A method for regulating rice plant type by editing the promoter of rice OsD18 gene

Editing the promoter of the rice OsD18 gene using the CRISPR-Cas12a gene editing system solved the problem of a narrow genetic base in rice breeding, achieving a reduction in rice plant height and an improvement in plant type, while ensuring seed quality.

CN116240236BActive Publication Date: 2025-12-12UNIV OF ELECTRONICS SCI & TECH OF CHINA
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202211733523.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-30
Publication Date
2025-12-12
Estimated Expiration
2042-12-30

AI Technical Summary

Technical Problem

In current technologies, rice breeding mainly relies on the SD1 gene for dwarfing breeding, which has a narrow genetic base and makes it difficult to screen out new plant type genes with breeding value, thus affecting rice yield and stability.

Method used

The promoter of the rice OsD18 gene was edited using the CRISPR-Cas12a gene editing system. By designing specific crRNAs, a CRISPR-Cas12a gene editing vector was constructed to regulate the expression of the OsD18 gene, thereby reducing plant height and improving rice plant architecture.

Benefits of technology

This method significantly reduces rice plant height while maintaining seed size and weight, providing a simple and easy-to-implement method for improving rice plant architecture, and has promising application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116240236B_ABST
    Figure CN116240236B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of plant biotechnology, and particularly relates to a method for regulating rice plant type by editing the promoter of a rice OsD18 gene. The present application aims to provide a new option for improving rice plant type. The technical scheme of the present application is a method for regulating rice plant type by editing the promoter of a rice OsD18 gene, which comprises the following steps: s1, constructing a Cas gene editing expression vector for expressing a guide RNA for editing the promoter of a rice OsD18 gene; s2, transforming rice with the expression vector obtained in step s1 to obtain transformed plants by using a CRISPR-Cas gene editing system; s3, collecting seeds of the transformed plants, screening for gene editing mutant seeds, and obtaining gene edited rice with improved plant type.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant biotechnology, and particularly relates to a method for regulating rice plant type by editing the promoter of a rice OsD18 gene. BACKGROUND

[0002] Plant type is a key factor determining crop yield, and an ideal rice plant type should have moderate plant height, compact plant type, less tillering, no ineffective tillering, large panicles, more grains, and strong stems. The most important event in the history of improvement and application of excellent rice varieties in China is the dwarf breeding starting from 1956, namely the "first green revolution" of rice. Local rice varieties are basically high-stalk types, poor in fertilizer tolerance, and prone to lodging, resulting in stable yield problems. Therefore, it is very important to explore dwarf germplasm resources and breed dwarf varieties. In 1956, Chinese breeders bred the first dwarf early indica variety, Gauchangai, which is characterized by dwarf, more panicles, developed root system, and compact plant type. This variety shows excellent fertilizer tolerance and lodging resistance, and the harvest index is also greatly improved. In 1966, the International Rice Research Institute (IRRI) used the local variety Dee-geo-woo-gen from Taiwan Province and Peta to cross-breed and bred the semi-dwarf variety IRS, creating a yield miracle at that time. The breeding of Gauchangai and the introduction of IRS promoted the entry of Chinese rice breeding into the first "green revolution" era. The gene that determines this rice dwarf breeding is the SD1 gene. Until now, only SD1 has been applied in breeding. Narrow genetic basis, screening and developing new plant type genes with breeding value are of great significance to ensure China's food security. SUMMARY

[0003] The technical problem to be solved by the present application is to provide a new option for improving rice plant type.

[0004] The technical solution of the present application is a method for regulating rice plant type by editing the promoter of a rice OsD18 gene, comprising the following steps:

[0005] a. Constructing a Cas gene editing expression vector for expressing a guide RNA for editing the promoter of a rice OsD18 gene;

[0006] b. Transforming rice with the expression vector obtained in step a, and obtaining transformed plants using a CRISPR-Cas gene editing system;

[0007] c. Collecting seeds of the transformed plants, screening for gene editing mutant seeds, and obtaining gene edited rice with improved plant type.

[0008] Further, the guide RNA is at least one of crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), crRNA11 (SEQ ID No. 11), crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10), or crRNA12 (SEQ ID No. 12).

[0009] Preferably, the guide RNA is at least one of crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), and crRNA11 (SEQ ID No. 11); or at least one of crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10), and crRNA12 (SEQ ID No. 12).

[0010] Preferably, the Cas gene editing expression vector is a CRISPR-Cas12a gene editing expression vector.

[0011] Preferably, the Cas gene editing expression vector is a CRISPR-Cas12a gene editing expression vector.

[0012] Further, the CRISPR-Cas12a gene editing expression vector comprises a Cas12a expression unit driven by a maize ubiquitin promoter ZmUbi1 and a crRNA-scaffold expression unit driven by a rice ubiquitin promoter OsUbi1.

[0013] In particular, the crRNA-scaffold expression unit expresses at least one of crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), crRNA11 (SEQ ID No. 11), crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10) or crRNA12 (SEQ ID No. 12) in series.

[0014] The Cas gene editing expression vector further comprises a hygromycin resistance gene Hyg expression unit driven by a CaMV35S promoter.

[0015] Preferably, the crRNA-scaffold expression unit expresses a fragment as shown in SEQ ID No. 13 or SEQ ID No. 14.

[0016] The application also provides a guide RNA or a nucleic acid molecule capable of complementing therewith, wherein the guide RNA is at least one of crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), crRNA11 (SEQ ID No. 11), crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10) or crRNA12 (SEQ ID No. 12).

[0017] In particular, the guide RNA is at least one of crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), crRNA11 (SEQ ID No. 11), crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10) or crRNA12 (SEQ ID No. 12).

[0018] The application also provides the application of the guide RNA or the nucleic acid molecule complementary thereto in improving the plant type of rice.

[0019] In particular, the application in reducing the plant height of rice, ensuring the size and weight of rice seeds.

[0020] The application also provides a guide RNA vector for expression editing of the promoter of the rice OsD18 gene.

[0021] In particular, the guide RNA is at least one of crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), crRNA11 (SEQ ID No. 11), crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10) or crRNA12 (SEQ ID No. 12).

[0022] Preferably, the guide RNA vector for expression editing of the promoter of the rice OsD18 gene is a CRISPR-Cas12a gene editing expression vector, which comprises a crRNA-scaffold expression unit driven by a rice ubiquitin promoter OsUbi1.

[0023] Further, the CRISPR-Cas12a gene editing expression vector comprises a Cas12a expression unit driven by a maize ubiquitin promoter ZmUbi1 and a hygromycin resistance gene Hyg expression unit driven by a CaMV35S promoter.

[0024] Preferably, the crRNA-scaffold expression unit expresses the fragment shown in SEQ ID No. 13 or SEQ ID No. 14.

[0025] The application also provides an application of the vector for expressing the guide RNA for editing the promoter of the rice OsD18 gene in improving the plant type of rice.

[0026] In particular, the application in reducing the plant height of rice, ensuring the size and weight of rice seeds.

[0027] The genes for regulating plant type are mainly genes related to hormone signal pathways (biosynthesis / signal transduction pathways of gibberellin, brassinosteroid, strigolactone, etc.). In the full analysis of these pathway genes, the application selects editing materials and preferential editing sites that can regulate the expression amount by editing the promoter to obtain the ideal plant type. After editing the genes D18, D2, D11, SD1, etc., the application screens and obtains D18 as the most ideal gene for regulating plant height by promoter editing, and obtains the ideal editing site crRNA (guide RNA).

[0028] The application provides a method for improving the quality traits of rice, which is based on the CRISPR-Cas12a gene editing system to direct edit the promoter element of the OsD18 gene, regulate the expression of the OsD18 gene, and thus change the plant height and improve the plant type traits of rice. In the method, 12 specific crRNAs are designed and screened for the promoter of the OsD18 gene of rice, and two CRISPR-Cas12a gene editing vectors for specifically editing the promoter element of the OsD18 gene of rice are constructed based on the crRNAs. The method can efficiently knock out the promoter element of the OsD18 gene of rice, and the new materials with different plant heights are obtained after knocking out the promoter element of the OsD18 gene of rice (the plant height of 30 mutants among the obtained 31 mutants is significantly reduced; among them, the plant height of 6 mutants is reduced by less than 10%, the plant height of 17 mutants is reduced by 10%-20%, the plant height of 6 mutants is reduced by 20%-30%, and the plant height of 1 mutant is reduced by less than 30%), and the size and weight of rice seeds are not changed. The method has simple steps and is easy to operate, and has a good prospect in the plant type, genome function research and application of rice. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 . The CRISPR-Cas12a multi-site directed editing system is used to knock out the promoter element of the OsD18 gene of rice;

[0030] A, Schematic diagram of target site design of rice OsD18 gene promoter directed editing; ARE, TCA-element, CAT-box, MYC…, etc. are predicted as cis-regulatory elements; crRNA01-crRNA12 are promoter editing guide RNAs based on Cas12a system; sgRNA is a coding region editing guide RNA based on Cas9 system.

[0031] B, Schematic diagram of CRISPR-Cas12a multi-site targeted knockout vector design; LbCas12a: V-type CRISPR-Cas protein from Lachnospiraceae bacterium; pZmUbi1: maize ubiquitin promoter; pOsUbi1: rice ubiquitin promoter; HspT: Hsp gene terminator; NosT: Nos gene terminator; Hyg+: hygromycin resistance gene expression unit; HH: hammerhead ribozyme; HDV: hepatitis virus ribozyme; DR:

[0032] Guide RNA motif.

[0033] Figure 2 .CRISPR-Cas12a multi-site targeted knockout mutant T0 identification map (Note: light color number indicates that a large fragment deletion occurs in this single plant).

[0034] Figure 3 .OsD18 promoter directed editing mutant T1 homozygous plant height determination (black origin point: represents the measurement value of five repeated experiments; letter: indicates the difference between different data groups by Duncan test).

[0035] Figure 4 .Partial OsD18 promoter directed editing mutant T1 homozygous plant height (scale = 10 cm); Plant height: plant height.

[0036] Figure 5 .Partial OsD18 promoter directed editing mutant T2 generation seed size determination result graph (black origin point: represents the measurement value of repeated experiments; letter: indicates the difference between different data groups by Duncan test). Phenotype of seed length: seed length phenotype; Phenotype of seed width: seed width phenotype; Seed length: seed length; Seed width: seed width; 1000-grain weight: 1000-grain weight.

[0037] Figure 6 .OsD2 promoter directed editing mutant T1 homozygous plant height (scale = 10 cm).

[0038] Figure 7Figure 1 shows the results of measuring the size of T2 generation seeds of OsD2 promoter directed editing mutants (black dots represent repeated experimental measurements; letters indicate the differences between different data groups by Duncan's test). Seed length phenotype: seed length phenotype; Seed width phenotype: seed width phenotype; Seed length: seed length; Seed width: seed width; 1000-grain weight: 1000-grain weight.

[0039] Figure 8 Figure 1 shows the results of measuring the size of T2 generation seeds of OsD2 promoter directed editing mutants (black dots represent repeated experimental measurements; letters indicate the differences between different data groups by Duncan's test). Seed length phenotype: seed length phenotype; Seed width phenotype: seed width phenotype; Seed length: seed length; Seed width: seed width; 1000-grain weight: 1000-grain weight.

[0040] Figure 9 Figure 1 shows the results of measuring the size of T2 generation seeds of OsD2 promoter directed editing mutants (black dots represent repeated experimental measurements; letters indicate the differences between different data groups by Duncan's test). Seed length phenotype: seed length phenotype; Seed width phenotype: seed width phenotype; Seed length: seed length; Seed width: seed width; 1000-grain weight: 1000-grain weight. DETAILED DESCRIPTION

[0041] Based on the analysis of a large number of research work on the control of rice ideal plant type genes (OsD18, OsD2, OsD11, OsSD1, etc.) in the early stage of the application, the promoter of the rice OsD18 gene is edited by CRISPR-Cas12a genome editing technology, the expression of the gene is reduced, the plant height is reduced to different degrees, and the edited material and the preferred editing site of the ideal plant type are obtained.

[0042] First, the present application designs and screens 12 guide RNAs (crRNA) based on the analysis of each element of the promoter of the rice OsD18 gene (as shown in Figure 1 A). The expression vector capable of expressing the above crRNA is constructed, and the directional knockout vectors pZJP078 and pZJP079 (main expression units are shown in Figure 1 B) are preferably obtained. Among them, the backbone vector of the above expression vector is pTX377. In the examples of the present application, pTX377 is used as a backbone vector, and high-efficiency editing effect is achieved.

[0043] The inventors found that using the above gene editing system can efficiently obtain different editing mutants of the promoter of the rice OsD18 gene. And the edited material of the ideal plant type is obtained.

[0044] Therefore, the present application provides the application of the above-mentioned crRNA or expression vector in creating OsD18 gene promoter mutants and reducing the plant height of rice. Including the following steps:

[0045] a. Design and preferably crRNA, construct OsD18 gene promoter CRISPR-Cas12 gene editing expression vector;

[0046] b. Transform rice with the expression vector obtained in step a to obtain genetically transformed plants;

[0047] c. Screening and identification of the transformed plants obtained in b to screen out rice OsD18 gene promoter editing mutants.

[0048] d. Agronomic trait test of rice OsD18 gene promoter editing mutants to obtain the results of rice height-reducing mutants.

[0049] Specifically, the method for creating rice OsD18 gene promoter mutants in the technical scheme of the present application comprises the following specific steps:

[0050] (1) Selection of crRNA target site

[0051] The rice OsD18 gene (LOC_Os01g10040) is located on the first chromosome of the genome. According to the recognition and cutting rules of the CRISPR-Cas12 system for the target site, the target site is designed at the promoter region (-2000bp-0bp) of the OsD18 gene (see Figure 1 A). The crRNA sequence is shown as SEQ ID No. 1-SEQ ID No. 12, and the length of each crRNA is 23nt. The PAM site is TTTV.

[0052] (2) Construction of OsD18 gene promoter directed editing expression vector

[0053] crRNA01, crRNA03, crRNA05, crRNA07, crRNA09, crRNA11 are constructed into one vector, and crRNA02, crRNA04, crRNA06, crRNA08, crRNA10, crRNA12 are constructed into one vector (see Figure 1 B). The two crRNA fragments required to be expressed are synthesized in a biological company, and the sequences are shown as SEQ ID No. 13 and SEQ ID No. 14.

[0054] SEQ ID No. 13, SEQ ID No. 14 were assembled into vector pTX377 (Tang X, Lowder LG, Zhang T, Malzahn A, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y. 2017. A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nature Plants, 3: 17018) by Golden gate. The constructed recombinant vectors were transformed into E. coli DH5a competent cells, and single colonies were picked for PCR detection. The rice OsD18 gene promoter targeted editing vectors pZJP078 and pZJP079 were obtained, and the main expression units thereof were as shown in SEQ ID No. 1 and SEQ ID No. 2. Figure 1 B.

[0055] (3) Genetic transformation and genotype identification

[0056] The rice OsD18 gene promoter targeted editing expression vectors pZJP078 and pZJP079 were subjected to Agrobacterium-mediated genetic transformation of rice, screening, and regeneration of transformed plants. The genomic DNA of the regenerated rice seedlings was extracted, and the target fragment was amplified using specific primers Intron-F1 (primer sequence as shown in SEQ ID No. 15) and downstream primer ZY010-R1 (primer sequence as shown in SEQ ID No. 16) to detect transgenic positives. After single DNA extraction for positive identification, the specific primers OsD18-sscp-F1 (primer sequence as shown in SEQ ID No. 17) and OsD18-sscp-R1 (primer sequence as shown in SEQ ID No. 18) were used for PCR to screen mutants with large fragment deletion, which were verified by Sanger sequencing to obtain targeted knockout mutants with large fragment deletion. For mutants without large fragment deletion, homozygous mutants were screened in T1 generation for sequencing analysis.

[0057] (4) Analysis of agronomic traits of mutants

[0058] The agronomic traits (plant height, thousand-grain weight, seed size, etc.) of the OsD18 gene promoter targeted editing materials were determined. The present application is more specifically described below through detailed description of the examples.

[0059] The nucleotides involved in the following examples are as follows:

[0060] SEQ ID No. 1 designed crRNA01 sequence: uucaccaauuaauucucucuuuu

[0061] SEQ ID No. 2 designed crRNA02 sequence: cucuccaaaucuauuaauuaaug

[0062] SEQ ID No. 3 designed crRNA03 sequence: uguuguguagcuaagcugguggc

[0063] SEQ ID No. 4 designed crRNA04 sequence: cuauaacauaacuuaauuuguau

[0064] SEQ ID No. 5 designed crRNA05 sequence: acaggaacaguagcguccuccgu

[0065] SEQ ID No. 6 designed crRNA06 sequence: cuaagaagacuaaccuuauauua

[0066] SEQ ID No. 7 designed crRNA07 sequence: cucguggcugcagacuagugcug

[0067] SEQ ID No. 8 designed crRNA08 sequence: uaauguauuagcaaccauucaug

[0068] SEQ ID No. 9 designed crRNA09 sequence: ggcuacguacggcgccgcccugg

[0069] SEQ ID No. 10 designed crRNA10 sequence: aauauaaacaaauaauaaugcgg

[0070] SEQ ID No. 11 designed crRNA11 sequence: gcauaauaaucaacauuauuuug

[0071] SEQ ID No. 12 designed crRNA12 sequence: uguucucuuuguugagaugugag

[0072] SEQ ID No. 13 designed DNA fragment for the construction of vector pZJP078:

[0073] caccggtctc AAGAT ttcaccaattaattctctctttt TAATTTCTACTAAGTGTAGAT tgttgtgtagctaagctggtggc TAATTTCTACTAAGTGTAGAT acaggaacagtagcgtcctccgt TAATTTCTACTAAGTGTAGAT ctcgtggctgcagactagtgctg TAATTTCTACTAAGTGTAGAT ggctacgtacggcgccgccctgg TAATTTCTACTAAGTGTAGAT gcataataatcaacattattttgggccg GAGACCATCG

[0074] SEQ ID No. 14 DNA fragment designed and synthesized for construction of vector pZJP079:

[0075] caccggtctc AAGAT ttcaccaattaattctctctttt TAATTTCTACTAAGTGTAGAT tgttgtgtagctaagctggtggc TAATTTCTACTAAGTGTAGAT acaggaacagtagcgtcctccgt TAATTTCTACTAAGTGTAGAT ctcgtggctgcagactagtgctg TAATTTCTACTAAGTGTAGAT ggctacgtacggcgccgccctgg TAATTTCTACTAAGTGTAGAT gcataataatcaacattattttgggccg GAGACCATCG

[0076] AAGTGTAGAT ttaagaagactaaccttatatta TAATTTCTACTAAGTGTAGAT taatgtattagcaaccattcatg TAATTTCTACTAAGTGTAGAT tttctctttgttgagatgtgagggccg GAGACCAT

[0077] AGTGTAGAT ttttctctttgttgagatgtgagggccg GAGACCAT

[0078] CG

[0079] SEQ ID No. 15 Upstream primer for transgene positive detection Intron-F1 : TTCTGATCCTCTCCGTTCCT

[0080] SEQ ID No. 16 Downstream primer for transgene positive detection ZY010-R1 : AAGACCGGCAACAGGATTC

[0081] SEQ ID No. 17 Upstream primer sequence for mutant detection OsD18-sscp-F1 : gacaacgcactaggggtgatg

[0082] SEQ ID No. 18 downstream primer sequence for mutant detection OsD18-sscp-R1: gtggaatgagtagtaaagtgag

[0083] Example 1 Construction of rice OsD18 promoter editing vector

[0084] (1) crRNA design

[0085] The coding region and (-2000bp-0bp) promoter sequence of rice OsD18 gene were retrieved and downloaded from the database website NCBI (https: / / www.ncbi.nlm.nih.gov / ). Then the cis-elements were analyzed by the website (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). Then according to the recognition and cleavage rules of the target site of the CRISPR-Cas12 system, the crRNA was designed; then the optimal 12 crRNAs were selected by predicting the mismatch rate and off-target sites of the crRNA using the CRISPR RGENTools website online (http: / / www.rgenome.net / cas-offinder / ). Figure 1 A, SEQ ID No. 1-SEQ ID No. 12). crRNA01, crRNA03, crRNA05, crRNA07, crRNA09, crRNA11 were designed to construct a vector, and crRNA02, crRNA04, crRNA06, crRNA08, crRNA10, crRNA12 were designed to construct a vector (see Figure 1 B). Then two crRNA fragments needed to be expressed were synthesized by a biological company according to the enzyme cutting site of the knockout vector pTX377 used in the present application, and BsaI enzyme cutting sites were added at both ends, and the sequences are shown in SEQ ID No. 13 and SEQ ID No. 14, which were synthesized by Chengdu Qikexing Biological Company.

[0086] (2) Ligation reaction

[0087] The synthesized fragments SEQ ID No. 12, SEQ ID No. 13 were assembled to the backbone vector pTX377 by Golden gate, respectively. The Golden gate reaction system was: T4 DNA ligase 1 μL, T4 DNA ligase buffer (10x) 2 μL, pTX377 backbone vector plasmid 1 μL (100 ng / μL), restriction endonuclease BsaI 1 μL, synthesized fragment 2 μL, ddH2O 13 μL. The Golden gate reaction program was: (37℃ 5 min, 16℃ 10 min) 15 cycles, 37℃ 5 min, 85℃ 10 min.

[0088] (3) Plasmid transformation of E. coli competent bacteria

[0089] Take 10 μL of the ligation product and add it to the DH5α competent bacteria, mix gently, place on ice for 20 min, heat shock at 42℃ for 60-90 s, then place in ice bath for 4 min, add 350 μL of LB, and place in a constant temperature 37℃, 200 rpm shaker for about 40 min of culture. After the culture is complete, centrifuge at 4000 rpm for 5 min, then suspend the bacterial cells with the remaining supernatant, spread the bacterial solution on LB medium, and place in a constant temperature incubator at 37℃ for overnight culture.

[0090] (4) Colony PCR

[0091] Use a sterile toothpick to pick a single colony on the LB plate and place it in 50 μL of ddH2O water, take 5 uL of the bacterial solution as a template for PCR amplification. Use a 25 uL system, the system is as follows: 2x Taq DNA Polymerase Mix 10 μL, Intron-F 10.5 μL (SEQ ID No. 15), ZY010-R1 0.5 μL (SEQ ID No. 16) 0.5 μL, bacterial solution Template 5 μL, ddH2O 9 μL. The PCR program is: 95℃, 3 min→ (95℃, 30 s→ 58℃, 30 s→ 72℃, 30 s) 35 cycles→ 72℃, 5 min→ 12℃, 10 min (Taq DNA enzyme, dNTP, etc. purchased from Tiangen Biotech Co., Ltd.). After the PCR is completed, electrophoresis detection is performed in a 1% agarose gel at 130 V for 30 min.

[0092] (5) Plasmid extraction and sequencing verification

[0093] The correct monoclonal colonies were verified by colony PCR, 50 μL bacterial solution was inoculated in LB containing 50 mg / L Kan and shaken for 12-16 hours, and plasmid was extracted. The extraction of plasmid DNA was performed according to the instructions of AXYGEN AxyPrepTM Plasmid Miniprep Kit. The extracted plasmid was sent to Genescript Biotech Co., Ltd. for sequencing verification. The expression vectors pZJP078 and pZJP079 for targeted editing of the promoter of the rice OsD18 gene were obtained, and the schematic diagram of the T-DNA region structure thereof is shown in Figure 1 B.

[0094] Example 2 Agrobacterium-mediated genetic transformation of rice

[0095] The vectors pZJP078 and pZJP079 were transformed into Agrobacterium tumefaciens EHA105, respectively. The specific steps were as follows: the vectors pZJP078 and pZJP079 were added to the competent Agrobacterium tumefaciens EHA105, and then placed on ice for 30 min, followed by quick freezing in liquid nitrogen for 5 min, and then placed in a 37°C constant temperature water bath for 5 min, and then placed on ice for 5 min in an ice bath, and finally 1 mL of LB liquid medium was added, and cultured at 220 rpm and 28°C for 120-150 min, and then coated on LB solid medium containing rifampicin 50 mg / L and kanamycin 50 mg / L, and cultured at 28°C for 2 d. After the culture was completed, single colonies were picked and subjected to colony PCR positive verification (the method was the same as in Example 1), and then the Agrobacterium solution was expanded and cultured and stored for later use.

[0096] The experimental methods disclosed in the reference (Tang X, Ren Q, Yang L, Bao Y, Zhong Z, He Y, Liu S, Qi C, Liu B, Wang Y, Sretenovic S, Zhang Y, Zheng X, Zhang T, Qi Y, Zhang Y. 2019. Single transcript unit CRISPR 2.0 systems for robust Cas9 and Cas12a mediated plant genome editing. Plant Biotechnol J 17, 1431-1445.) were used.

[0097] The genetic transformation steps of rice are as follows: the mature seeds of rice (Nipponbare) are shelled and disinfected; the disinfected seeds are inoculated on N-6-D solid medium containing 0.4% gellan gum, and are cultured at 32°C under continuous light for 1-5 days; the cultured seeds are transformed into rice by Agrobacterium-mediated transformation method respectively with plasmids pZJP078 and pZJP079, and the transformed rice seeds are cultured in an induction and selection medium at 32°C under light for 2 weeks; the proliferated callus is transferred into RE-III medium; the young plants produced from the callus are transferred into HF medium to induce root production. When the obtained resistant regenerated seedlings grow to about 15 cm, the root medium is washed with water, and the seedlings are transplanted into nutrient soil and cultured in a greenhouse.

[0098] Example 3 Identification of rice OsD18 gene promoter editing mutant

[0099] (1) Extraction of rice seedling genomic DNA

[0100] The CTAB method is used for extracting rice seedling DNA, and the specific operation steps are as follows:

[0101] Fresh rice leaves with a length of about 2-3 cm are taken, placed in a 2 mL EP tube, and frozen with liquid nitrogen. After completion, the foam box is shaken vigorously, and the leaves are crushed by friction with steel balls. Then, 600 μL of CTAB is added, mixed, and placed in a 65°C water bath for heating for 30-45 min. After completion, 600 μL of chloroform is added and mixed, and then centrifuged at 8600 rpm for 10 min. The supernatant is moved to a 1.5 mL EP tube, 600 μL of dimethyl methyl alcohol is added and mixed, and then stored in a -20°C refrigerator for 1 h. Then, centrifuged at 12000 rpm for 10 min, the supernatant is removed, 500 μL of 75% alcohol is added, washed twice, and then dried by blowing. Finally, 50 μL of ddH2O is added to dissolve the DNA, and the solution is stored in a -20°C refrigerator for standby.

[0102] (2) Transgenic positive detection of rice seedlings

[0103] The specific primer Intron-F1 (the primer sequence is as shown in SEQ ID No. 15) and the downstream primer ZY010-R1 (the primer sequence is as shown in SEQ ID No. 16) are used to amplify the target fragment for transgenic positive detection. The PCR amplification system and reaction program are the same as those in the colony PCR of Example 1.

[0104] (3) Genotype identification of mutant

[0105] The positive plants obtained by detection were subjected to PCR with specific primers OsGBSS I-sscp-F1 (primer sequence as SEQ ID No. 17) and OsGBSS I-sscp-R1 (primer sequence as SEQ ID No. 18), and the PCR products were screened for large fragment deletion mutants on 1% agarose gel, and verified by Sanger sequencing. The results showed that 12 of the 32 single plants tested had large fragment deletions, with an efficiency of 37.5%. Figure 2 For mutants without large fragment deletions, homozygous mutants were screened in the T1 generation for sequencing analysis.

[0106] Example 4 Analysis of agronomic traits of mutants

[0107] (1) Determination of plant height of mutants

[0108] At the mature stage of the T1 generation homozygous mutants, the plant height of the mutants was determined, and the results( Figure 3 ) showed that compared with the control, the plant height of 30 of the 31 mutants obtained was significantly reduced. Among them, the plant height of 6 was reduced by less than 10%, that of 17 was reduced by 10-20%, that of 6 was reduced by 20-30%, and that of 1 was reduced by less than 30%. At the same time, some mutants were photographed( Figure 4 ), and it was found that the plant height of the OsD18 promoter edited mutants was between that of the wild type and the OsD18 coding region mutant d18-1 (directed knockout of the OsD18 gene coding region using the Cas9 system) and xiaowei (Hu, S. et al. Xiaowei, a new rice germplasm for large-scale indoor research. Mol Plant 11, 1418-1420 (2018)). Among the listed OsD18 promoter edited mutants, 3 mutants had plant height consistent with that of the semi-dwarf gene OsSD1 coding region mutant (reduced by 10-20% compared with the wild type).

[0109] (2) Determination of seed size

[0110] After the seeds were harvested, the seed size (length, width), thousand seed weight and other agronomic traits were analyzed. The results( Figure 5 ) showed that compared with the wild type, the length, width and thousand seed weight of the mutant seeds had no obvious difference. It was shown that editing the promoter of the OsD18 gene would not affect the seed size and thousand seed weight.

[0111] (3) Observation of agronomic traits of OsD2 and OsD11 promoter edited mutants

[0112] Meanwhile, by using similar method, for the promoters of the genes regulating plant height, OsD2 and OsD11, DNA fragments containing crRNAs for vector construction were designed and synthesized: SEQ ID No. 19 (for constructing vector pZJP074, against OsD2): cacttgccaattccattccattaTAATTTCTACTAAGTGTAGATgtggtacctgttgataaataggaTAATTTCTACTAAGTGTAGATa aggatatgtgtggatacaataaTAATTTCTACTAAGTGTAGATgttagtcacttaatatgaaaactTAATTTCTACTAAGTGTAGATt agagtatgtaataatgtaaattTAATTTCTACTAAGTGTAGATgtagaatataaattactttgcat;

[0113] SEQ ID No. 20 (for constructing vector pZJP075, against OsD2): tgggcgtgggccctacgcgtgtgTAATTTCTACTAAGTGTAGATataatgtaagagctattggtagtTAATTTCTACTAAGTGTAGATtaataattaatactcctgtacgcTAATTTCTACTAAGTGTAGATtaatacaaccaatgactaggatcTAATTTCTACTAAGTGTAGATtatgagcaggttaaggttgaaatTAATTTCTACTAAGTGTAGATaaattgcatttttaggtccctca;

[0114] SEQ ID No. 21 (used for constructing vector pZJP077, against OsD11): aaacaaggccaaagcaaggaaacTAATTTCTACTAAGTGTAGATggaaatgacacagatatgagtcaTAATTTCTACTAAGTGTAGATcttctctcaaatactccatccgtTAATTTCTACTAAGTGTAGATtagtatatatctagttgagttaTAATTTCTACTAAGTGTAGATtcggtggttttctaccgttagtgTAATTTCTACTAAGTGTAGATgtgaactaaagatggcacaaagc. By genetic transformation, mutant was screened, and the agronomic traits of the obtained mutant were observed. The results showed that although the plant height of the OsD2 gene promoter editing mutant was reduced ( Figure 6 ), the seed size and thousand seed weight were significantly reduced ( Figure 7 ). The plant height of the OsD11 gene promoter editing mutant was also reduced ( Figure 8 ), but the ear size and seed setting rate were extremely significantly reduced ( Figure 9 ). It is indicated that OsD2 and OsD11 are not ideal editing candidate genes for plant type. OsD18 is a candidate gene for ideal plant type.

Claims

1. A method for regulating rice plant architecture by editing the promoter of the rice OsD18 gene, characterized in that... Includes the following steps: a. Construct a Cas gene editing expression vector that expresses the guide RNA for editing the promoter of the rice OsD18 gene; the Cas gene editing expression vector is a CRISPR-Cas12a gene editing expression vector. b. Transform rice with the expression vector obtained in step a, and obtain transformed plants using the CRISPR-Cas gene editing system; c. Collect seeds of the transformed plants, screen out the gene-edited mutant seeds, and obtain gene-edited rice with improved plant type; The CRISPR-Cas12a gene editing expression vectors mentioned in step a are CRISPR-Cas12a gene editing expression vectors that can express guide RNAs: crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), and crRNA11 (SEQ ID No. 11); and CRISPR-Cas12a gene editing expression vectors that can express guide RNAs: crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10), and crRNA12 (SEQ ID No. 12d).

2. The method as described in claim 1, characterized in that: The CRISPR-Cas12a gene editing expression vector includes a Cas12a expression unit initiated by the maize ubiquitin promoter ZmUbi1 and a crRNA-scaffold expression unit initiated by the rice ubiquitin promoter OsUbi1.

3. The method as described in claim 2, characterized in that: The crRNA-scaffold expression unit tandemly expresses crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), and crRNA11 (SEQ ID No. 11); or tandemly expresses crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10), and crRNA12 (SEQ ID No. 12).

4. The method as described in claim 3, characterized in that, The crRNA-scaffold expression unit expresses the fragment shown in SEQ ID No. 13 or SEQ ID No.

14.

5. The method as described in claim 1, characterized in that: The Cas gene editing expression vector also includes a Hyg expression unit for the hygromycin resistance gene initiated by the CaMV35S promoter.

6. A vector for expressing guide RNA that edits the promoter of the rice OsD18 gene; wherein the vector is an expression vector capable of expressing the guide RNAs crRNA01 (SEQ ID No. 1), crRNA03 (SEQ ID No. 3), crRNA05 (SEQ ID No. 5), crRNA07 (SEQ ID No. 7), crRNA09 (SEQ ID No. 9), and crRNA11 (SEQ ID No. 11); Alternatively, the vector may be an expression vector capable of expressing guide RNAs: crRNA02 (SEQ ID No. 2), crRNA04 (SEQ ID No. 4), crRNA06 (SEQ ID No. 6), crRNA08 (SEQ ID No. 8), crRNA10 (SEQ ID No. 10), and crRNA12 (SEQ ID No. 12d).

7. The carrier as described in claim 6, characterized in that: The vector for expressing the guide RNA that edits the rice OsD18 gene promoter is a CRISPR-Cas12a gene editing expression vector, which includes a crRNA-scaffold expression unit initiated by the rice ubiquitin promoter OsUbi1.

8. The carrier as described in claim 7, characterized in that: The CRISPR-Cas12a gene editing expression vector includes a Cas12a expression unit initiated by the maize ubiquitin promoter ZmUbi1 and a hygromycin resistance gene Hyg expression unit initiated by the CaMV35S promoter.

9. The carrier as described in claim 7, characterized in that: The crRNA-scaffold expression unit expresses the fragment shown in SEQ ID No. 13 or SEQ ID No.

14.

10. The application of the carrier according to any one of claims 6 to 9 in improving rice plant type; wherein the improved rice plant type is used to reduce rice plant height while ensuring rice seed size and weight.

Citation Information

Patent Citations

  • High-throughput promoter variation creation method

    CN113061602A

  • Method for creating large and long grain type new germplasm or large and long grain type dwarf new germplasm of rice and application thereof

    CN115216488A

  • Method for regulating and controlling plant type of rice

    CN117802148A

  • Vegetative growth-specific promoter and genetically modified plants obtained thereby

    CN1494594A