG C shaker at 180 rpm, and detect the AFB1 content at 24 h, 48 h, 72 h respectively.

[0152] The removal efficiency of AFB1 in the range of 100 ppb-4000 ppb by Aspergillus shahii in liquid culture process at 24 h, 48 h and 72 h is shown in Table 1. Figure 8 As can be seen from the results, the AFB1 removal ability of Aspergillus shahii is very strong, and the removal rate is proportional to the time and inversely proportional to the concentration; with the extension of removal time, the removal rate increases, and with the increase of removal concentration, the removal efficiency decreases; for example, the removal efficiency of 100 ppb concentration of AFB1 at 24 h is 83.26±0.8%, the removal efficiency at 48 h is 96.23±0.85%, and the removal efficiency at 72 h is 98.03±0.45%; the removal efficiency of 4000 ppb concentration of AFB1 at 24 h is 41.1±1.01%, the removal efficiency at 48 h is 68.1±1.01%, and the removal efficiency at 72 h is 86.3±1.52%.

[0153] Example 8 Removal efficiency of AFB1 by different components of Aspergillus okinawaensis YZ-1

[0154] I. Method for obtaining different components of Aspergillus okinawaensis

[0155] The Aspergillus okinawaensis stored at -80°C was activated and cultured using PDA medium, the culture temperature was 25°C±1°C, and the culture time was 5-7 days; the Aspergillus okinawaensis spores grown in the solid for 5-7 days were counted using a hemocytometer, and then inoculated into PDB medium at a density of 2-5×10 5 / mL, and placed in a 28°C shaker at 180 rpm for 4-6 days; the cultured bacterial liquid was poured into a separatory funnel containing lens paper to filter the bacterial cells, and the obtained fermentation liquid was filtered using a 0.22 μm water filter to remove bacteria; the bacterial cells were washed with PBS for 3 times to obtain Aspergillus okinawaensis cells for adsorbing aflatoxin B1; the washed bacterial cells were broken in an ultrasonic cell disruptor at 300 W under ice bath for 25 minutes, and the broken bacterial cells were removed by centrifugation to obtain intracellular material.

[0156] II. The bacterial cells were weighed after absorbing the surface water on the water-absorbing paper, and bacterial cells with a wet weight of 0.08 g / mL were weighed, 40 μg / mL of AFB1 stock solution and water were added to obtain an initial concentration of 1000 ppb, and the sterile fermentation liquid and intracellular material were used to remove AFB1 with a final concentration of 1000 ppb, the removal temperature was 28°C, and the residual content of AFB1 was detected after 72 hours.

[0157] The removal efficiency of AFB1 by different components of Aspergillus okinawaensis is shown in Table 1. Figure 9 As can be seen from the results, the component for removing AFB1 is Aspergillus okinawaensis cells. The removal efficiency of AFB1 by the bacterial cells is 94.26±0.97% after 72 hours, and the sterile fermentation liquid and intracellular material have no effect on the removal of AFB1.

[0158] Example 9 Adsorption efficiency of Aspergillus okinawaensis YZ-1 cells for different concentrations of AFB1

[0159] The method for obtaining Aspergillus okinawaensis cells is the same as step I in Example 8, and the AFB1 stock solution is step II in Example 7.

[0160] The weight of Aspergillus okinawaensis cells used for adsorbing AFB1 is 0.08 g / mL of wet weight, the initial concentration of AFB1 for adsorption is 500 ppb, 1000 ppb, 2000 ppb, 4000 ppb, 8000 ppb, and 16000 ppb, the residual content of AFB1 was detected after 72 hours at 28°C, and the adsorption rate was calculated.

[0161] The adsorption efficiency of Aspergillus okinawaensis cells for different concentrations of AFB1 is shown in Table 2. Figure 10As shown in the results, the adsorption of AFB1 by Aspergillus okinawaensis gradually decreased with the increase of AFB1 concentration, but the adsorption rate of AFB1 at 16000 ppb for 72 h was still more than 60%, indicating that Aspergillus okinawaensis had strong adsorption capacity for AFB1.

[0162] Example 10 Stability of AFB1-Aspergillus okinawaensis YZ-1 complex

[0163] The method for obtaining Aspergillus okinawaensis cells is the same as step one in Example 8, and the AFB1 stock solution is the same as step two in Example 7.

[0164] After the cells were weighed after absorbing the surface water on the water-absorbing paper, 0.08 g / mL of the cells were weighed, 40 μg / mL of the AFB1 stock solution and water were added, the initial concentration of adsorption was 1000 ppb, and after 72 h of adsorption at 28°C, the cells were washed by water, PBS, methanol, HCl and NaOH at 28°C on a shaker at 180 rpm overnight, the elution rate of AFB1 after washing was detected to determine the stability of the AFB1-Aspergillus okinawaensis complex.

[0165] The stability of the AFB1-Aspergillus okinawaensis complex is shown in Figure 11 As shown in the results, the elution rate of AFB1 by other solvents except methanol was only 3.45±0.3%-4.66±0.41%, the elution rate of methanol was higher than that of other solvents, and the elution rate after overnight washing was 40.3±1.47%; but overall, the combination of Aspergillus okinawaensis and AFB1 was relatively stable, and water, PBS, HCl and NaOH were not easy to wash away the AFB1 combined to the cells.

[0166] Example 11 Adsorption efficiency of Aspergillus okinawaensis YZ-1 cells at different temperatures

[0167] The method for obtaining Aspergillus okinawaensis cells is the same as step one in Example 8, and the AFB1 stock solution is the same as step two in Example 7.

[0168] After the cells were weighed after absorbing the surface water on the water-absorbing paper, 0.08 g / mL of the cells were weighed, 40 μg / mL of the AFB1 stock solution and water were added, the initial concentration of adsorption was 1000 ppb, and after 72 h of adsorption at 28°C, the cells were washed by water, PBS, methanol, HCl and NaOH at 28°C on a shaker at 180 rpm overnight, the elution rate of AFB1 after washing was detected to determine the stability of the AFB1-Aspergillus okinawaensis complex.

[0169] The adsorption efficiency of Aspergillus okinawaensis cells at different temperatures is shown in Figure 12As shown in the results, the AFB1 adsorption efficiency of Aspergillus okinawaensis at 25-40°C for 24h was 68.46±1.12%-78.66±0.68%, which indicated that Aspergillus okinawaensis had strong adsorption capacity for AFB1 at 25-40°C, and the adsorption efficiency was better at 28-40°C.

[0170] Example 12 Adsorption efficiency of Aspergillus okinawaensis YZ-1 mycelium at different pH

[0171] The method for obtaining Aspergillus okinawaensis mycelium was the same as step one in Example 8, and the AFB1 stock solution was step two in Example 7.

[0172] The water was adjusted to pH 3.2, pH 4.2, pH 5.2, pH 6.2, pH 7.2, and pH 8.2 by using 1 mol / L HCl.

[0173] The Aspergillus okinawaensis mycelium was added to the aqueous solution with different pH and AFB1 concentration of 1000 ppb for adsorption for 24h, and the adsorption efficiency of Aspergillus okinawaensis mycelium at different pH was compared.

[0174] The adsorption efficiency of Aspergillus okinawaensis mycelium at different pH is shown in Table 2. Figure 13 As shown in the results, there was no significant difference in the adsorption rate of Aspergillus okinawaensis at pH 3.2-pH 8.2 for AFB1, and the adsorption rate was greater than 70%, which indicated that pH had little effect on the adsorption of AFB1 by Aspergillus okinawaensis.

[0175] Example 13 Adsorption efficiency of Aspergillus okinawaensis YZ-1 mycelium in artificial gastric juice and artificial small intestinal juice

[0176] The method for obtaining Aspergillus okinawaensis mycelium was the same as step one in Example 8, and the AFB1 stock solution was step two in Example 7.

[0177] The AFB1 stock solution was added to the artificial gastric juice and artificial small intestinal juice to make the concentration 1000 ppb, and the mycelium with a wet weight of 0.08g was added thereto, which was placed at 28°C for adsorption. The residual content of AFB1 was detected at 24h, 48h, and 72h, respectively, and the adsorption rate was calculated.

[0178] The adsorption efficiency of Aspergillus okinawaensis in artificial gastric juice and artificial small intestinal juice is shown in Table 3. Figure 14 As shown in Table 3, at 72h, the adsorption efficiency of Aspergillus okinawaensis for AFB1 in artificial gastric juice was (92.53±1.11%), and the adsorption efficiency of Aspergillus okinawaensis for AFB1 in artificial small intestinal juice was (94.3±0.96%), which was not lower than that of the control group (adsorption efficiency of 92.7±0.91%). It can be seen that the adsorption efficiency of Aspergillus okinawaensis in artificial gastric juice and artificial small intestinal juice was good, which indicated that Aspergillus okinawaensis had good adsorption effect for AFB1 in vivo.

[0179] Example 14 Influence of Aspergillus okinawaensis YZ-1 cell wall on adsorption efficiency

[0180] The method for obtaining Aspergillus okinawaensis mycelia was the same as step one in Example 8, and the AFB1 storage solution was the same as step two in Example 7.

[0181] After the Aspergillus okinawaensis mycelia were freeze-dried, they were broken by grinding in liquid nitrogen to obtain Aspergillus okinawaensis mycelia powder, which was dissolved in PBS solution. The solution was centrifuged at 5000 r·min-1for 15 min, and the supernatant was discarded. The Aspergillus okinawaensis mycelia powder was obtained by centrifugation. -1 After centrifugation for 15 min, the Aspergillus okinawaensis cell wall was obtained. The cell wall was treated with 40 mg / mL and 80 mg / mL snailase for 4 h, and the snailase was removed. AFB1 stock solution was added to the Aspergillus okinawaensis mycelia, cell wall, and snailase-treated cell wall, and water was added to make the initial concentration of AFB1 1000 ppb. After 72 h, the remaining content of AFB1 was detected, and the adsorption rate was calculated.

[0182] The influence of Aspergillus okinawaensis cell wall on adsorption efficiency is shown in Figure 15 As shown in the results, there was no significant difference in the adsorption efficiency of AFB1 between the Aspergillus okinawaensis mycelia (93.1 ± 0.7%) and the cell wall (91.4 ± 1.12%) after 72 h of adsorption. After the cell wall was destroyed by snailase treatment, the adsorption efficiency of AFB1 by Aspergillus okinawaensis was significantly reduced. The adsorption efficiency was inversely proportional to the concentration of snailase, and the adsorption efficiency decreased with increasing snailase concentration (67.6 ± 1% and 46 ± 0.83% after treatment with 40 mg / mL and 80 mg / mL snailase, respectively), indicating that the adsorption of AFB1 by Aspergillus okinawaensis was mainly due to the cell wall.

[0183] Example 15 FTIR spectra of Aspergillus okinawaensis YZ-1 before and after adsorption of AFB1

[0184] Aspergillus okinawaensis was used to adsorb AFB1 at concentrations of 1000 ppb and 4000 ppb, and Aspergillus okinawaensis control was not used to adsorb AFB1. The method was the same as that in Example 9. The mycelia after 72 h of adsorption and the control mycelia were frozen overnight at -80°C and freeze-dried in a freeze dryer until the weight was constant. 2 mg of mycelia powder (dry weight) was mixed with 200 mg of potassium bromide powder in a marble mortar, ground evenly, and a suitable amount of powder was pressed into a tablet. The tablet was placed on the detection table of a Fourier transform infrared absorption spectrometer, and scanning was performed in the range of 4000-400 cm-1. -1

[0185] The FTIR spectra of Aspergillus okinawaensis before and after adsorption of AFB1 are shown in Figure 16 ​As shown in the figure, after 72 hours of adsorption of 1000ppb and 4000ppb AFB1 by Aspergillus shahum, the peak shape remained basically unchanged, indicating that AFB1 had no impact on the basic structure of the bacteria. Some absorption peaks showed blue shift and red shift, such as the absorption peak at 3273.5, which was blue shifted to 3277.5 and 3280, because the peaks at 3400-3200 cm -1 were wide and strong, which were formed by the combined action of associated O-H stretching vibration peaks and N-H stretching vibration peaks, so the movement of the absorption peak at 3273.5 may be due to the participation of hydroxyl and amino groups on the cell wall. The absorption peaks at 2960-2850 cm -1 were mainly from the stretching vibration of C-H or N-H bonds in methyl (CH3), methylene (CH2) and CH (methylene), and the absorption peaks were mainly from proteins and lipids. In the experiment, the absorption peak at 2881 was blue shifted to 2882 and 2883.5, indicating that methyl, methylene and methylene participated in the adsorption. The peaks at 1820-1627 cm -1 were amide I bands, which were caused by the stretching vibration of C=O in amide group (-CONH2). The peaks at 1570-1540 cm -1 were amide II bands, which were mainly absorption peaks caused by the coupling of N-H bending vibration and part of C-N stretching vibration. The peaks at 1430-1050 cm -1 were amide III bands, which were mainly absorption peaks caused by the coupling of C-N stretching vibration. In the experiment, the single peak at 1708 cm -1 was changed to a double peak, indicating that C=O participated in the adsorption. The absorption peak at 1583 cm -1 was red shifted to 1556 cm -1 after treatment with 1000ppb and 4000ppb AFB1. The absorption peaks at 1622 cm -1 were blue shifted to 1629 cm -1 after treatment with 1000ppb and 4000ppb AFB1, indicating that the adsorption of AFB1 by the bacteria may involve N-H and C-H, and AFB1 may interact with the proteins on the bacteria. The absorption peak at 1329.5 cm -1 was blue shifted to 1334 cm -1 after adsorption of AFB1. The absorption peaks at 1215.5 cm -1 were blue shifted to 1219.5 cm -1 and 1221.5 cm -1 after treatment with 1000ppb and 4000ppb AFB1, respectively. The absorption peaks at 1185.5 cm -1 were blue shifted to 1188.5 cm -1 and 1190 cm-1 The results show that the C-N group is involved in the adsorption process. In summary, the groups involved in the adsorption of AFB1 by the bacterial cells are amido, hydroxyl, amino, methyl, methylene and methine groups.

[0186] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application as defined by the claims.

Claims

1. A strain of Aspergillus Ryukyu ( Aspergillus luchuensis YZ-1, characterized in that, The preservation number of the Aspergillus luchuensis is CCTCC NO: M 20221462.

2. The use of Aspergillus okinawaensis YZ-1 according to claim 1 for the prevention and treatment of bacteria and fungi for non-therapeutic purposes, characterized in that, The bacteria is *Cronobacter sakazakii* (… Cronobacter sakazakii ), Burkholderia gladioli ( Burkholderia gladioli ), Escherichia coli ( Escherichia coli Listeria monocytogenes () Listeria monocytogenes ),salmonella( Salmonella ) and Pseudomonas aeruginosa ( Pseuduinonas aeruginosa The fungus is Aspergillus flavus ( ); Aspergillus flavus ), Penicillium ( Penicillium ) and gray mold ( Botrytis cinerea ).

3. Use of the Aspergillus okinawaensis YZ-1 according to claim 1 for the preparation of a bacterial and fungal control agent for non-therapeutic purposes, characterized in that, The bacteria is *Cronobacter sakazakii* (… Cronobacter sakazakii ), Burkholderia gladioli ( Burkholderia gladioli ), Escherichia coli ( Escherichia coli Listeria monocytogenes () Listeria monocytogenes ),salmonella( Salmonella ) and Pseudomonas aeruginosa ( Pseuduinonas aeruginosa The fungus is Aspergillus flavus ( ); Aspergillus flavus ), Penicillium ( Penicillium ) and gray mold ( Botrytis cinerea ).

4. The application of Aspergillus luchuensis YZ-1 in adsorbing aflatoxin B1 according to claim 1.

5. The application of Aspergillus luchuensis YZ-1 in preparing a bacterial agent for adsorbing aflatoxin B1 according to claim 1.

6. A microbial agent for inhibiting bacteria and fungi, characterized by, Aspergillus luchuensis YZ-1 according to claim 1.

7. A bacterial agent that adsorbs aflatoxin B1, characterized in that, Aspergillus luchuensis YZ-1 according to claim 1.

Images