A primer composition and its application

Abstract

The present invention discloses a primer composition and its application, and relates to the technical field of molecular biology. The primer composition comprises an upstream primer STV11-F1 having a sequence as shown in SEQ ID NO:1 and a downstream primer STV11-R1 having a sequence as shown in SEQ ID NO:2. The present invention also discloses a kit comprising the primer composition and a method for identifying resistance to rice stripe disease using the primer composition based on HRM. Based on the primer composition, PCR amplification is performed on a rice DNA sample to be tested, and HRM analysis scanning is performed on the PCR product, and typing of the rice to be tested is achieved according to the HRM analysis result, which can perform rapid and high-throughput screening of the STV11 gene for resistance to stripe disease and resistance identification on the rice variety to be tested, accelerate the breeding of new rice stripe disease-resistant varieties, and solve the problems of low accuracy, cumbersome process, low efficiency, and unsafe operation existing in the prior art.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to identification of resistance to rice stripe leaf blight. Background Art

[0002] Rice stripe disease is a serious rice virus disease in the temperate zone of East Asia caused by the small brown planthopper. It is widely distributed in countries and regions such as Japan, China, South Korea, the Soviet Union and South America. Its pathogen is Rice Stripe Virus (RSV), a single-stranded RNA virus belonging to the genus Tenuivirus (or genus Flexovirus). Unlike bacterial or fungal diseases, once the stripe disease occurs, it cannot be reversed by existing physical and chemical methods. Therefore, it is also one of the most difficult diseases to prevent and control in rice cultivation.

[0003] In recent years, rice stripe disease has broken out in the middle and lower reaches of the Yangtze River and in Shandong and Henan, especially in japonica rice. Infected plants often develop chlorotic stripes or patches on the lower part of the sword leaves, and most of the panicles are withered or small and deformed, resulting in serious yield reduction.

[0004] Rice stripe disease is a viral disease transmitted by the virus vector, the gray leafhopper. Therefore, rice resistance to the disease is mainly manifested in two aspects: disease resistance and insect resistance. Disease resistance refers to resistance to the stripe virus, which can be divided into resistance to virus infection and tolerance after virus infection; while insect resistance refers to resistance to the virus vector, the gray leafhopper. Based on the experience of prevention and control of the disease, cultivating and planting varieties resistant to rice stripe disease is one of the most economical and effective means of preventing and controlling the disease.

[0005] Traditional rice disease resistance breeding is to select rice plants by phenotypic selection through field resistance identification, which is time-consuming and easily restricted by environmental conditions. The identification results are prone to errors and the selection efficiency is low. Moreover, like most viruses, stripe virus has a wide range of variations. Therefore, it is urgent to explore new breeding technologies to screen rice stripe disease resistant varieties. With the maturity of sequencing technology and the continuous innovation of molecular biology methods, new biotechnologies such as molecular marker-assisted selection (MAS) and gene editing are gradually applied to the cultivation of new rice varieties that combine high yield, high quality and multi-resistance. And the mining of disease resistance genes is a prerequisite for the use of biotechnology to select disease-resistant varieties.

[0006] Washio et al. discovered two dominant complementary genes Stv-a and Stv-b for resistance to stripe disease in Japanese upland rice varieties. Stv-a is located on the short arm of chromosome 6 and is linked to the horny endosperm Wx gene and the light-sensitive gene Se-1. Subsequently, Washio et al. located an incomplete dominant gene Stv-b in the indica rice variety Modan. i , which is equivalent to Stv-b. Further, Hayano-Saito et al. i The gene is located between XNpb220 (0.9 cM) and XNpb257 (0.9 cM) on rice chromosome 11 and is tightly linked to ST10 (0 cM). Further studies have found that Stv-b i Located in the approximately 286 kb region where two BACs overlap. Stv-b i The gene has been used as a stable source of resistance to stripe disease in breeding, carrying Stv-b i Rice varieties carrying the gene have always shown stable resistance. The gene was eventually located in the 48kb interval between markers ST49 and ST82 on the long arm of chromosome 11 and was successfully cloned. In the QTL positioning of some resistant varieties, several major QTLs for RSV resistance have been discovered one after another. For example, Ding Xiulan et al. used the recombinant inbred line population DV85 / Kinmaze and the backcross recombinant inbred line population Nipponbare / Kasalath / / NipponbareL to locate the gene in the S2260-G257 marker interval on chromosome 11. Maeda et al. found that the upland rice variety Kanto72 carries a major RSV resistance site located in the same interval of chromosome 11. Wu et al. detected three resistance QTLs in the variety Dular, one located on chromosome 3, and the other two located in the adjacent marker intervals RM287-RM209 and RM209-RM21 on chromosome 11. Zhang et al. used the doubled haploid population of Zhaiyeqing 8 / Jingxi 17 to locate a stably expressed QTL on chromosome 11, which is located in the interval CT533-CT224.

[0007] In recent years, with the continuous deepening of research, several genes resistant to leaf stripe disease have been further precisely located. For example, Wu et al. constructed a chromosome single segment substitution line using the indica rice variety Teqing and the susceptible japonica rice variety Lemont, and replaced qSTV11 TQ The gene is located in the approximately 55.7 kb interval between CAPs3 and CAPs2 on chromosome 11. Zhang et al. used the highly resistant indica rice variety Kasalath to express qSTV11 KASThe gene was located in the approximately 39.2 kb interval between two markers C1 and R53 on chromosome 11. The gene was eventually successfully cloned and named STV11. Wang et al. used the indica rice variety IR24 to clone qSTV11 i The gene was located in the approximately 74 kb interval between markers F12-1 and F12-20 on chromosome 11. Zhang et al. identified two QTLs (qSTV11 HAB -1 and qSTV11 HAB -2) respectively locate, among which, qSTV11 HAB -1 gene was located in the 333kb interval of marker R15-RM209 on chromosome 11. HAB The -2 gene was located in the approximately 203 kb interval between markers R69 and R73 on chromosome 11. Kwon et al. used the indica rice variety Shingwang to identify qSTV11 SG The gene was located in the approximately 150 kb interval between two markers InDel11 and InDel5 on chromosome 11.

[0008] It can be seen that in the past few decades, different researchers have detected multiple stripe resistance genes using different genetic analysis populations, and have detected the presence of multiple major QTLs that stably express stripe resistance on rice chromosome 11, such as Stv-b i ,qSTV11 IR24 ,qSTV11 i ,qSTV11 HAB -1,qSTV11 HAB -2, qSTV11 TQ ,qSTV11 KAS and qSTV11 SG wait.

[0009] One of the methods for screening resistance genes is to select target genes from the currently detected disease-resistant genes and develop specific molecular markers for auxiliary selection by using the base differences in the target genes. Currently, the developed markers are either based on enzyme digestion and agarose or polyacrylamide gel electrophoresis for analysis, which has high requirements on the quality of the genomic DNA template, is time-consuming and labor-intensive, and inefficient. In addition, the EB or polyacrylamide used in electrophoresis can easily cause harm to the human body and pollute the environment. Alternatively, the KASP technology is used to analyze through fluorescence changes, which requires the addition of probes to the analysis system. The system establishment is complex and costly. Summary of the invention

[0010] In view of this, the object of the present invention is to provide a primer combination and its application. The primer combination can assist in screening resistance genes: based on the primer combination, PCR amplification is performed on the rice genomic DNA sample to be tested, and HRM analysis scanning is performed on the PCR product, and typing of the rice to be tested can be achieved according to the HRM analysis result, which can realize rapid and high-throughput screening of the STV11 gene for resistance to rice stripe disease and identification of resistance to rice stripe disease for the rice varieties to be tested, accelerate the breeding of new rice varieties resistant to rice stripe disease, and solve the problems of low accuracy, cumbersome process, low efficiency, and unsafe operation in the existing detection technology.

[0011] In order to achieve the above object, the present invention adopts the following technical solutions:

[0012] In a first aspect of the present invention, the present invention provides a primer composition comprising:

[0013] Upstream primer STV11-F1: CATGTGGCTGTTCACCATGAG (SEQ ID No. 1); and

[0014] Downstream primer STV11-R1: GTCGCAGAACAGGTCGAACAC (SEQ ID No. 2).

[0015] In a second aspect of the present invention, the present invention provides a kit for identifying resistance to rice stripe disease based on a high-resolution melting curve method, including a PCR kit for HRM analysis, wherein the PCR kit for HRM analysis comprises the primer combination.

[0016] In some specific examples of the present invention, the kit further includes: a PCR kit for sequencing, and the PCR kit for sequencing contains the primer composition.

[0017] In a third aspect of the present invention, the present invention provides a method for identifying resistance to rice stripe disease based on a high-resolution melting curve method, comprising the following steps:

[0018] (1) extracting genomic DNA from each rice sample to be tested to obtain a genomic DNA sample of the rice sample to be tested;

[0019] (2) selecting at least one genomic DNA sample of rice that may be resistant to rice stripe disease and at least one genomic DNA sample of rice that may be susceptible to rice stripe disease from the genomic DNA samples of all the rice samples to be tested as control samples, performing a first PCR amplification on the control samples using a first PCR reaction system and a first PCR reaction program, and sequencing the first PCR amplification products; the first PCR reaction system comprises the primer combination;

[0020] (3) according to the sequencing results, identifying and distinguishing a control sample resistant to leaf stripe disease and a control sample susceptible to leaf stripe disease among the control samples; selecting one control sample resistant to leaf stripe disease and one control sample susceptible to leaf stripe disease and mixing them of equal mass to form a heterozygous control sample;

[0021] (4) taking genomic DNA samples of other rice samples to be tested, a control sample resistant to rice stripe disease, a control sample susceptible to rice stripe disease, and a heterozygous control sample as test samples, and performing a second PCR amplification on the test samples using a second PCR reaction system and a second PCR reaction procedure; the second PCR reaction system comprises the primer combination;

[0022] (5) performing HRM analysis on the second PCR amplification product to obtain high-resolution melting curves of each tested rice sample, a high-resolution melting curve of a rice stripe disease resistant control sample, a high-resolution melting curve of a rice stripe disease susceptible control sample, and a high-resolution melting curve of a heterozygous control sample;

[0023] (6) Comparing and typing the high-resolution melting curve corresponding to each rice sample to be tested with the high-resolution melting curves of each control sample, and then determining whether the type of the rice sample to be tested is a rice stripe disease resistant variety, a rice stripe disease non-resistant variety, or a heterozygous type.

[0024] When selecting control samples in step (2), it is necessary to ensure that the selected samples include at least one rice sample resistant to rice stripe disease and at least one rice sample susceptible to rice stripe disease. This can be achieved by selecting several samples, or by selecting rice samples with known resistance and susceptibility. Considering the variation, the samples still need to be sequenced and identified.

[0025] In some specific examples of the present invention, the method for identifying rice varieties' resistance to stripe disease based on the high-resolution melting curve method comprises the following steps:

[0026] (1) extracting genomic DNA from each rice sample to be tested to obtain a corresponding genomic DNA sample; the rice samples to be tested include: a plurality of rice samples to be identified, at least one rice stripe disease resistant control sample, and at least one rice stripe disease susceptible control sample;

[0027] A genomic DNA sample of a control sample resistant to leaf stripe disease and a genomic DNA sample of a control sample susceptible to leaf stripe disease were selected and mixed in equal mass to form a genomic DNA sample of a heterozygous control sample;

[0028] (2) performing a second PCR amplification on the genomic DNA sample of the rice sample to be tested and the genomic DNA sample of the heterozygous control sample using a second PCR reaction system and a second PCR reaction procedure, respectively; the second PCR reaction system comprises the primer combination;

[0029] (3) performing HRM analysis on the second PCR amplification product to obtain a high-resolution melting curve of the rice sample to be identified, a high-resolution melting curve of a control sample resistant to rice stripe disease, a high-resolution melting curve of a control sample susceptible to rice stripe disease, and a high-resolution melting curve of a heterozygous control sample;

[0030] (4) comparing and typing the high-resolution melting curve of each rice sample to be identified with the high-resolution melting curve of each control sample, thereby determining whether the type of the rice sample to be identified is a rice stripe disease-resistant variety, a rice stripe disease-non-resistant variety, or a heterozygous type.

[0031] In some specific examples of the present invention, in the second PCR reaction system, the concentration of STV11-F1 is 10 μM, the concentration of STV11-R1 is 10 μM, and the concentration of the DNA template is 50-350 ng / μL.

[0032] In some specific examples of the present invention, the second PCR reaction procedure is: ① 95°C, 1 min; ② 95°C, 15 s; ③ 55°C, 15 s; ④ 72°C, 45 s; ② to ④ repeated for 40 cycles; ⑤ 72°C, 5 min.

[0033] In some specific examples of the present invention, in the first PCR reaction system, the concentration of STV11-F1 is 10 μM, the concentration of STV11-R1 is 10 μM, and the concentration of the DNA template is 50-350 ng / μL.

[0034] In some specific examples of the present invention, the first PCR reaction procedure is: ① 95°C, 3 min; ② 95°C, 15 s; ③ 55°C, 15 s; ④ 72°C, 5 s; ② to ④ repeated for 30-35 cycles; ⑤ 72°C, 5 min.

[0035] In some specific examples of the present invention, in step (2), the first PCR amplification product is sequenced in the forward and reverse directions.

[0036] In some specific examples of the present invention, in step (1), the genomic DNA of the rice leaves to be tested is extracted using the CTAB method.

[0037] In the present invention, among multiple stripe resistance genes, the inventors selected STV11 gene as the target gene. The stripe resistance allele STV11-R encodes a rice sulfotransferase OsSOT1, which can catalyze the sulfonation of salicylic acid (SA) to generate sulfosalicylic acid (SSA), inhibiting the replication of rice stripe virus (RSV); while the gene product encoded by the stripe resistance allele STV 11-S loses this activity.

[0038] By analyzing the gene coding sequence, it was found that the main reasons for the difference in resistance and susceptibility were: the 640th nucleotide A at the beginning of the transcription start site of STV11-R in the disease-resistant variety mutated to T. This mutation caused the encoded amino acid to change from serine to threonine; and at the 670th position starting from the transcription start site, the disease-resistant variety lacked 6 consecutive bases GCGGCG compared to the susceptible variety, resulting in the loss of two alanines.

[0039] Based on the genetic differences between resistant and susceptible varieties, the inventors designed corresponding primer sequences and selected specific primer combinations from a large number of primer sequences, and used the primer pairs for PCR amplification. Closed-tube HRM detection and analysis of PCR amplification products can directly type rice materials and identify whether rice varieties have resistance to stripe disease.

[0040] Compared with the prior art, the present invention has the following beneficial technical effects:

[0041] The primer combination and kit of the present invention can be used for identification of rice varieties with resistance to stripe disease, and the operation is simple and fast, and only includes PCR reaction and subsequent HRM analysis process, which shortens the detection procedure; closed-tube operation, high-throughput screening, and no pollution throughout the process; low cost and high sensitivity and good specificity, significantly improve the selection efficiency of rice varieties resistant to stripe disease, and are very suitable for screening high-quality germplasm resources in plant breeding. The method of the present invention no longer requires steps such as electrophoresis and restriction endonuclease digestion, and overcomes the problems of long detection time, cumbersome process and low efficiency in the prior art. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is the HRM standard curve diagram of the 8 rice samples and 1 heterozygous control sample that have been sequenced and identified in Example 1.

[0043] Figure 2 This is the HRM difference curve diagram of the 8 rice samples sequenced and identified in Example 1 and 1 heterozygous control sample.

[0044] Figure 3 This is the HRM standard curve diagram of 73 rice materials and 1 heterozygous control sample in Example 1.

[0045] Figure 4This is the HRM difference curve diagram of 73 rice materials and 1 heterozygous control sample in Example 1.

[0046] Figure 5 The agarose gel electrophoresis diagram of the PCR amplification product in Comparative Example 1.

[0047] Figure 6 This is the polyacrylamide gel electrophoresis diagram of the PCR amplification product in Comparative Example 3.

[0048] Figure 7 This is a schematic diagram of the typing of 24 rice samples in HRM analysis in Comparative Example 3.

[0049] Figure 8 This is the HRM difference curve diagram of 24 rice samples in Comparative Example 3.

[0050] Fig. 9 This is the polyacrylamide gel electrophoresis diagram of the PCR amplification product in Comparative Example 4.

[0051] Fig.10 This is the HRM standard curve diagram of 24 rice samples in Comparative Example 4.

[0052] Fig.11 This is the HRM difference curve diagram of 24 rice samples in Comparative Example 4. DETAILED DESCRIPTION

[0053] The present invention will be further described below in conjunction with specific embodiments and drawings. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0054] If no specific technology or conditions are specified in the examples, the technology or conditions described in the literature in the field or the product instructions are used. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased on the market. For example, Rapid Tap Master Mix was purchased from Nanjing Novezan Biotechnology Co., Ltd. HRM qPCR Master Mix was purchased from Tiansie (Shanghai) Technology Co., Ltd.

[0055] In the following examples, mM refers to mmol / L.

[0056] Example 1

[0057] 1. Design primers based on target sequence

[0058] The cloned sequence of STV11 gene was obtained from the National Rice Data Center (accession number: LOC_Os11g30910).

[0059] Primers were designed based on the difference sequences of nucleotides 640 and 670-675 of the cloned sequence of the STV11 gene in resistant and susceptible varieties.

[0060] The nucleotide sequence of primer pair 1 is as follows:

[0061] Upstream primer STV11-F1: CATGTGGCTGTTCACCATGAG (SEQ ID No. 1);

[0062] Downstream primer STV11-R1: GTCGCAGAACAGGTCGAACAC (SEQ ID No. 2);

[0063] The size of the PCR amplification product was 115 bp for the resistant material and 121 bp for the susceptible material.

[0064] Primer pair 1 was synthesized by Zhejiang Shangya Biotechnology Co., Ltd.

[0065] 2. Extraction of genomic DNA from rice leaves using the CTAB method

[0066] A small amount of rice leaves were placed in a 2.0 mL Eppendorf tube, two small steel balls were placed in the tube, and liquid nitrogen was added to grind the tube into powder using a tissue grinder. 900 μL of preheated (65°C) CTAB buffer (100 mM Tris-HCl, 20 mM EDTA, 500 mM NaCl, 2 wt% hexadecyltrimethylammonium bromide CTAB, 1 wt% β-mercaptoethanol, pH 8.0) was quickly added, mixed and placed in a 65°C hot water bath for 1 h, with shaking three times during the period. In a fume hood, 900 μL of a chloroform-isoamyl alcohol mixture (the volume ratio of chloroform to isoamyl alcohol was 24:1) was added, the tube was shaken vigorously for 1 min, and centrifuged at 12000 g for 10 min. 700 μL of the supernatant was transferred to a new 1.5 mL Eppendorf tube, 700 μL of precooled (-20°C) isopropanol was added thereto, mixed, and allowed to stand at -20°C for more than 1 h. Centrifuge at 12,000g for 10min to obtain a white precipitate (DNA precipitate), discard the supernatant; add 1mL 75% alcohol to wash once, flick off the precipitate; centrifuge at 12,000g for 7min, discard the supernatant, add 1mL 90% alcohol or pure alcohol, wash once, pour out the alcohol and put the centrifuge tube in a 37℃ oven for 10min to dry it thoroughly. The dried DNA was dissolved in 100μL deionized water, and the concentration and quality of the DNA were measured and recorded using Nano-Drop2000 ultra-micro spectrophotometer, and stored at -20℃ for future use.

[0067] The above operation was performed for each rice leaf sample to be tested, thereby obtaining genomic DNA samples of all rice leaves to be tested, and the concentration range of the genomic DNA samples of the rice leaves to be tested was measured to be 50-350 ng / μL.

[0068] 3. Determination of the typing control of the rice stripe disease resistance gene STV11 by sequencing

[0069] From all the genomic DNA samples of rice leaves to be tested obtained in step 2, 8 genomic DNA samples of rice leaves to be tested (including at least one sample of a variety that may be resistant to stripe disease and at least one sample of a variety that may be susceptible to stripe disease) were selected and PCR amplified using the above primer pair 1 according to the following settings. The PCR amplification reaction system (25 μL) is shown in Table 1 below:

[0070] Table 1 PCR reaction system for sequencing

[0071]

[0072] In Table 1, the DNA template is the genomic DNA sample of the rice leaf to be tested.

[0073] The PCR amplification reaction program is shown in Table 2 below:

[0074] Table 2 PCR reaction program for sequencing

[0075]

[0076] The eight products obtained by PCR amplification were sent to Zhejiang Shangya Biotechnology Co., Ltd. for bidirectional Sanger sequencing using STV11-F1 and STV11-R1 primers to obtain the genome sequences of the eight rice leaves to be tested; the obtained sequences were compared using SnapGene software.

[0077] According to the sequence differences between rice stripe leaf blight resistant and susceptible varieties, it was determined that the eight tested rice leaves included three disease-resistant control samples (denoted as STV11-R) and five disease-susceptible control samples (denoted as STV11-S), as shown in Table 3 below.

[0078] Table 3 Sequencing typing comparison results

[0079]

[0080]

[0081] Take a genomic DNA sample of one disease-resistant control sample (material name: Hubble 903) and a genomic DNA sample of a susceptible control sample (material name: Hubble 109), mix them in equal mass (prepared to equal mass concentrations and then mixed in a volume ratio of 1:1) to form a genomic DNA sample of a heterozygous control sample (denoted as STV11-H).

[0082] IV. PCR Amplification for HRM Analysis

[0083] On a 96-well PCR plate with a white background and a black frame, the above primer pair 1 was used to perform PCR amplification on the genomic DNA sample to be tested according to the following settings to obtain an amplified product.

[0084] The PCR amplification reaction system (20 μL) is shown in Table 4 below:

[0085] Table 4 PCR reaction system for HRM analysis

[0086]

[0087] In Table 4, the DNA template is the genomic DNA sample of the rice leaf to be tested.

[0088] The PCR amplification reaction program is shown in Table 5 below:

[0089] Table 5 PCR reaction program for HRM analysis

[0090]

[0091]

[0092] The genomic DNA samples to be tested include: 73 genomic DNA samples of rice leaves to be tested (including genomic DNA samples of 8 control samples) and 1 genomic DNA sample of STV11-H heterozygous control sample. The genomic DNA samples of the 8 control samples include genomic DNA samples of 3 STV11-R disease-resistant control samples (Habo 903, Jinjing 698 and Nanjing 5713) and genomic DNA samples of 5 STV11-S disease-susceptible control samples (Habo 109, C010, LA7, Jiazhongxiang and Habo 1699).

[0093] 5. High Resolution Melting (HRM) Analysis

[0094] Each PCR amplification product obtained in step (iv) is subjected to high resolution melting curve (HRM) analysis to identify the resistance of each rice sample to be tested, as follows:

[0095] After the PCR was completed, 20 μL of mineral oil was added to each well of the 96-well PCR plate to cover it. Then, the HRM detection system was operated. After the temperature of the machine rose to 55°C, the sample PCR plate was placed in the HRM detector (Light Scanner96, Idaho Technology Inc, USA) and the sample was detected at 0.1°C·s -1 The PCR products were scanned by heating from 55°C to 95°C at a speed of 100 °C to obtain the melting curve formed by the change of fluorescence signal intensity with the increase of temperature. The scanning results were analyzed using Light Scanner data analysis software (Call ITTM2.0, Idaho Technology Inc, USA). Each sample (PCR amplification product) corresponds to an HRM melting curve.

[0096] The 9 HRM melting curves corresponding to the 9 control samples are as follows: Figure 1 and Figure 2 shown. Figure 1 is the HRM standard curve of 9 control samples (Sensitivity Level = -0.8), Figure 2 It is the HRM difference curve of 9 control samples (Sensitivity Level = -0.8). Figure 2 Yes Figure 1 The standard curve was obtained by normalization.

[0097] from Figure 2 It can be clearly seen that the HRM difference curves of the 9 control samples correspond to three different types:

[0098] The red curve (located below the baseline, which corresponds to the horizontal line with a vertical coordinate of 0) corresponds to the three control samples, Hubble 903, Jinjing 698, and Nanjing 5713. The sequencing results showed that these three samples were identified as varieties resistant to stripe disease, and this group of curves was determined to be the melting curve of the disease-resistant control "STV11-R";

[0099] The gray curve (near the baseline) corresponds to the five control samples, Hubble 109, C010, LA7, Jiazhongxiang, and Hubble 1699. The sequencing results showed that these five samples were identified as non-resistant to stripe disease, and this group of curves was determined to be the melting curve of the susceptible control "STV11-S";

[0100] The blue curve (above the baseline) corresponds to the heterozygous control sample, which is identified as the heterozygous control "STV11-H" melting curve.

[0101] The HRM melting curves of all rice samples tested are as follows Figure 3 and Figure 4 shown. Figure 3 is the HRM standard curve of all rice samples to be tested (Sensitivity Level = -0.8), Figure 4 The HRM difference curves of all tested rice samples (Sensitivity Level = -0.8) are Figure 3 The standard curve was obtained by normalization.

[0102] It can be found that the HRM melting curves of all samples are divided into three groups of curves, which are clearly distinguished:

[0103] One group is a red curve, which means that the high-resolution melting curve of the tested rice samples belonging to this group is consistent with the melting curve of the disease-resistant control "STV11-R", and the tested rice samples belonging to this group are labeled as STV11-R and identified as stripe disease-resistant varieties;

[0104] One group is a gray curve, which means that the high-resolution melting curve of the tested rice samples belonging to this group is consistent with the melting curve of the susceptible control "STV11-S", and the tested rice samples belonging to this group are labeled as STV11-S and identified as non-resistant to stripe disease.

[0105] One is a blue curve, which is the melting curve of the heterozygous control "STV11-H" corresponding to the heterozygous control sample.

[0106] The specific results of marker typing of 73 tested rice samples are shown in Table 6.

[0107] Table 6 Marker typing results of 72 rice samples

[0108]

[0109]

[0110] The 73 rice samples to be tested were all parental materials for rice breeding. According to statistics, there were 26 rice materials resistant to rice stripe disease, 47 rice materials not resistant to rice stripe disease, and no heterozygous types.

[0111] It can be seen that the above method can quickly identify the resistance of rice plants to rice stripe disease, greatly improving the selection efficiency of rice materials resistant to rice stripe disease. After sequencing and confirming the resistance of the control sample, all samples can be subjected to a one-time high-throughput HRM analysis after PCR amplification to identify the typing. Alternatively, after the resistance of the control sample has been identified, the control sample and all rice samples to be tested can be subjected to a one-time high-throughput HRM analysis after PCR amplification, and then the genotype of each sample can be clearly identified with the help of software, which can be applied to the identification of resistance to rice stripe disease efficiently and at low cost, and is of great significance.

[0112] Comparative Example 1

[0113] The cloned sequence of the STV11 gene (accession number: LOC_Os11g30910) can be obtained from the National Rice Data Center. Primers were designed based on the difference in the 640th and 670-675th nucleotides of the cloned sequence of the STV11 gene between resistant and susceptible varieties. The nucleotide sequence of primer pair 2 is shown below:

[0114] Upstream primer STV11-F2: GTTCACCATGAGCAACATGGTGA (SEQ ID No. 3);

[0115] Downstream primer STV11-R2: TACCGGAGGAAGAGGACCTTCT (SEQ ID No. 4);

[0116] The size of the PCR amplification product was 200 bp for the resistant material and 206 bp for the susceptible material.

[0117] Primer pair 2 was synthesized by Zhejiang Shangya Biotechnology Co., Ltd.

[0118] The genomic DNA of 8 rice leaves to be tested that are exactly the same as those in Example 1 were selected, and PCR amplification was performed using the above primer pair 2 according to the following settings.

[0119] The PCR amplification reaction system (25 μL) is basically the same as that in Example 1, except that the primers are different, as shown in Table 7 below:

[0120] Table 7 PCR reaction system

[0121]

[0122] In Table 7, the DNA template is the genomic DNA sample of the rice leaf to be tested.

[0123] The PCR amplification reaction procedure is exactly the same as the PCR reaction procedure for sequencing shown in Table 2 in Example 1.

[0124] The products obtained by PCR amplification were separated by agarose gel electrophoresis, stained with ethidium bromide, and imaged under a gel imaging system. Figure 5 As shown. It can be found that Figure 5 No target band was amplified, and a very obvious primer dimer smaller than 100 bp was formed, which was non-specific.

[0125] Comparative Example 2

[0126] The cloned sequence of the STV11 gene (accession number: LOC_Os11g30910) can be obtained from the National Rice Data Center. Primers were designed based on the difference in the 640th and 670-675th nucleotides of the cloned sequence of the STV11 gene between resistant and susceptible varieties. The nucleotide sequence of primer pair 3 is shown below:

[0127] Upstream primer STV11-F3: CAACGACCACGGACGAAC (SEQ ID No. 5);

[0128] Downstream primer STV11-R3: CGTACCGGAGGAAGAGGA (SEQ ID No. 6);

[0129] The size of the PCR amplification product was 168 bp for the resistant material and 174 bp for the susceptible material.

[0130] Primer pair 3 was synthesized by Zhejiang Shangya Biotechnology Co., Ltd.

[0131] The following 24 rice samples were selected as samples to be tested (see Table 8).

[0132] Table 8: Information of the samples to be tested

[0133] serial number Material Name serial number Material Name E1 WANG0505 F1 Wankenjing WS36 E2 Yangjing 3012 F2 Longjing 71 E3 Lianjing 1U2329 F3 Jingjing No.1 E4 Golden Spike 14-151 F4 Wujing068 E5 Huafeng 2728 F5 Town Rice 243 E6 Golden Terrier 104 F6 SH1557 E7 SD01 F7 Salt Rice 1333 E8 SD02 F8 Lindao 16 E9 SD03 F9 Holy Rice 19 E10 Xinfeng 2018 F10 Jinjing 698 E11 Long grain fragrant F11 Longjing968 E12 Wujin Fragrant Blood Glutinous Rice F12 W1606

[0134] The genomic DNA of 24 rice leaves to be tested was extracted using the method of Example 1 to obtain the corresponding genomic DNA samples. The primer pair 3 was used to perform PCR amplification according to the following settings.

[0135] The PCR amplification reaction system (25 μL) is shown in Table 9 below:

[0136] Table 9 PCR reaction system

[0137]

[0138] In Table 9, the DNA template is the genomic DNA sample of the rice leaf to be tested.

[0139] The PCR amplification reaction procedure is exactly the same as the PCR reaction procedure shown in Table 2 in Example 1.

[0140] The products obtained by PCR amplification were separated by polyacrylamide gel electrophoresis, stained with ethidium bromide, and imaged under a gel imaging system. It was found that no target band was amplified, indicating that the specificity of primer pair 3 was not good.

[0141] Comparative Example 3

[0142] The cloned sequence of the STV11 gene (accession number: LOC_Os11g30910) can be obtained from the National Rice Data Center. Primers were designed based on the difference in the 640th and 670-675th nucleotides of the cloned sequence of the STV11 gene between resistant and susceptible varieties.

[0143] The nucleotide sequence of primer pair 4 is as follows:

[0144] Upstream primer STV11-F4: GACCACGGACGAACACCA (SEQ ID No. 7);

[0145] Downstream primer STV11-R4: CAGAACAGGTCGAACACC (SEQ ID No. 8);

[0146] The size of the PCR amplification product was 66 bp for the resistant material and 72 bp for the susceptible material.

[0147] The above primer pair 4 was synthesized by Zhejiang Shangya Biotechnology Co., Ltd.

[0148] 24 genomic DNA samples of rice leaves to be tested that are exactly the same as those in Comparative Example 2 were selected, and PCR amplification was performed using the above primer pair 4 according to the following settings. The PCR amplification reaction system (25 μL) is shown in Table 10 below:

[0149] Table 10 PCR reaction system

[0150]

[0151] In Table 10, the DNA template is the genomic DNA sample of the rice leaf to be tested.

[0152] The PCR amplification reaction procedure is exactly the same as the PCR reaction procedure shown in Table 2 in Example 1.

[0153] The products obtained by PCR amplification were separated by polyacrylamide electrophoresis, stained with ethidium bromide, and imaged under a gel imaging system. Figure 6 As shown, the results showed that primer pair 4 amplified the target band and the primer specificity was good. Then, the subsequent PCR amplification for HRM analysis was carried out.

[0154] The PCR amplification reaction system (20 μL) is shown in Table 11 below:

[0155] Table 11 PCR reaction system for HRM analysis

[0156]

[0157] The PCR amplification reaction procedure is exactly the same as the PCR reaction procedure shown in Table 5 in Example 1.

[0158] Each PCR amplification product obtained above was subjected to high-resolution melting curve HRM analysis one by one to identify the resistance of each rice sample to be tested. Figure 7 and Figure 8 shown. Figure 7 This is a schematic diagram of the typing of 24 rice samples in HRM analysis in Comparative Example 3. Figure 8 is the HRM difference curve of 24 rice samples in Comparative Example 3. Figure 6 Polyacrylamide gel electrophoresis and Figures 7-8 The results of HRM typing were compared and it was found that the melting curve typing results of HRM analysis did not correspond to the polyacrylamide results. This shows that primer pair 4 has good specificity in PCR amplification, but cannot achieve HRM typing.

[0159] Comparative Example 4

[0160] The cloned sequence of the STV11 gene (accession number: LOC_Os11g30910) can be obtained from the National Rice Data Center. Primers were designed based on the difference in the 640th and 670-675th nucleotides of the cloned sequence of the STV11 gene between resistant and susceptible varieties.

[0161] The nucleotide sequence of primer pair 5 is as follows:

[0162] Upstream primer STV11-F5: CACAACGACCACGGACGAA (SEQ ID No. 9);

[0163] Downstream primer STV11-R5: GTGAAGGGTGTCACAACGA (SEQ ID No. 10);

[0164] The size of the PCR amplification product was 171 bp for the resistant material and 177 bp for the susceptible material.

[0165] The above primer pair 5 was synthesized by Zhejiang Shangya Biotechnology Co., Ltd.

[0166] 24 genomic DNA samples of rice leaves to be tested that are exactly the same as those in Comparative Example 2 were selected, and PCR amplification was performed using the above primer pairs according to the following settings. The PCR amplification reaction system (25 μL) is shown in Table 12:

[0167] Table 12 PCR reaction system

[0168]

[0169]

[0170] In Table 12, the DNA template is the genomic DNA sample of the rice leaf to be tested.

[0171] The PCR amplification reaction procedure is exactly the same as the PCR reaction procedure shown in Table 2 in Example 1.

[0172] The products obtained by PCR amplification were separated by polyacrylamide electrophoresis, stained with ethidium bromide, and imaged under a gel imaging system, such as Fig. 9 shown. Fig. 9 In the electrophoresis results, primer pair 5 failed to type the resistance-susceptible rice. However, high-resolution melting curve HRM analysis was performed on each PCR amplification product obtained above. The results are as follows Fig.10 and Fig.11 shown. Figures 10-11 Primer pair 5 can barely type the resistance-susceptible rice: E2 (Yangjing 3012), E4 (Jinsui 14-151), E9 (SD03), E10 (Xinfeng 2018), F1 (Wankenjing WS36), F3 (Jingjing 1), and F7 (Yandao 1333) have different melting curve peak heights, but the shapes are the same, and they are still classified as STV11-S materials. Other samples belong to STV11-R materials, but E12 (Wujin Xiangxuenuo) and F9 (Shengdao 19) have different melting curve shapes from most of these samples and need to be confirmed by sequencing.

[0173] It can be seen that although the primer pairs are designed for the difference sequences of the 640th and 670-675th nucleotides of the cloned sequence of the STV11 gene in the resistant and susceptible varieties, the primer pair 2 of comparative example 1 and the primer pair 3 of comparative example 2 can meet the amplification length requirements of the HRM technology, but the specificity is not good. The PCR amplification based on these two primer pairs did not obtain the target band. Primer pair 4 of comparative example 3 can meet the requirements of the HRM technology for the length of the amplified product, and the specificity is also good, but the resistant rice cannot be typed during the HRM analysis. Primer pair 5 of comparative example 4 is not ideal during PCR amplification and cannot be typed for resistant and susceptible rice; however, during the HRM analysis, the resistant and susceptible rice can be barely typed. It can be seen that the influence of the selected primer combination on PCR amplification and HRM analysis is relatively complex. Compared with the situations in comparative examples 1 to 4, the primer pair 1 selected in the embodiment of the present invention has achieved unexpected technical effects: not only has good specificity in PCR reaction amplification, but also has good effect when used for HRM typing. Only one PCR reaction is required for the genomic DNA sample of the treated rice sample to obtain the typing results of stripe leaf blight after HRM analysis, which is simple and efficient.

[0174] It can be seen that the purpose of the present invention has been completely and effectively achieved. The method and principle of the present invention have been demonstrated and explained in the embodiments. Without departing from the principles, the implementation methods can be modified arbitrarily. Therefore, the present invention includes all modified implementation methods based on the spirit and scope of the claims.

Claims

1. A method for identifying resistance to rice stripe disease based on a high-resolution melting curve method, comprising the following steps: (1) extracting genomic DNA from each rice sample to be tested to obtain a genomic DNA sample of the rice sample to be tested; (2) From the genomic DNA samples of all the rice samples to be tested, at least one genomic DNA sample of rice resistant to rice stripe disease and at least one genomic DNA sample of rice susceptible to rice stripe disease are selected as control samples, and the control samples are subjected to a first PCR amplification using a first PCR reaction system and a first PCR reaction program, and the first PCR amplification product is sequenced; the first PCR reaction system comprises a primer combination, and the primer combination is: an upstream primer STV11-F1: CATGTGGCTGTTCACCATGAG (SEQ ID No. 1); and a downstream primer STV11-R1: GTCGCAGAACAGGTCGAACAC (SEQ ID No. 2); (3) according to the sequencing results, identifying and distinguishing a control sample resistant to leaf stripe disease and a control sample susceptible to leaf stripe disease among the control samples; selecting one control sample resistant to leaf stripe disease and one control sample susceptible to leaf stripe disease and mixing them of equal mass to form a heterozygous control sample; (4) Taking genomic DNA samples of other rice samples to be tested, control samples resistant to rice stripe disease, control samples susceptible to rice stripe disease and heterozygous control samples as test samples, and performing a second PCR amplification on the test samples using a second PCR reaction system and a second PCR reaction program; the second PCR reaction system comprises a primer combination, wherein the primer combination is: an upstream primer STV11-F1: CATGTGGCTGTTCACCATGAG (SEQ ID No. 1); and a downstream primer STV11-R1: GTCGCAGAACAGGTCGAACAC (SEQ ID No. 2); (5) performing HRM analysis on the second PCR amplification product to obtain high-resolution melting curves of each tested rice sample, a high-resolution melting curve of a rice stripe disease resistant control sample, a high-resolution melting curve of a rice stripe disease susceptible control sample, and a high-resolution melting curve of a heterozygous control sample; (6) Compare and type the high-resolution melting curve corresponding to each rice sample to be tested with the high-resolution melting curves of each control sample, and then determine whether the type of the rice sample to be tested is a rice stripe disease resistant variety, a rice stripe disease non-resistant variety, or a hybrid type.

2. A method for identifying resistance to rice stripe disease based on a high-resolution melting curve method, comprising the following steps: (1) Extracting genomic DNA from each rice sample to be tested to obtain corresponding genomic DNA samples; The rice samples to be tested include: a plurality of rice samples to be identified, at least one control sample resistant to rice stripe disease and at least one control sample susceptible to rice stripe disease; A genomic DNA sample of a control sample resistant to leaf stripe disease and a genomic DNA sample of a control sample susceptible to leaf stripe disease were selected and mixed in equal mass to form a genomic DNA sample of a heterozygous control sample; (2) using a second PCR reaction system and a second PCR reaction program to perform a second PCR amplification on the genomic DNA sample of the rice sample to be tested and the genomic DNA sample of the heterozygous control sample; the second PCR reaction system comprises a primer combination, wherein the primer combination is: an upstream primer STV11-F1: CATGTGGCTGTTCACCATGAG (SEQ ID No. 1); and a downstream primer STV11-R1: GTCGCAGAACAGGTCGAACAC (SEQ ID No. 2); (3) performing HRM analysis on the second PCR amplification product to obtain a high-resolution melting curve of the rice sample to be identified, a high-resolution melting curve of a control sample resistant to rice stripe disease, a high-resolution melting curve of a control sample susceptible to rice stripe disease, and a high-resolution melting curve of a heterozygous control sample; (4) The high-resolution melting curve of each rice sample to be identified is compared with the high-resolution melting curve of each control sample, and the type of the rice sample to be identified is determined as a rice stripe disease-resistant variety, a rice stripe disease-non-resistant variety, or a hybrid type.

3. The method for identifying resistance of rice varieties to stripe disease according to claim 1 or 2, characterized in that: In the second PCR reaction system, the concentration of STV11-F1 is 10 μM, the concentration of STV11-R1 is 10 μM, and the concentration of the DNA template is 50-350 ng / μL.

4. The method for identifying resistance of rice varieties to stripe disease according to claim 1 or 2, characterized in that: The second PCR reaction procedure is: ①95°C, 1 min; ②95°C, 15 s; ③55°C, 15 s; ④72°C, 45 s; ②~④ repeated 40 cycles; ⑤72°C, 5 min.

5. The method for identifying resistance of rice varieties to stripe disease as claimed in claim 1, characterized in that: In the first PCR reaction system, the concentration of STV11-F1 is 10 μM, the concentration of STV11-R1 is 10 μM, and the concentration of the DNA template is 50-350 ng / μL.

6. The method for identifying resistance of rice varieties to stripe disease as claimed in claim 1, characterized in that: The first PCR reaction procedure is: ① 95°C, 3 min; ② 95°C, 15 s; ③ 55°C, 15 s; ④ 72°C, 5 s; ②~④ are repeated for 30-35 cycles; ⑤ 72°C, 5 min.

7. The method for identifying resistance of rice varieties to stripe disease according to claim 1 or 2, characterized in that: In step (1), the genomic DNA of the rice leaves to be tested is extracted using the CTAB method.

Images