Recombinant bacteria for producing poly(hydroxyalkanoate-co-lactic acid) and application thereof

Abstract

The application provides a recombinant bacterium for producing poly(hydroxy fatty acid-co-lactic acid) and an application thereof, and the recombinant bacterium can produce P(HA-co-LA) by modifying a strain originally incapable of producing P(HA-co-LA). Meanwhile, the recombinant bacterium can regulate the content of LA and the content of HA monomers in the produced P(HA-co-LA), so that new P(HA-co-LA) materials with excellent various types of performance are obtained.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and biomaterials, specifically to various hydroxy fatty acid and lactic acid copolymers P (HA-co-LA), and methods for constructing microbial biosynthetic pathways and regulating different monomer ratios. Background Technology

[0002] Polylactic acid (PLA) is a typical biopolymer. Traditional synthesis involves two steps: bio-fermentation and chemical polymerization. Lactic acid, obtained through microbial fermentation, is then polymerized into PLA via catalyst-mediated chemical polymerization (Reference: Nampoothiri, KM, Nair, NR, and John, RP (2010). An overview of the recent developments in polylactide (PLA) research. Bioresource Techn 101, 8493-8501.). PLA is widely used in biopharmaceuticals, food, and even everyday consumer goods. However, its poor material ductility and presence of heavy metal residues significantly limit its applications. Polyhydroxyalkanoates (PHAs) are carbon and energy sources synthesized by microorganisms and stored intracellularly. They are also a collective term for polymers containing hundreds of monomers. PHAs are biorenewable and biodegradable. Due to the diverse monomer structures used in the synthesis of PHA, different types of PHA exhibit vastly different material properties (Reference: Chen, GQ, and Hajnal, I. (2015). The 'PHAome'. Trends Biotechnol 33, 559-564.). PHA obtained by polymerization from a single monomer, such as PHB, suffers from low elongation at break, brittleness, poor toughness, and unstable melt state. Compared to PHB, PLA has a lower melting point, significantly reducing processing difficulty for thermoplastic processes (Reference: Perego, G., Cella, GD, and Bastioli, C. (1996). Effect of molecular weight and crystallinity on poly(lactic acid) mechanical properties. J ApplPolym Sci 59, 37-43.). PHA materials containing lactic acid monomers, due to the variety of monomer structures, achieve a good balance between rigidity and toughness, and possess excellent degradability and heat-sealing properties. Therefore, copolymerizing lactic acid (LA) with different types of PHA monomer molecules can improve the properties of PLA or PHA.

[0003] Furthermore, the high cost is a significant obstacle limiting the market share of bio-fermentation technology in competition with traditional chemical technologies (Reference: Taguchi, S., Yamada, M., Matsumoto, Ki, Tajima, K., Satoh, Y., Munekata, M., Ohno, K., Kohda, K., Shimamura, T., and Kambe, H. (2008). A microbial factory for lactate-based polyesters using a lactate-polymerizing enzyme. Proc Natl AcadSci 105, 17323-1). High-density fermentation technology increases yield per unit volume while increasing fermentation volume, thus reducing fermentation costs and demonstrating significant application value. Summary of the Invention

[0004] To address the above problems, this application provides a novel method for preparing P(HA-co-LA) using bio-fermentation technology. Specifically, this method involves modifying strains that are not originally capable of producing P(HA-co-LA) to construct recombinant bacteria that can produce lactic acid monomers and copolymerize lactic acid with monomers that constitute PHA to form P(HA-co-LA). Furthermore, this recombinant bacteria can regulate the LA content and HA monomer content in the produced P(HA-co-LA). The resulting P(HA-co-LA) exhibits a high glass transition temperature, a low Young's modulus, and a large elongation at break.

[0005] In a first aspect, the present invention provides a recombinant strain for producing poly(hydroxy fatty acid-co-lactic acid).

[0006] The genome of the recombinant bacteria contains a PHA synthesis gene and / or a lactate synthesis gene. Preferably, the PHA synthesis gene and / or lactate synthesis gene can be integrated into the chromosomal genome or contained in the recombinant plasmid vector and exist freely in the recombinant bacteria.

[0007] The PHA synthesis gene and / or lactic acid synthesis gene are overexpressed in the recombinant bacteria.

[0008] The promoter used for overexpression can be constitutive or inducible. In one specific embodiment of the invention, the constitutive promoter can be the constitutive porin gene promoter or a mutant thereof. The constitutive promoter can be a low-strength promoter, a medium-strength promoter, or a high-strength promoter. For example, Pporin 203, Pporin 221, Pporin 194, Pporin 278, Pporin 68, Pporin 42, or Pporin 58 (Reference: Shen, R. et al. Promoter engineering for enhanced P(3HB-co-4HB) production by Halomonas bluephagenesis. ACS synthetic biology 7, 1897-1906 (2018).).

[0009] In one specific embodiment of the present invention, the inducible promoter may be the IPTG-inducible T7 promoter or the T7-like promoter (Reference: Weiss, R., Knight, T. & Sussman, G. Cellular computing and communication using engineered genetic regulatory networks. Cellular computing, 120-121 (2001).).

[0010] The hydroxy fatty acids include one or more of the following: 3-hydroxybutyric acid (3HB), 4-hydroxybutyric acid (4HB), 3-hydroxypropionic acid (3HP), 3-hydroxyhexanoic acid (3-HHx), 6-hydroxyhexanoic acid (6-HHx), 3-hydroxyoctanoic acid (3HO), 3-hydroxyvalerateic acid (3HV), 5-hydroxyvalerateic acid (5HV), 3-hydroxydecanoic acid (3HD), 3-hydroxydodecanoic acid (3HDD), or 3-hydroxytetradecanoic acid (3HTD).

[0011] The PHA is a homopolymer or copolymer of monomers. The monomers include one or more of the following: 3-hydroxybutyric acid (3HB), 4-hydroxybutyric acid (4HB), 3-hydroxypropionic acid (3HP), 3-hydroxyhexanoic acid (3-HHx), 6-hydroxyhexanoic acid (6-HHx), 3-hydroxyoctanoic acid (3HO), 3-hydroxyvalerateic acid (3HV), 5-hydroxyvalerateic acid (5HV), 3-hydroxydecanoic acid (3HD), 3-hydroxydodecanoic acid (3HDD), or 3-hydroxytetradecanoic acid (3HTD).

[0012] The PHA synthesis genes include poly(3-hydroxybutyrate) (PHB) synthesis genes, 3-hydroxybutyric acid (3HB) and 4-hydroxybutyric acid (4HB) copolymer (P34HB) synthesis genes, poly(3-hydroxypropionic acid) (P3HP) synthesis genes, etc.

[0013] In one specific embodiment of the present invention, the PHA synthesis gene containing 3-hydroxybutyrate monomer comprises one or more of the following: β-ketothiolysis enzyme encoding gene (phaA), acetyl-CoA reductase encoding gene (phaB), or PHA polymerase encoding gene (phaC).

[0014] Preferably, the β-ketothiolytic enzyme encoding gene (phaA) and / or the acetyl-CoA reductase encoding gene (phaB) are derived from Rochechocetes.

[0015] In one specific embodiment of the present invention, the PHA synthesis gene containing 4-hydroxybutyrate monomer comprises one or more of the following: succinate half-aldehyde dehydrogenase encoding gene (sucD), 4-hydroxybutyrate dehydrogenase encoding gene (4hbD), or 4-hydroxybutyryl-CoA transferase encoding gene (orfZ); or, the PHA synthesis gene containing 4-hydroxybutyrate monomer comprises one or more of the following: alcohol dehydrogenase encoding gene (dhaT), aldehyde dehydrogenase encoding gene (aldD), or 4-hydroxybutyryl-CoA transferase encoding gene (orfZ). Preferably, it also includes one or more of the following: 2-ketoglutarate decarboxylase (ogdA), scpA, or scpB.

[0016] In one specific embodiment of the present invention, the PHA synthesis gene containing 3-hydroxypropionic acid monomer includes an aldehyde dehydrogenase encoding gene (aldD) and / or an alcohol dehydrogenase encoding gene (dhaT).

[0017] In one specific embodiment of the present invention, the PHA synthesis gene containing 3-hydroxydodecanoate monomer comprises one or more of the following: β-ketothiolysis enzyme encoding gene (phaA), acetyl-CoA reductase encoding gene (phaB), or PHA polymerase encoding gene (phaC), wherein the PHA polymerase encoding gene is phaC61-3.

[0018] The sequence of phaC61-3 is the first to 1680th positions of FJ626663.1 or its mutated sequence, such as the mutations of S325T and Q481K. In a specific embodiment of the present invention, the sequence is shown in SEQ ID NO: 10.

[0019] When the hydroxy fatty acid contains 3-hydroxydodecanoic acid, the recombinant bacteria weakly express one or more of the following genes: 3-ketoacyl-CoA thiolytic enzyme encoding gene (fadA), (S)-3-hydroxyacyl-CoA dehydrogenase encoding gene (fadB), or 3-hydroxyacyl-CoA acyltransferase encoding gene (phaG).

[0020] Preferably, the weakened expression can be gene knockout or gene silencing.

[0021] Preferably, the recombinant bacteria express one or more of sdhE, gabD, sad, prpC, phaG, or phaJ in a weakened manner.

[0022] In one specific embodiment of the present invention, the hydroxy fatty acid in the poly(hydroxy fatty acid-co-lactic acid) is 3HB: the PHA synthesis gene includes one or more of the following: a β-ketothiolase encoding gene (phaA), an acetyl-CoA reductase encoding gene (phaB), or a PHA polymerase encoding gene (phaC). Preferably, the β-ketothiolase encoding gene (phaA) and / or the acetyl-CoA reductase encoding gene (phaB) are derived from *Rhodotorula fragilis*; the recombinant bacteria are *Halomonas*.

[0023] In one specific embodiment of the present invention, the hydroxy fatty acid in the poly(hydroxy fatty acid-co-lactic acid) is 4HB; the PHA synthesis gene contains one or more of the following: succinate semialdehyde dehydrogenase encoding gene (sucD), 4-hydroxybutyrate dehydrogenase encoding gene (4hbD), or 4-hydroxybutyryl-CoA transferase encoding gene (orfZ); or, it contains one or more of the following: alcohol dehydrogenase encoding gene (dhaT), aldehyde dehydrogenase encoding gene (aldD), or 4-hydroxybutyryl-CoA transferase encoding gene (orfZ); the recombinant bacteria is *Halomonas*.

[0024] In one specific embodiment of the present invention, the hydroxy fatty acids in the poly(hydroxy fatty acid-co-lactic acid) are 3HB and 4HB; the PHA synthesis gene contains one or more of the following: a β-ketothiolase encoding gene (phaA), an acetyl-CoA reductase encoding gene (phaB), or a PHA polymerase encoding gene (phaC). Preferably, the β-ketothiolase encoding gene (phaA) and / or the acetyl-CoA reductase encoding gene (phaB) are derived from *Rhodotorula fragilis*; and contain one or more of the following: a succinate semialdehyde dehydrogenase encoding gene (sucD), a 4-hydroxybutyrate dehydrogenase encoding gene (4hbD), or a 4-hydroxybutyryl-CoA transferase encoding gene (orfZ), or a combination of one or more of the following: an alcohol dehydrogenase encoding gene (dhaT), an aldehyde dehydrogenase encoding gene (aldD), or a 4-hydroxybutyryl-CoA transferase encoding gene (orfZ); the recombinant bacteria are *Halomonas*.

[0025] In one specific embodiment of the present invention, the hydroxy fatty acid in the poly(hydroxy fatty acid-co-lactic acid) is 3HB; the PHA synthesis gene includes the β-ketothiolysis enzyme encoding gene (phaA) and the acetyl-CoA reductase encoding gene (phaB); the recombinant bacteria is Escherichia.

[0026] In one specific embodiment of the present invention, the hydroxy fatty acids in the poly(hydroxy fatty acid-co-lactic acid) are 3HB and 4HB; the PHA synthesis gene includes the encoding genes for 2-ketoglutarate decarboxylase (ogdA), succinate semialdehyde dehydrogenase (sucD), 4-hydroxybutyrate dehydrogenase (4hbD), 4-hydroxybutyryl coenzyme A transferase (orfZ), alcohol dehydrogenase (dhaT), and aldehyde dehydrogenase (aldD); the recombinant bacteria are Burkholderia, preferably Ralstonia eutropha.

[0027] In one specific embodiment of the present invention, the hydroxy fatty acids in the poly(hydroxy fatty acid-co-lactic acid) are 3HB and mLl HA: The PHA synthesis gene contains one or more of the following: a β-ketothiolase encoding gene (phaA), an acetyl-CoA reductase encoding gene (phaB), or a PHA polymerase encoding gene (phaC61-3). Preferably, the β-ketothiolase encoding gene (phaA) and / or the acetyl-CoA reductase encoding gene (phaB) are derived from *Rhodotorula fragilis*; and the recombinant bacteria are expressed attenuatedly as 3-ketoacyl-CoA thiolase gene (fadA), (S)-3-hydroxyacyl-CoA dehydrogenase gene (fadB), and 3-hydroxyacyl-CoA acyltransferase (phaG); the recombinant bacteria are *Pseudomonas*.

[0028] The lactic acid synthesis gene mentioned includes the polylactic acid synthesis gene.

[0029] The lactate synthesis genes mentioned include one or more of the following: lactate dehydrogenase encoding genes, propionyl-CoA transferase encoding genes, or PHA polymerase encoding genes.

[0030] Preferably, the lactate dehydrogenase encoding gene is ldhA.

[0031] Preferably, the propionyl-CoA transferase encoding gene is derived from Clostridium propionitum; more preferably, the propionyl-CoA transferase encoding gene is pct540; its sequence can be seen at positions 485-2059 of AJ276553.1 or SEQ ID NO: 8.

[0032] Preferably, the PHA polymerase encoding gene is derived from *Pseudomonas schlegelii*; more preferably, the PHA polymerase encoding gene is phaC1437; its sequence can be seen in positions 1-1680 of FJ626663.1 or its mutated sequence, such as mutations in Q481K, S325T, E130D and S477G. In a specific embodiment of the present invention, the sequence is shown in SEQ ID NO: 9.

[0033] The recombinant bacteria are *Halomonas*, *Pseudomonas*, *Escherichia*, or *Burkholderia*. *Burkholderia* includes, but is not limited to, *Ralstonia eutropha*. *Halomonas* includes *Halomonas bluephagenesis* TD01 CGMCC No. 4353, *Halomonas campaniensis* LS21 CGMCC No. 6593, or *Halomonas aydingkolgenesis* M1 CGMCC No. 19880, and any derivatives of these *Halomonas* species, especially those that are genetically engineered or physicochemically mutagenic.

[0034] The PHA synthesis gene and lactate synthesis gene are expressed or overexpressed on chromosomes or plasmids.

[0035] Preferably, the overexpression can also be an activating transcription factor that upregulates the target gene.

[0036] In a second aspect, the present invention provides a method for constructing the recombinant bacteria described above.

[0037] The construction method described includes overexpressing the PHA synthesis gene and / or the lactate synthesis gene in recombinant bacteria.

[0038] Preferably, the construction method includes introducing a PHA synthesis gene and / or a lactic acid synthesis gene into recombinant bacteria.

[0039] Preferably, the PHA synthesis gene and / or lactate synthesis gene can be integrated into the chromosomal genome or contained in the recombinant plasmid vector carried and free in the recombinant bacteria.

[0040] The importation can be performed by inserting the PHA synthesis gene and / or lactate synthesis gene into the non-functional region of the recombinant bacteria.

[0041] The introduction is performed using a plasmid vector carrying the PHA synthesis gene and / or lactate synthesis gene. The plasmid vector contains a promoter, which can be constitutive or inducible. In one specific embodiment of the invention, the constitutive promoter can be the constitutive porin gene promoter and its mutants. The constitutive promoter can be a low-strength promoter, a medium-strength promoter, or a high-strength promoter. For example, Pporin 203, Pporin 221, Pporin 194, Pporin 278, Pporin 68, Pporin 42, or Pporin 58 (Reference: Shen, R. et al. Promoter engineering for enhanced P(3HB-co-4HB) production by Halomonas bluephagenesis. ACS synthetic biology 7, 1897-1906 (2018).). In one specific embodiment of the present invention, the inducible promoter may be the IPTG-induced T7 promoter or the T7-like promoter (Reference: Weiss, R., Knight, T. & Sussman, G. Cellular computation and communication using engineered genetic regulatory networks. Cellularcomputing, 120-121 (2001).).

[0042] The construction method further includes knocking out one or more of the following genes: 3-ketoacyl-CoA thiolytic enzyme encoding gene (fadA), (S)-3-hydroxyacyl-CoA dehydrogenase encoding gene (fadB), or 3-hydroxyacyl-CoA acyltransferase encoding gene (phaG).

[0043] The knockout can be the knockout of all or part of the nucleotide sequence of the target gene, or the knockout of the regulatory elements or related regulatory genes of the target gene, so that the target gene is not expressed in the recombinant bacteria or the expressed protein is not functional.

[0044] A third aspect of the present invention provides a method for producing poly(hydroxy fatty acid-co-lactic acid).

[0045] The method described is an intracellular synthesis method. Preferably, the method includes fermentation culture of the recombinant bacteria described above.

[0046] The fermentation medium can be liquid, solid, or semi-solid.

[0047] The fermentation medium can be a natural medium, a synthetic medium, and / or a semi-synthetic medium. Preferably, the fermentation medium can be a conventional medium of the prior art, or it can be other substances containing nutrients. Conventional mediums include inorganic salt medium (MMG), Luria-Bertani medium (LB), etc.

[0048] Preferably, the fermentation medium contains a carbon source, a nitrogen source, inorganic salts, etc. The nitrogen source includes inorganic nitrogen sources and / or organic nitrogen sources. More preferably, the fermentation medium also contains vitamins and / or growth factors.

[0049] The fermentation medium contains relevant carbon sources and / or unrelated carbon sources.

[0050] The relevant carbon source is selected from one or more of the following: lactic acid, glycerol, γ-butyrolactone, 4-hydroxybutyric acid, 1,2-butanediol, 1,3-butanediol, 1,4-butanediol, 1,6-hexanediol, 1,8-octanediol, 1,10-decanediol, 1,12-dodecanediol, propionic acid, valeric acid or heptanoic acid, or other medium- or long-chain fatty acids.

[0051] The unrelated carbon source is selected from one or more combinations of glucose, sodium gluconate, glycerol, acetic acid, hexanoic acid, xylose, cellulose, lactose, lactic acid, or fructose.

[0052] The relevant and unrelated carbon sources can be used individually or in combination to adjust the proportion of different monomers in P(HA-co-LA).

[0053] Preferably, the promoter strength of one or several genes is adjusted to regulate the proportion of different monomers in P(HA-co-LA).

[0054] Preferably, the feeding time during the fermentation process is adjusted to appropriately extend the cell growth time.

[0055] In one specific embodiment of the present invention, the feeding time is from the 5th to the 36th hour of fermentation culture, preferably from the 16th to the 28th hour.

[0056] In a fourth aspect, the present invention provides a poly(hydroxy fatty acid-co-lactic acid) obtained by the above-described method.

[0057] The proportion of lactic acid monomer is any value between 0 and 50%, preferably any value between 1 and 25%, such as 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, etc.

[0058] A fifth aspect of the present invention provides a method for adjusting the monomer ratio in poly(hydroxy fatty acid-co-lactic acid), the method comprising fermenting and culturing the recombinant bacteria described above.

[0059] Preferably, the monomer ratio in poly(hydroxy fatty acid-co-lactic acid) can be adjusted by regulating the carbon source (e.g., the ratio between relevant and unrelevant carbon sources) or by regulating the enzyme strength at key nodes of the metabolic pathway, or by using different promoters to express the gene.

[0060] The adjustment can be increased or decreased. Preferably, the proportion of lactic acid monomers is increased.

[0061] Preferably, the feeding amount is controlled by adjusting the timing of the carbon-to-nitrogen ratio switching, i.e., the amount of feed added during the bacterial growth phase and the PHA accumulation phase. In one specific embodiment of the invention, the feeding time during fermentation is adjusted to appropriately extend the cell growth time.

[0062] In one specific embodiment of the present invention, the feeding time is from the 5th to the 36th hour of fermentation culture, preferably from the 16th to the 28th hour.

[0063] A sixth aspect of the present invention provides a method for increasing the proportion of LA in P(HA-co-LA), the method comprising fermenting and culturing the recombinant bacteria described above.

[0064] Preferably, the method includes adjusting the expression intensity of the overexpressed gene. For example, different promoters can be used to regulate gene expression, or the ratio of relevant carbon sources to irrelevant carbon sources in the culture medium can be adjusted.

[0065] A seventh aspect of the present invention provides the application of the above-described recombinant bacteria and the above-described poly(hydroxyl fatty acid-co-lactic acid) in the preparation of biodegradable new biomaterials. Preferably, the application is in the development of medical devices, medical microspheres, surgical sutures, patches, disposable packaging materials, or textile fibers.

[0066] The "overexpression" described in this invention refers to the upregulation of gene expression, exceeding the original natural expression level or causing a gene that was not originally expressed to be expressed.

[0067] The "weakened expression" described in this invention refers to downregulating gene expression to a level lower than the original natural expression level, or even not expressing it at all.

[0068] The “poly(hydroxy fatty acid-co-lactic acid)” described in this invention is a copolymer of hydroxy fatty acid and lactic acid, which can be abbreviated as P(HA-co-LA) or P(LA-co-HA) in this document, where LA represents lactic acid and HA represents one or more hydroxy fatty acids, such as 3HB, 3HB-co-4HB, etc.

[0069] The "medium- and long-chain 3-hydroxy fatty acids" mentioned in this invention are abbreviated as mcl HA, which represent 3-hydroxy fatty acids with a chain length of 10-15 (e.g., 10, 11, 12, 13, 14, 15), such as 3-hydroxydecanoic acid (3HD), 3-hydroxydodecanoic acid (3HDD), or 3-hydroxytetradecanoic acid (3HTD).

[0070] The “monomer ratio” mentioned in this invention refers to the molar amount of the monomer in the total polymer. For example, the “monomer ratio in P(3HB-co-4HB-co-LA)” represents the molar amount of monomers LA, 3HB, or 4HB in P(3HB-co-4HB-co-LA).

[0071] Table 1 shows the correspondence between the abbreviations and Chinese names of monomers or polymers in this application.

[0072] Table 1: Abbreviations and Chinese Names of Monomers or Polymers

[0073]

[0074]

[0075] The abbreviations and Chinese names of genes in this application are shown in Table 2.

[0076] Table 2: Comparison of Gene Abbreviations and Chinese Names

[0077]

[0078] Attached Figure Description

[0079] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0080] Figure 1 : P(3HB-co-LA) synthesis-related metabolic pathway diagram. Detailed Implementation

[0081] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0082] The culture medium formulation used in the examples is as follows:

[0083] 60LB: 5g / L yeast extract, 10g / L peptone, 60g / L NaCl, the remainder being distilled water; adjust the pH to 7.0-7.2; then autoclave.

[0084] LB: 5 g / L yeast extract, 10 g / L peptone, 10 g / L NaCl, the remainder being distilled water; adjust the pH to 7.0-7.2; then autoclave.

[0085] 20 MMG: Prepare a NaCl solution for yeast extract with a concentration of 1 g / L and a NaCl concentration of 20 g / L; autoclave after dissolution; after cooling, add 1 mL of component I (to dilute 10 g (NH4)2SO4 and 2 g MgSO4 to 200 mL with distilled water, then autoclave) and 1 mL of component II (to dilute 96.5 g Na2HPO4·12H2O and 15 g KH2PO4 to 200 mL with distilled water, then autoclave) to every 50 mL of solution; finally, adjust the pH of the system to approximately 7.0 with a 5 M NaOH aqueous solution.

[0086] 60 MMG: Prepare a NaCl solution for yeast extract with a concentration of 1 g / L and a NaCl concentration of 60 g / L; autoclave after dissolution; after cooling, add 1 mL of component I (to dilute 10 g (NH4)2SO4 and 2 g MgSO4 to 200 mL with distilled water, then autoclave) and 1 mL of component II (to dilute 96.5 g Na2HPO4·12H2O and 15 g KH2PO4 to 200 mL with distilled water, then autoclave) to every 50 mL of solution; finally, adjust the pH of the system to approximately 9.0 with a 5 M NaOH aqueous solution.

[0087] Cell dry weight calculation method in the embodiment:

[0088] The measurement is based on the dry weight of cells per liter of the fermented system. The unit of dry weight of cells is g / L. Take 30 mL of bacterial culture sample into a centrifuge tube, centrifuge to remove the supernatant, and then freeze-dry. Dry weight of cells (CDW) = (weight of the freeze-dried centrifuge tube - weight of the original empty centrifuge tube) ÷ 0.03; the weight of the freeze-dried centrifuge tube and the weight of the original empty centrifuge tube are both in g; 0.03 represents 0.03 L.

[0089] The methods for detecting the PHA content and the content of each monomer in the bacterial cells in the examples are as follows:

[0090] The freeze-dried product was subjected to esterification, and the monomer content was then determined by gas chromatography (GC).

[0091] Esterification reaction: Take 30-40 mg of the freeze-dried product into an esterification tube, add 2 mL of chloroform and 2 mL of esterification solution (methanol solution containing 1 g / L benzoic acid and 3% concentrated sulfuric acid), mix well, cover and seal, and esterify in a metal bath at 100℃ for 4 h; after cooling to room temperature, add 1 mL of distilled water, shake well and mix thoroughly, and let stand to separate the layers; after the chloroform phase and water are completely separated, take the chloroform phase for gas chromatography analysis;

[0092] Take 20-25 mg of poly(3-hydroxybutyrate) (PHB), γ-butyrolactone or δ-valerolactone, and D-lactic acid and esterify them to obtain a standard sample.

[0093] Gas chromatography (GC) analysis parameters: The analytes were separated using an HP-5 column in a Shimadzu GC-2014 gas chromatograph; the GC analysis temperature program was set as follows: injection port temperature (240℃), detector temperature (250℃), initial temperature and holding time (80℃, 1.5 min), first stage temperature increase (temperature increase rate 30℃ / min), second stage temperature increase (temperature increase rate 40℃ / min, held at 240℃ for 2 min), and total program time 8 min;

[0094] The corresponding PHA monomer ratio is calculated by reading the peak area of ​​the internal standard, the peak area of ​​the PHA monomer methyl ester in the standard, the peak area of ​​the internal standard in the sample, and the peak area of ​​the PHA monomer methyl ester in the sample obtained by gas chromatography.

[0095] PHA content (%) = (mass of PHA + mass of LA) ÷ mass of freeze-dried product × 100%;

[0096] The content of LA (mol%) = number of moles of LA ÷ (number of moles of PHA + number of moles of LA) × 100%;

[0097] For the calculation method of the content of other PHA monomers, please refer to the content of LA.

[0098] In the examples, the sites of Halomonas, such as G43 and G7, refer to or follow the naming rules of the article: Low-cost industrial production of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) (Tsinghua University Doctoral Dissertation, Jianwen Ye and Guoqiang Chen), or the article: Stimulus response-based fine-tuning of polyhydroxyalkanoate pathwayin Halomonas (Ye JWet al, Metabolic Engineering, 2020).

[0099] The Halomonas bluephagenesis TD01-D1 used in the examples can be found in the article: Tan D, Xue YS, Aibaidula G, et al. Unsterile and continuous production of polyhydroxybutyrate by Halomonas TD01[J]. Bioresource Technology: Biomass, Bioenergy, Biowastes, Conversion Technologies, Biotransformations, Production Technologies, 2011(17):102.

[0100] Example 1: Introducing the pct540 and phaC1437 genes into halophilic bacteria to increase the proportion of LA synthesized from unrelated carbon sources.

[0101] This invention introduces propionyl-CoA transferase (Pct540) and PLA polymerase (PhaC1437) with PLA polymerization activity at the G43 site in the halophilic bacterium *Halomonas bluephagenesis* TD01-D1 using homologous recombination. In copolymers, an excessively high proportion of 3HB can lead to a lack of flexibility and ductility. Therefore, various promoters with different strengths were designed to express the pct540 (SEQ ID NO: 8) and phaC1437 (SEQ ID NO: 9) genes. This enables the conversion of glycolysis product pyruvate into lactyl-CoA, which then synthesizes P(3HB-co-LA) under the metabolic pathway described in Example 1. The relevant principles are detailed in the appendix. Figure 1 .

[0102] The promoters used in the porin promoter library include Pporin203, Pporin221, Pporin 194, Pporin 278, Pporin 68, Pporin 42, and Pporin 58, and the corresponding recombinant bacteria are named Halomonas bluephagenesis TDJ1, TDJ2, TDJ3, TDJ4, TDJ5, TDJ6, and TDJ7, etc.

[0103] Both the recombinant bacteria and the originating strain *Halomonas bluephagenesis* TD01 were cultured in 60 LB medium at 37°C and 200 rpm for 12 hours. Then, 1% of the culture was inoculated into 50 mL of 60 MMG medium supplemented only with glucose as the carbon source, and cultured at 37°C and 200 rpm for 48 hours. After 48 hours, the bacterial cells were collected, and the cell dry weight and PHA content were measured. The results are shown in Table 3 below.

[0104] Table 3: Synthesis of PHA and its monomer LA by various recombinant Halomonas bluephagenesis strains

[0105]

[0106]

[0107] The PHA accumulated by the originating strain Halomonas bluephagenesis TD01 with unrelated carbon source (glucose) as substrate did not contain LA component, while the PHA accumulated by the recombinant strains Halomonas bluephagenesis TDJ1-TDJ7 contained LA component. The two genes contained in this strain can achieve the synthesis of P(3HB-co-LA) with unrelated carbon source as substrate in Halomonas.

[0108] Example 2: Introducing phaA, phaB, and phaC genes into halophilic bacteria to increase overall PHA content.

[0109] This invention increases the yield of P(3HB-co-LA) by introducing exogenous β-ketothiolase (phaA), acetyl-CoA reductase (phaB), and PHA polymerase (phaC) at the G51 site of the genome in the halophilic bacterium *Halomonas bluephagenesis* TDJ7, using the Pporin58 promoter and the promoter of the phaCAB gene cluster from *Ralstonia eutropha*. The related principles are detailed in the appendix. Figure 1 The strain constructed using this method was named TDJ7N1.

[0110] Both the recombinant bacteria and the originating bacteria, Halomonas bluephagenesis TDJ7, were cultured in 60 LB medium at 200 rpm and 37°C for 12 hours. Then, 1% of the culture was inoculated into 50 mL of 60 MMG medium and cultured at 200 rpm and 37°C for 48 hours. After 48 hours, the bacterial cells were collected, and the cell dry weight and PHA content were measured. The results are shown in Table 4 below.

[0111] Table 4: Expression of phaA, phaB, and phaC increases P(LA-co-3HB) yield

[0112]

[0113] Under the same culture conditions, the recombinant strain Halomonas bluephagenesis TDJ7N1 showed significantly higher cell dry weight and PHA content than the original strain Halomonas bluephagenesis TDJ7, indicating that the introduction of these three genes can increase the P(3HB-co-LA) yield of Halomonas.

[0114] Example 3: Introducing a 4HB monomer synthesis pathway into halophilic bacteria to increase the proportion of 4HB synthesized from unrelated carbon sources.

[0115] P34HB is a binary polyester. Compared to PHB, which is composed solely of 3HB, P34HB exhibits better ductility, and its Young's modulus increases with the proportion of 4HB. Therefore, increasing the proportion of 4HB is crucial in the production of P34HB. The synthetic pathways for 4HB monomers are divided into two types based on their sources. One pathway involves the synthesis of 4HB from succinyl-CoA composed of the sucD, 4hbD, and orfZ genes, which allows for the production of 4HB components using glucose as a substrate. The other pathway involves the synthesis of 4HB from BDO composed of the aldD, dhaT, and orfZ genes.

[0116] First, two recombinant expression plasmids for genes with different 4HB synthesis pathways were constructed, one being pSEVA321-P. p2 -sucD-4hbD, the other is pSEVA321-P p2 -aldD-dhaT. Simultaneously, two control plasmids, pSEVA321-P, were constructed. Porin -sucD-4hbD, the other is pSEVA321-P Porin -aldD-dhaT. The above four plasmids were transformed into P, which was recombined at the G7 site of the genome. Porin -orfZ's H. bluephagenesis TD01G7::P Porin In -orfZ, P34HB synthetic strains were obtained using glucose, BDO, or a mixture of both as substrates. Shake-flask fermentation experiments were performed on each strain, and the dry weight, PHA%, and 4HB% of each strain were analyzed. It was found that pSEVA321-P was present in each strain. p2 -sucD-4hbD and pSEVA321-P p2The -aldD-dhaT strains showed little change in PHA% compared to the control group, but 4HB% increased to varying degrees, as detailed in Tables 5-6.

[0117] Table 5: phaP2 promoter drives genes in the succinyl-CoA to 4HB synthesis pathway to increase the proportion of 4HB in P34HB.

[0118]

[0119] Table 6: Genes driving the BDO to 4HB synthesis pathway via the phaP2 promoter increase the proportion of 4HB in strain P34HB.

[0120]

[0121] Example 4: Construction of a halophilic bacterium synthesizing P(3HB-co-4HB-co-LA)

[0122] The recombinant bacteria from Example 2 were introduced into the BDO plasmid in Example 3, namely TDJ7N2 (corresponding to P). porin -orfZ(P P2 -aldD-dhaT)) and TDJ7N3 (corresponding to P porin -orfZ(P Porin The recombinant bacteria and the original strain, Halomonas bluephagenesis TD01, were cultured in 60 LB medium at 37°C and 200 rpm for 12 hours. Then, 1% of the culture was inoculated into 50 mL of 60 MMG medium supplemented only with 1,4-butanediol and glucose as carbon sources, and cultured at 37°C and 200 rpm for 48 hours. After 48 hours, the bacterial cells were collected, and the cell dry weight and PHA content were measured. The results are shown in Table 7 below.

[0123] Table 7: Synthesis of PHA and its monomers 4HB and LA by various recombinant Halomonas bluephagenesis strains

[0124]

[0125]

[0126] The recombinant strain Halomonas bluephagenesis TDJ7N2-J7N3 accumulated PHA containing both 4HB and LA components, indicating that microbial production of polyhydroxy fatty acid copolymers containing lactic acid monomers, such as P(3HB-co-4HB-co-LA), can be achieved.

[0127] Example 5: Introducing the 3HB and LA monomer synthesis pathway into Escherichia coli to synthesize P(3HB-co-LA)

[0128] This invention utilizes CRISPR / Cas9 technology to insert the coenzyme A transferase gene (pct540, SEQ ID NO: 8) from *Clostridium propionitum* and the PHA polymerase gene (phaC1437, SEQ ID NO: 9) from *Pseudomonas stearothermiae* into the non-functional region gtttctgcgttgtccatacc (SEQ ID NO: 1) of the *Escherichia coli* genome; and to insert the β-ketothiolase gene (phaA) from *Treutrophus roximatei* into the region gttcctttcattcaatcctc (SEQ ID NO: 2). Re ), acetyl-CoA reductase gene (phaB) Re This allows the recombinant bacteria ECBA to synthesize P(3HB-co-LA).

[0129] The recombinant strain ECBA was cultured in LB medium at 200 rpm and 37°C for 12 hours, then inoculated at 1% into 50 mL of MMG medium and cultured at 200 rpm and 37°C for 48 hours. Carbon sources of 20 g / L glucose and 5 g / L lactic acid were added to the MMG medium. After 48 hours, the bacterial cells were collected, and the cell dry weight and PHA content were measured. The results are shown in Table 8 below.

[0130] Table 8: Synthesis of P(3HB-co-LA) material by recombinant strain ECBA in MMG medium with different carbon sources

[0131] glucose 8.41±1.35 64.50±2.15 12.04±0.65 glucose + lactic acid 6.68±0.84 52.61±1.97 22.70±1.52

[0132] Example 6: Introducing the 3HB, 4HB, and LA monomer synthesis pathways into Ralstonia eutropha to synthesize P(3HB-co-4HB-co-LA)

[0133] This invention utilizes homologous recombination to introduce a coenzyme A transferase gene (pct540, SEQ ID NO: 8) from Clostridium propioni and a PHA polymerase gene (phaC1437, SEQ ID NO: 9) from Pseudomonas schwanniferum into the gaaaatggccactgataaggc (SEQ ID NO: 3) site of the genome; inserts 2-ketoglutarate decarboxylase (ogdA), succinate semialdehyde dehydrogenase (sucD), 4-hydroxybutyrate dehydrogenase (4hbd), and 4-hydroxybutyryl coenzyme A transferase (orfZ) into the cttgataaacggaggcatgg (SEQ ID NO: 4) site; and inserts alcohol dehydrogenase (dhaT) and aldehyde dehydrogenase (aldD) into the cacagacatttcggcgccgc (SEQ ID NO: 5) site to enable the recombinant strain REBA to synthesize P(3HB-co-4HB-co-LA).

[0134] The recombinant strain REBA was cultured in LB medium at 200 rpm and 37°C for 12 hours, then inoculated at 1% into 50 mL of 20 MMG medium and cultured at 200 rpm and 37°C for 48 hours. Carbon sources were added to the 20 MMG medium: 20 g / L fructose, 17 g / L palm oil, and 2 g / L lactic acid. After 48 hours, the bacterial cells were collected, and the cell dry weight and PHA content were measured. The results are shown in Table 9 below.

[0135] Table 9: Synthesis of P(3HB-co-4HB-co-LA) material by recombinant strain REBA in MMG medium with different carbon sources

[0136]

[0137] Example 7: Introducing the 3HB, mAl HA and LA monomer synthesis pathway into Pseudomonas entomophila to synthesize P(3HB-co-LA-co-mcl HA)

[0138] This invention utilizes homologous recombination to knock out the 3-ketoacyl-CoA thiolase gene (fadA), (S)-3-hydroxyacyl-CoA dehydrogenase gene (fadB), and 3-hydroxyacyl-CoA acyltransferase (phaG) gene in the genome of *Pseudomonas entomophila*. The coenzyme A transferase gene (pct540, SEQ ID NO: 8) from *Clostridium propionitum* and the PHA polymerase gene (phaC1437, SEQ ID NO: 9) from *Pseudomonas stearothermiae* were inserted at the ccaccgccagggtaatgacc (SEQ ID NO: 6) site in the genome; and the β-ketoacyl-thiolase gene (phaA) from *Treutrophus roximatei* was inserted at the caacggcaccgtgttcggcg (SEQ ID NO: 7) site. Re ), acetyl-CoA reductase gene (phaB) Re The recombinant bacteria PEBA synthesize P(3HB-co-LA-co-mclHA) by using the PHA polymerase gene (phaC61-3, SEQ ID NO: 10) and the PHA polymerase gene (phaC61-3, SEQ ID NO: 10).

[0139] After culturing the above recombinant bacteria PEBV in LB medium at 200 rpm and 30℃ for 12 hours, it was inoculated at 1% into 50 mL MS medium containing 20 g / L glucose, 2 g / L lauric acid and 2 g / L lactic acid. After culturing at 200 rpm and 30℃ for 72 hours, the bacterial cells were collected, and the cell dry weight and PHA content were detected. The results are shown in Table 10 below.

[0140] Table 10: Synthesis of P(3HB-co-LA-co-mclHA) materials by recombinant bacteria PEBA in MMG medium with different carbon sources

[0141] glucose 6.53±0.75 48.56±1.48 13.57±0.78 0 Lauric acid 3.58±0.88 22.15±3.86 1.64±0.38 87.42±3.19 glucose + lauric acid 5.95±2.36 62.36±1.46 8.72±1.56 33.67±1.08 Glucose + Lauric Acid + Lactic Acid 4.32±0.67 52.71±2.97 14.37±0.96 28.53±3.66

[0142] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0143] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

Claims

1. A method for producing poly(hydroxy fatty acids-) co Recombinant bacteria containing β-lactic acid, characterized in that, The genome of the recombinant bacteria contains a PHA synthesis gene and a lactic acid synthesis gene; The hydroxy fatty acid is 3-hydroxybutyric acid; The recombinant bacteria are Halomonas bluephagenesis ; The lactate synthesis genes are propionyl-CoA transferase encoding genes and PHA polymerase encoding genes, wherein the propionyl-CoA transferase encoding gene is SEQ ID NO: 8 and the PHA polymerase encoding gene is SEQ ID NO:

9.

2. A method for producing poly(hydroxy fatty acids-) co Recombinant bacteria containing β-lactic acid, characterized in that, The genome of the recombinant bacteria contains a PHA synthesis gene and a lactic acid synthesis gene; The hydroxy fatty acids are 3HB and 3-hydroxydodecano; The recombinant bacteria are Pseudomonas entomophila ; The lactate synthesis gene is a propionyl-CoA transferase encoding gene and a PHA polymerase encoding gene phaC1437, wherein the propionyl-CoA transferase encoding gene is SEQ ID NO: 8 and the PHA polymerase encoding gene phaC1437 is SEQ ID NO: 9; The PHA synthesis gene includes a β-ketothiolase encoding gene, an acetyl-CoA reductase encoding gene, and a PHA polymerase encoding gene phaC61-3. The β-ketothiolase encoding gene and the acetyl-CoA reductase encoding gene are derived from *Rhodotorula fragilis*. Ralstonia eutropha The PHA polymerase encoding gene phaC61-3 is SEQ ID NO: 10; Furthermore, the genes expressing 3-ketoacyl-CoA thiolytic enzyme, (S)-3-hydroxyacyl-CoA dehydrogenase, and 3-hydroxyacyl-CoA acyltransferase were knocked out in the recombinant bacteria.

3. The recombinant bacteria according to claim 1 or 2, characterized in that, The PHA synthesis gene and lactate synthesis gene are expressed on chromosomes or plasmids.

4. A method for constructing the recombinant bacteria according to claim 1, characterized in that, The construction method described includes overexpression of the PHA synthesis gene and the lactic acid synthesis gene in recombinant bacteria; The hydroxy fatty acid is 3-hydroxybutyric acid; The recombinant bacteria are Halomonas bluephagenesis ; The lactate synthesis genes are propionyl-CoA transferase encoding genes and PHA polymerase encoding genes, wherein the propionyl-CoA transferase encoding gene is SEQ ID NO: 8 and the PHA polymerase encoding gene is SEQ ID NO:

9.

5. A method for constructing the recombinant bacteria according to claim 2, characterized in that, The construction method includes overexpressing the PHA synthesis gene and the lactate synthesis gene in recombinant bacteria, and knocking out the gene encoding 3-ketoacyl-CoA thiolase, (S)-3-hydroxyacyl-CoA dehydrogenase, and 3-hydroxyacyl-CoA acyltransferase in the recombinant bacteria. The hydroxy fatty acids are 3HB and 3-hydroxydodecano; The recombinant bacteria are Pseudomonas entomophila ; The lactate synthesis gene is a propionyl-CoA transferase encoding gene and a PHA polymerase encoding gene phaC1437, wherein the propionyl-CoA transferase encoding gene is SEQ ID NO: 8 and the PHA polymerase encoding gene phaC1437 is SEQ ID NO: 9; The PHA synthesis gene includes a β-ketothiolase encoding gene, an acetyl-CoA reductase encoding gene, and a PHA polymerase encoding gene phaC61-3. The β-ketothiolase encoding gene and the acetyl-CoA reductase encoding gene are derived from *Rhodotorula fragilis*. Ralstonia eutropha The PHA polymerase encoding gene phaC61-3 is SEQ ID NO:

10.

6. A method for producing poly(hydroxy fatty acids-) co The method for (-lactic acid), characterized in that... The method includes fermenting and culturing the recombinant bacteria according to any one of claims 1-3.

7. The method according to claim 6, characterized in that, The culture medium for fermentation contains relevant carbon sources and / or unrelated carbon sources; The relevant carbon source is selected from one or more of the following: lactic acid, γ-butyrolactone, 4-hydroxybutyric acid, 1,2-butanediol, 1,3-butanediol, 1,4-butanediol, 1,6-hexanediol, 1,8-octanediol, 1,10-decanediol, 1,12-dodecanediol, propionic acid, valeric acid, or heptanoic acid. The unrelated carbon source is selected from one or more combinations of glucose, sodium gluconate, glycerol, acetic acid, hexanoic acid, xylose, cellulose, lactose, or fructose.

8. The use of a recombinant bacterium as described in any one of claims 1-3 or a recombinant bacterium obtained by the construction method as described in any one of claims 4-5 in the preparation of biodegradable new biomaterials.

Images