P450 enzyme at the C11α position of hydroxylated progesterone, its gene, expression vector, cell and application

Abstract

The present invention relates to a P450 enzyme capable of hydroxylating the C11α position of progesterone, its gene, expression vector, cell and application, belonging to the technical fields of enzyme engineering and genetic engineering. The progesterone P450 hydroxylase CYP BMH3 and its gene sequence cyp bmh3 derived from the prokaryotic microorganism Bacillus megaterium H-1. The full length of this gene is 1233 bp, encoding 410 amino acids, and its amino acid sequence is shown in SEQ ID NO.1, and the gene sequence is shown in SEQ ID NO.2; and based on the heterologous expression of this enzyme, the efficient conversion of progesterone is achieved, with high specificity, reduced reaction by-products, and reduced production costs, laying a foundation for its further industrial application.

Description

Technical Field

[0001] The present invention relates to the technical fields of enzyme genetic engineering and enzyme engineering, and particularly relates to a P450 enzyme capable of hydroxylating the C11α position of progesterone, and its gene, expression vector, cell and application. Background Art

[0002] Progesterone, also known as luteosterone, pregnenolone, corpus luteum steroidone, progestogen, progestin, corpus luteum hormone or progestin, abbreviated as P4, with the full name pregnane-4-ene-3,20-dione, is an endogenous steroid and progestational sex hormone, and also the main progestogen in the body, secreted by the ovaries of women. Progesterone is a steroid hormone containing 21 carbon atoms secreted by ovarian luteal cells, and is also an intermediate product for synthesizing all steroid hormones, belonging to one of the progestogens. It has two crystal forms, namely α-form and β-form, and the two crystal forms have similar physiological activities. The α-form is precipitated from dilute ethanol and is an orthorhombic white prismatic crystal, and the β-form is an orthorhombic white needle crystal. Both are insoluble in water and soluble in ethanol, ether, chloroform, acetone, etc. In nature, progesterone widely exists in animals and has physiological functions such as maintaining pregnancy in female animals, promoting the thickening of the uterine mucosa layer, the curvature of glands, and the increase of secretion function. The hydroxylation reaction of sterols refers to the reaction of introducing a hydroxyl group onto an organic molecule. After the hydroxylation modification of steroid compounds, they generally exhibit better pharmacological activities. Common hydroxylated progesterone drug intermediates include 11α-OH-progesterone. As one of the most important hydroxylation intermediates of progesterone, 11α-OH-progesterone is also known as 11α-OH-pregnane, with the molecular formula C 21 H 30 O 3 , with a relative molecular mass of 330.46. It is reported that it can selectively inhibit 11β-hydroxysteroid dehydrogenase II, an enzyme that is very important in regulating renal electrolyte balance. It can metabolize cortisol in the human body into cortisone. Therefore, 11α-OH-progesterone can affect blood pressure regulation. In addition, 11α-OH-progesterone has anti-androgenic activity and has relatively small side effects on estrogen and progesterone, so it has great potential in the field of clinical application research.

[0003] The preparation methods of 11α-OH-progesterone include chemical method and biological method. The synthesis route of chemical synthesis of 11α-OH-progesterone is to use 11α-acetyl progesterone as raw material, and obtain 11α-OH-progesterone through multi-step condensation, ring opening and isomerization reactions. This process has many reaction steps, low conversion rate, and complex separation and purification process. In 1952, Peterson and Murray first discovered that Rhizopus nigricans has the ability to C-11α hydroxylate steroids, thereby shortening the synthesis of progesterone to corticosterone to three steps with a yield of 90%, thus solving the problem of synthesizing corticosteroid compounds such as cortisone, thus creating a precedent for microbial transformation of steroid compounds.

[0004] At present, the research on the microbial hydroxylation of progesterone is very extensive. For example, Huang Zhumei (Study on the Microbial Hydroxylation of Progesterone and Epoxy Progesterone, Sichuan Normal University, 2013. DOI: 10.7666 / d.Y2301348.) used Curvularia lunulata and Absidia cyanobacteria to ferment and transform progesterone, respectively. The transformation liquid was extracted and concentrated to obtain the crude product, which was then separated and purified by silica gel column chromatography. It was found that the transformation product of progesterone contained 11α- OH-progesterone; Patent CN202110142291.8 discloses a method for preparing 11α,17α-hydroxyprogesterone by conversion using immobilized hydroxylase, and 11α,17α-OH-progesterone is prepared using 17α-OH-progesterone as a substrate; Patent CN202010405130.9 discloses a 11α-hydroxylase mutant, and the recombinant Pichia pastoris constructed based on the mutant can convert the substrate progesterone into 11α-OH-progesterone. However, the above methods for the microbial hydroxylation of progesterone mostly use eukaryotic systems such as fungi for biocatalysis. Although fungal catalysis has good conversion efficiency, its genetic characteristics are unclear, the molecular operation system is imperfect, and many by-products are accompanied by the conversion process, which is not conducive to the efficient separation of downstream products. For prokaryotic systems such as bacteria, with the rapid development of biotechnology in recent years, its genetic operation system has been very mature, so it is necessary to find a new method for preparing 11α-OH-progesterone using prokaryotic systems. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides an amino acid sequence of a P450 progesterone hydroxylase from Bacillus megaterium H-1 and a nucleotide sequence encoding the protein, provides a plasmid comprising the gene of the present invention and a host cell comprising the expression plasmid, and after expressing the progesterone hydroxylase in a host cell (Bacillus subtilis), progesterone can be effectively converted into 11α-OH-progesterone.

[0006] The first object of the present invention is to provide a P450 enzyme capable of hydroxylating the C11α position of progesterone. This P450 enzyme capable of hydroxylating the C11α position of progesterone can catalyze the hydroxylation of the C11 position of progesterone and convert it into 11α-OH-progesterone, and its amino acid sequence is shown in SEQ ID NO.1. The specific sequence is as follows:

[0007]

[0008] The second object of the present invention is to provide a gene encoding the above-mentioned P450 enzyme capable of hydroxylating the C11α position of progesterone.

[0009] Furthermore, for the gene encoding the above-mentioned P450 enzyme capable of hydroxylating the C11α position of progesterone, its nucleotide sequence is shown in SEQ ID NO.2. The specific sequence is as follows:

[0010]

[0011]

[0012] The third object of the present invention is to provide a recombinant plasmid, which contains the gene encoding the P450 enzyme capable of hydroxylating the C11α position of progesterone.

[0013] Furthermore, in an embodiment of the present invention, the recombinant plasmid uses pMA5 as the vector backbone.

[0014] The fourth object of the present invention is to provide a cell expressing the above-mentioned P450 enzyme capable of hydroxylating the C11α position of progesterone. This cell contains the gene encoding the P450 enzyme capable of hydroxylating the C11α position of progesterone or a recombinant plasmid containing the gene encoding the P450 enzyme capable of hydroxylating the C11α position of progesterone.

[0015] Furthermore, the cells include but are not limited to bacteria, fungi, plant cells, animal cells, etc.

[0016] Furthermore, when the host cell is a bacterium, Bacillus subtilis is preferred.

[0017] Furthermore, the above-mentioned recombinant Bacillus subtilis uses Bacillus subtilis WB600 as the host and pMA5 as the expression vector.

[0018] The fifth object of the present invention is to provide the application of the above-mentioned P450 enzyme capable of hydroxylating the C11α position of progesterone, the gene encoding the P450 enzyme capable of hydroxylating the C11α position of progesterone, the expression vector or cell containing the gene in the preparation of 11α-OH-progesterone.

[0019] Furthermore, using progesterone as a substrate, its C11α position is hydroxylated by microorganisms to generate 11α-OH-progesterone.

[0020] Furthermore, when using recombinant Bacillus subtilis to synthesize 11α-OH-progesterone, the recombinant Bacillus subtilis is inoculated into an LB liquid medium for cultivation to obtain a seed solution; the seed solution is inoculated into an LB medium for fermentation to prepare 11α-OH-progesterone; wherein, the components of the LB liquid medium include 1-10 g / L yeast extract, 5-15 g / L peptone, and 5-15 g / L NaCl; the components of the LB medium include 5-15 g / L peptone, 5-15 g / L sodium chloride, and 1-10 g / L yeast extract.

[0021] Furthermore, the concentration of the substrate progesterone is preferably 0.5 g / L.

[0022] Furthermore, one or more of glycerol, Tween 80, and HP-β-CD are added to the substrate for solubilization assistance.

[0023] Furthermore, when the recombinant Bacillus subtilis expressing the P450 enzyme capable of hydroxylating the C11α position of progesterone ferments to produce 11α-OH-progesterone, the fermentation conditions are 30-40 °C, pH 6.0-8.0, preferably 35-37 °C, pH 7.0-7.5, and most preferably 37 °C, pH 7.0.

[0024] The P450 enzyme CYP BMH3 of the present invention capable of hydroxylating the C11α position of progesterone has great application potential in aspects such as pharmaceuticals and the preparation of feeds (such as as animal feed additives).

[0025] By means of the above solution, the present invention has at least the following advantages:

[0026] The present invention provides a P450 enzyme CYP BMH3 capable of hydroxylating the C11α position of progesterone, inserts the gene CYP BMH3 into the pMA5 plasmid to construct a recombinant expression plasmid pMA5-CYP BMH3, uses Bacillus subtilis WB600 as an expression host to achieve the heterologous expression of the P450 enzyme CYP BMH3 capable of hydroxylating the C11α position of progesterone, and successfully realizes the efficient conversion of progesterone, with high specificity, no reaction by-products, and reduced production costs, laying a foundation for its further industrial application.

[0027] The above description is only an overview of the technical solution of the present invention. In order to be able to understand the technical means of the present invention more clearly and implement it in accordance with the content of the specification, the following takes the preferred embodiments of the present invention and combines with detailed drawings for description as follows. Brief Description of the Drawings

[0028] To make the content of the present invention easier to be clearly understood, the following further details the present invention according to specific embodiments of the present invention and in combination with the accompanying drawings.

[0029] Figure 1 It is the agarose gel electrophoresis diagram for screening WB600-pMA5-BMH3 positive transformants; wherein, M: Marker; 1-6: WB600-pMA5-BMH3 colonies 1-6;

[0030] Figure 2 It is the SDS-PAGE diagram result of the WB600-pMA5-BMH3 recombinant Bacillus subtilis bacterial solution; wherein, M: Marker; 1: WB600-pMA5 bacterial solution; 2: WB600-pMA5-BMH3 bacterial solution;

[0031] Figure 3 It is the HPLC analysis diagram of 11α-OH-progesterone standard, progesterone standard, progesterone transformed by WB600-pMA5 and progesterone transformed by WB600-pMA5-BMH3; wherein, A is the HPLC analysis diagram of 11α-OH-progesterone standard; B is the HPLC analysis diagram of progesterone standard; C is the HPLC analysis diagram of progesterone transformed by WB600-pMA5; D is the HPLC analysis diagram of progesterone transformed by WB600-pMA5-BMH3;

[0032] Figure 4 It is the MS[M+H] spectrum of progesterone standard;

[0033] Figure 5 It is the MS[M+H] spectrum of 11α-OH-progesterone standard;

[0034] Figure 6 It is the LC-MS spectrum of the progesterone product transformed by WB600-pMA5-BMH3;

[0035] Figure 7 It is the yields of wild bacteria and recombinant bacteria WB600-pMA5-BMH3 transforming progesterone into 11α-OH-progesterone at different temperatures;

[0036] Figure 8 It is the yields of wild bacteria and recombinant bacteria WB600-pMA5-BMH3 transforming progesterone into 11α-OH-progesterone at different pH values;

[0037] Figure 9 It is the yields of wild bacteria and recombinant bacteria WB600-pMA5-BMH3 transforming progesterone into 11α-OH-progesterone in the presence of different co-solvents;

[0038] Figure 10It is the agarose gel electrophoresis diagram for screening BL21-pET28a-BMH3 positive transformants; among them, M: Marker; 1-2: Recombinants of BL21-pET28a-bmh3;

[0039] Figure 11 It is the HPLC analysis diagram of 11α-OH-progesterone standard, progesterone standard, progesterone transformed by BL21-pET28a, and progesterone transformed by BL21-pET28a-BMH3; among them, A is the HPLC analysis diagram of 11α-OH-progesterone standard; B is the HPLC analysis diagram of progesterone standard; C is the HPLC analysis diagram of progesterone transformed by BL21-pET28a; D is the HPLC analysis diagram of progesterone transformed by BL21-pET28a-BMH3. Detailed implementation manners

[0040] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments are not used as a limitation to the present invention.

[0041] The materials and methods involved in the following embodiments are as follows:

[0042] The strain of Bacillus megaterium H-1 is preserved in the General Microbiology Center of the China Microbial Culture Collection Center, and the preservation number is CGMCC No. 20362.

[0043] The formula of LB medium is: peptone 10 g / L, sodium chloride 10 g / L, yeast extract 5 g / L, pH 7.0;

[0044] The formula of LB liquid medium is: peptone 10 g / L, sodium chloride 10 g / L, yeast extract 5 g / L, pH 7.0;

[0045] The formula of LB solid medium is: peptone 10 g / L, sodium chloride 10 g / L, yeast extract 5 g / L, agar 20 g / L, pH 7.0

[0046] The HPLC analysis conditions for the catalytic reaction product of P450 enzyme CYP BMH3 that can hydroxylate the C11α position of progesterone are:

[0047] The reaction product was extracted three times with 1 mL of ethyl acetate for 2 minutes each time. The ethyl acetate extracts from the three extractions were combined and dried. Then the residue was dissolved in 1 mL of acetonitrile. Linear elution was performed for 30 min on an Agilent TC-C18 column (250 mm × 4.6 mm, 5 μm) with a mobile phase of 70%:30% acetonitrile-water. Before the second injection, re-equilibration was carried out for 5 minutes. The injection volume was 10 μL, the detection wavelength was 254 nm, the flow rate was 0.5 mL / min, and the column temperature was 30 °C.

[0048] The construction process of the following examples is as follows:

[0049] The cyp bmh3 sequence was obtained by PCR from the genome of Bacillus megaterium H-1. The gene was used to construct the recombinant expression plasmid pMA5-bmh3 with pMA5 as the plasmid, and Bacillus subtilis WB600 was used as the expression host to achieve the high-level expression of P450 progesterone hydroxylase (CYP BMH3) of Bacillus megaterium H-1.

[0050] Example 1 Extraction of the genome of Bacillus megaterium H-1 strain

[0051] The Bacillus megaterium H-1 strain was cultured in LB medium (10 g / L peptone, 10 g / L sodium chloride, 5 g / L yeast extract, pH 7.0) for 12 h at a culture temperature of 30 °C. 1 mL of the bacterial solution was taken, centrifuged at 12000 rpm for 2 min, the supernatant was discarded, and the cells were collected.

[0052] The whole genome of the Bacillus megaterium H-1 strain was extracted according to the instructions of the genome extraction kit, and the obtained genome of the Bacillus megaterium H-1 strain was used for subsequent experiments.

[0053] Example 2 Cloning of the P450 progesterone hydroxylase gene of Bacillus megaterium H-1 strain

[0054] Relevant protein information was obtained through transcriptome sequencing of Bacillus megaterium strain H-1, and part of it is P450 progesterone hydroxylase. According to the comparison of the known P450 progesterone hydroxylase sequence on NCBI, it is known that this P450 belongs to the CYP106A subfamily and has a high homology with CYP106A1. Based on the protein information obtained from the known CYP106A1 sequence, primers were designed to amplify the target gene, and the primer sequences are as follows:

[0055] Primer 1:

[0056] AAAAGGAGCGATTTACATATGATGAACAAAGAAGTCATTCCCGTT

[0057] Primer 2:

[0058] GAGCTCGACTCTAGAGGATCCTTATCTGTACACCGTCATGGGC

[0059] Using the extracted genome of Bacillus megaterium strain H-1 as a template and the above nucleotide sequences as primers, the coding gene of P450 progesterone hydroxylase was amplified by PCR. The PCR reaction was carried out in a 50 μL system, and the reaction conditions were as follows: pre-denaturation at 95 °C for 3 min followed by cycling; denaturation at 95 °C for 30 s, annealing at 62.5 °C for 30 s, extension at 72 °C for 1.5 min, for a total of 34 cycles; final extension at 72 °C for 5 min. After agarose gel electrophoresis of the PCR products, the gel was cut and recovered, ligated with the pMA5 vector, and then transformed into Escherichia coli JM109. Positive transformants were screened on LB plates containing Amp resistance (50 mg / L). Positive transformants were picked and inoculated into LB liquid medium, cultured at 37 °C for 12 h, and the plasmid was extracted. This plasmid was named pMA5-bmh3, and the sequence of this plasmid was determined.

[0060] By comparing the transcriptome sequencing results of Bacillus megaterium H-1 on NCBI, it was found that the nucleic acid sequence cyp bmh3 of the P450 hydroxylase CYP BMH3 has the highest homology with the nucleic acid sequence CYP106A1 of the P450 progesterone hydroxylase of Bacillus megaterium DSM 319, reaching 93.76%. It is speculated that the P450 hydroxylase CYP BMH3 derived from Bacillus megaterium H-1 has a similar function.

[0061] Example 3 Construction of recombinant expression plasmid

[0062] The expression plasmid used in this study is the expression plasmid pMA5 of Bacillus subtilis, which is an integrative expression plasmid. The plasmid pMA5 and the enzyme gene cyp bmh3 were double-digested to obtain linear fragments. After enzyme digestion, agarose gel electrophoresis was performed and the gel was recovered. The fragments were ligated with T4 ligase at 37°C for 3.5 hours. The ligation products were transformed into Escherichia coli JM109 competent cells and cultured overnight on LB plates containing Amp resistance (50 mg / L). Positive transformants were screened and enriched and cultured before the plasmid was extracted and named pMA5-bmh3.

[0063] Example 4 Screening and induction of expression of recombinant bacteria

[0064] The recombinant plasmid pMA5-bmh3 was transformed into Bacillus subtilis WB600 competent cells, cultured overnight on LB plates containing Kana resistance (100 mg / L), and the positive transformants WB600-pMA5-BMH3 were screened (see the results). Figure 1 ). The transformants were picked up and placed in 10 mL LB liquid medium and cultured at 37°C for 36 h. The protein in the bacterial solution was analyzed by SDS-PAGE (see the results). Figure 2 ).

[0065] Figure 2 In the figure, lane 2 is a sample of Bacillus subtilis WB600-pMA5-BMH3 culture liquid. The target protein CYP BMH3 is about 46 kDa in size. From the figure, we can see that the correct band appears at the corresponding position, which proves that the enzyme protein can be expressed soluble in Bacillus subtilis.

[0066] Example 5 Analysis of progesterone conversion by recombinant bacteria

[0067] The transformant WB600-pMA5-BMH3 was transferred to LB medium and cultured for 12 hours. 0.5 g / L progesterone was added for transformation. After 120 hours of transformation, samples were taken for HPLC analysis. The results are shown in Figure 3 The fermentation product of the recombinant bacterium Bacillus subtilis WB600-pMA5-BMH3 corresponds to the peak time of the 11α-OH-progesterone standard liquid chromatography; the MS spectrum is as follows Figures 4 - 6 As shown, the MS spectrum of the fermentation product of the recombinant bacteria Bacillus subtilis WB600-pMA5-BMH3 corresponds to the MS spectrum of the 11α-OH-progesterone standard.

[0068] The conversion rate of progesterone and the molar yield of 11α-OH-progesterone were calculated and the results are shown in the table below.

[0069] Table 1 Results of progesterone transformation by recombinant bacteria in Example 5

[0070] Recombinant bacterium WB600 - pMA5 - BMH3 Progesterone conversion efficiency 67.53％ Molar yield of 11α - OH - progesterone 10.65％

[0071] Optimum temperature of P450 enzyme CYP BMH3 at the C11α position of hydroxylatable progesterone

[0072] Whole-cell conversion was carried out at 30 °C, 33 °C, 35 °C, 37 °C, and 40 °C for 120 h respectively, and the other conditions were the same as those in Example 4. The optimum temperature for the recombinant bacterium WB600-pMA5-BMH3 to convert progesterone into 11α-OH-progesterone was determined to be 37 °C. The yields of 11α-OH-progesterone are shown in the following table ( Figure 7 ).

[0073]

[0074] As can be seen from the above table, the optimum catalytic temperature of P450 enzyme CYP BMH3 at the C11α position of hydroxylatable progesterone is 37 °C.

[0075] Example 7 Optimum pH of P450 enzyme CYP BMH3 at the C11α position of hydroxylatable progesterone

[0076] Whole-cell conversion was carried out at different initial pH values (at 37 °C, the most suitable temperature) for 120 h, and the other conditions were the same as those in Example 4. The yields of 11α-OH-progesterone are shown in the following table ( Figure 8 ).

[0077]

[0078] As can be seen from the above table, the optimum pH of P450 enzyme CYP BMH3 at the C11α position of hydroxylatable progesterone is 7.0.

[0079] Example 8 Substrate solubilization

[0080] Whole-cell conversion was carried out under different substrate solubilizing agents (the solubilizing agents were methanol, ethanol, DMF, glycerol, Tween 80, and hydroxypropyl-β-cyclodextrin HP-β-CD, 1% feeding) (at 37 °C, pH 7.0, the most suitable temperature and pH) for 120 h, and the other conditions were the same as those in Example 4. The yields of 11α-OH-progesterone are shown in the following table ( Figure 9 ).

[0081]

[0082]

[0083] As can be seen from the above table, the best substrate solubilizing agent for P450 enzyme CYP BMH3 at the C11α position of hydroxylatable progesterone is HP-β-CD, followed by glycerol and Tween 80.

[0084] Comparative Example 1 Comparison of condition optimization

[0085] (1) Conversion efficiency and molar yield of progesterone under unoptimized conditions:

[0086] When the substrate feeding amount is 1 g / L and the culture temperature is 30 °C without any fermentation optimization, the conversion efficiency and molar yield results of recombinant strain WB600-pMA5-BMH3 for progesterone are shown in the following table.

[0087] Recombinant bacterium WB600 - pMA5 - BMH3 Progesterone conversion efficiency 55.62％ Molar yield of 11α - OH - progesterone 1.51％

[0088] (2) Conversion efficiency and molar yield of progesterone after condition optimization:

[0089] Specifically, the fermentation condition optimization is as follows: substrate feeding amount 0.5 g / L; culture temperature 37 °C; pH = 7.0; substrate cosolvent is 1% HP-β-CD:

[0090] Recombinant bacterium WB600 - pMA5 - BMH3 Progesterone conversion efficiency 67.53％ Molar yield of 11α - OH - progesterone 10.65％

[0091] Comparative Example 2 Replacement of host

[0092] In addition to Bacillus subtilis, the applicant also attempted to construct recombinant Escherichia coli BL21-pET28a-CYP BMH3.

[0093] The cyp bmh3 sequence was obtained by PCR from the genome of Bacillus megaterium H-1. The gene was used to construct a recombinant expression plasmid pET28a-bmh3 with pET28a as the plasmid and Escherichia coli BL21 as the expression host, in order to achieve the high-efficiency expression of P450 progesterone hydroxylase (CYP BMH3) of Bacillus megaterium H-1. The specific steps are as follows:

[0094] (1) Extraction of the genome of Bacillus megaterium H-1 strain

[0095] The Bacillus megaterium H-1 strain was cultured in LB medium (peptone 10 g / L, sodium chloride 10 g / L, yeast powder 5 g / L, pH 7.0) for 12 h at a culture temperature of 30 °C. Take 1 mL of the bacterial solution, centrifuge at 12000 rpm for 2 min, discard the supernatant, and collect the bacterial cells.

[0096] Extract the whole genome of the Bacillus megaterium H-1 strain according to the genome extraction kit instructions, and use the obtained genome of the Bacillus megaterium H-1 strain for subsequent experiments.

[0097] (2) Cloning of the P450 progesterone hydroxylase gene from Bacillus megaterium strain H-1

[0098] Relevant protein information was obtained through transcriptome sequencing of Bacillus megaterium strain H-1, and part of it was P450 progesterone hydroxylase. According to the comparison of the known P450 progesterone hydroxylase sequence on NCBI, it was known that this P450 was from the CYP106A subfamily and had a high homology with CYP106A1. Based on the protein information obtained from the known CYP106A1 sequence, primers were designed to amplify the target gene, and the primer sequences were as follows:

[0099] Primer 1:

[0100] CAGCAAATGGGTCGCGGATCCATGAACAAAGAAGTCATTCCCGT T

[0101] Primer 2:

[0102] TTGTCGACGGAGCTCGAATTCTTATCTGTACACCGTCATGGGC

[0103] Using the extracted genomic DNA of Bacillus megaterium strain H-1 as a template and the above nucleotide sequences as primers, the coding gene of P450 progesterone hydroxylase was amplified by PCR. The PCR reaction was carried out in a 50 μL system, and the reaction conditions were as follows: pre-denaturation at 95 °C for 3 min, then cycling; denaturation at 95 °C for 30 s, annealing at 62.5 °C for 30 s, extension at 72 °C for 1.5 min, for a total of 34 cycles; final extension at 72 °C for 5 min. After agarose gel electrophoresis of the PCR products, the gel was cut and recovered, ligated with the pET28a vector, and then transformed into Escherichia coli JM109. Positive transformants were screened on LB plates containing Amp resistance (50 mg / L). Positive transformants were picked and inoculated into LB liquid medium, cultured at 37 °C for 12 h, and the plasmid was extracted. This plasmid was named pET28a-bmh3, and the sequence of this plasmid was determined.

[0104] (3) Construction of recombinant expression plasmid

[0105] The expression plasmid used in this study is the expression plasmid pET28a of Escherichia coli BL21. The plasmid pET28a and the enzyme gene cyp bmh3 were digested with double enzymes to obtain linear fragments. After digestion, agarose gel electrophoresis was performed, and the gel was cut and recovered. T4 ligase was used to ligate at 37°C for 3.5 h. The ligation product was transformed into competent cells of Escherichia coli E. coli JM109 and cultured overnight on an LB plate containing Amp resistance (50 mg / L). Positive transformants were screened, enriched, and then the plasmid was extracted and named pET28a-bmh3.

[0106] (4) Screening and induced expression of recombinant bacteria

[0107] The recombinant plasmid pET28a-bmh3 was transformed into competent cells of Escherichia coli BL21 and cultured overnight on an LB plate containing Kana resistance (100 mg / L). Positive transformants BL21-pET28a-BMH3 were screened (the results are shown in Figure 10 ). The transformants were picked into 10 mL of LB liquid medium and cultured at 37°C for 36 h. SDS-PAGE analysis was performed on the proteins in the bacterial solution.

[0108] It was confirmed by SDS-PAGE expression verification experiments that the above recombinant bacteria could express the target enzyme. However, through fermentation verification, it was found that the recombinant bacteria could not convert progesterone to produce the target product 11α-OH-progesterone (see Figure 11 ). Only recombinant Bacillus subtilis has a complete hydroxylation function.

[0109] Obviously, the above embodiments are only examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of this invention.

Claims

1. A recombinant Bacillus subtilis expressing a P450 enzyme that hydroxylates the C11α position of progesterone, characterized in that: the recombinant Bacillus subtilis expresses a P450 enzyme that hydroxylates the C11α position of progesterone and has the amino acid sequence shown in SEQ ID NO.

1.

2. The recombinant Bacillus subtilis according to claim 1, characterized in that: the nucleotide sequence of the gene encoding the P450 enzyme that hydroxylates the C11α position of progesterone is shown in SEQ ID NO.

2.

3. The recombinant Bacillus subtilis according to claim 2, characterized in that: in the recombinant Bacillus subtilis, the gene encoding the P450 enzyme that hydroxylates the C11α position of progesterone uses pMA5 as an expression vector.

4. Use of the recombinant Bacillus subtilis according to any one of claims 1-3 in catalyzing the conversion of progesterone to 11α-OH-progesterone.

5. The use according to claim 4, characterized in that: the recombinant Bacillus subtilis is used for fermentative production of 11α-OH-progesterone under fermentation conditions of 30-40 °C and pH 6.0-8.0.

Images