A combined molecular marker for resistance to enterocytosis in Litopenaeus vannamei, KASP detection primers and their application

Abstract

The present invention discloses a combination molecular marker for the resistance to hepatocellular carcinoma of Penaeus vannamei, a KASP detection primer and an application thereof. The combination molecular marker is located upstream of the uncharacterized gene LOC113820209 in the genome of Penaeus vannamei. 358 Site and P 339 site, where P 358 The locus is a C / T type SNP marker, P 339 The site is a T / C type SNP marker. This combined molecular marker is detected using KASP technology. 358 Site and P 339 When the genotype combination of the locus is T / T and C / C, the resistance of Penaeus vannamei to hepatocellular carcinoma is stronger. 358 Site and P 339 When the genotype combination of the locus is other types, it is sensitive to hepatocystis. The combined molecular marker and KASP detection primer can be used to detect the genotype of the corresponding locus and to screen the breeding materials of Penaeus vannamei, which is of great significance for promoting the breeding of shrimp resistant to hepatocystis.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic animal breeding, and in particular relates to a combined molecular marker for hepatoenterozoa resistance traits of Penaeus vannamei, a KASP detection primer and an application thereof. Background Art

[0002] The seed industry is the "chip" of agriculture, and the vannamei shrimp seed industry is crucial to supporting the development of the entire shrimp farming industry. Vannamei shrimp, also known as white shrimp, is the largest farmed shrimp variety in my country and the world. In the past decade or so, my country's shrimp farming society and ecological environment have undergone significant changes. At the same time, disease outbreaks have occurred frequently, and the shrimp farming industry has suffered a major impact. Farmers' demand for shrimp farming varieties has changed from a single pursuit of growth rate to a demand for multiple traits such as disease resistance and growth. In the past decade or so, through the continuous efforts of Chinese scientists, 14 new varieties of white shrimp have been bred (as of December 2022), but the existing new varieties of vannamei shrimp all have outstanding traits in a single category, and most of them are growth, stress resistance or antiviral traits. There have been no reports on resistance breeding or new resistant varieties against other pathogen categories.

[0003] Enterocytosis hepatopancreatis (EHP), also known as "enteric epithelial cell sporozoan", was first discovered in 2003 and was isolated and named from the slow-growing Penaeus monodon in 2009. It mainly infects Penaeus monodon and Penaeus vannamei. Since 2012, it has begun to break out in Southeast Asia and China and has gradually become a global shrimp farming disease. Enterocytosis hepatopancreatis belongs to the kingdom of fungi and is an intracellular parasitic microsporidia. It mainly parasitizes the epithelial cells of the hepatopancreatic tubules and the intestinal epithelial cells of shrimp. The mature spores are oval and covered with a layer of spore wall. They have strong resistance to harsh environments. This feature leads to the widespread distribution of enterocytosis in shrimp farming environments. Once shrimp are infected, it is extremely difficult to remove them from the farming system. Infection of Penaeus vannamei with Enterocytosis does not lead to acute death. The disease course of the diseased shrimp is often long, which seriously affects the economic benefits of aquaculture. Currently, Enterocytosis is common in Penaeus vannamei farmed in my country. In terms of infection rate, Enterocytosis has become the most serious pathogenic species that endangers Penaeus vannamei aquaculture.

[0004] In summary, breeding shrimp with strong resistance to hepatoenteric cysts has very important economic significance. At present, there are no reports on breeding shrimp for resistance to hepatoenteric cysts infection at home and abroad. Molecular marker-assisted breeding refers to the method of mining molecular markers directly related to traits through QTL positioning or genome association analysis, and realizing direct selection of target traits, which can greatly improve the efficiency and accuracy of shrimp breeding. At present, there are no reports on mining molecular markers related to resistance to hepatoenteric cysts infection in shrimp. Competitive allele-specific PCR (KASP) is a genotyping technology based on conventional PCR and fluorescence detection. KASP technology has the advantages of low cost, accuracy, and rapidity. It can meet the needs of high-throughput genotyping in ordinary laboratories. Therefore, it has a good application prospect in the discovery of molecular markers and large-scale target genotype detection. So far, there has been no report on the use of KASP detection method in the detection method of shrimp molecular markers. Summary of the invention

[0005] The invention aims to provide a combined molecular marker related to the anti-hepatoenterozoan trait of Litopenaeus vannamei, a KASP primer combination for detecting the genotype of the molecular marker and the application thereof.

[0006] To achieve the above purpose, the present invention adopts the following technical solution

[0007] A molecular marker combination associated with resistance to hepato-enterozoa in Penaeus vannamei, located upstream of an uncharacterized gene LOC113820209 in the genome of Penaeus vannamei 358 Site (base 549245 of genome scaffold fragment NW_020870611.1) and P 339 Site (base 549264 of genome Scaffold fragment NW_020870611.1), where P 358 The locus is a C / T type SNP marker, P 339 The site is a T / C type SNP marker. 358 Site and P 339 When the genotype combination of the locus is T / T and C / C, the resistance of Penaeus vannamei to hepatocellular carcinoma is stronger. 358 Site and P 339 When the genotype combination of the loci was other types, Litopenaeus vannamei was sensitive to Enterocytosis.

[0008] The present invention also provides a primer set for amplifying the above molecular marker combination, wherein the primer set is composed of a detection P 358 Primer set for locus genotype and detection P 339 Primer set composition for locus genotype;

[0009] The detection P 358 The primer sets for locus genotyping are as follows:

[0010] 549245F1: GAAGGTGACCAAGTTCATGCT CGGTACAAGGAAAGGAACAGGGACC;

[0011] 549245F2: GAAGGTCGGAGTCAACGGATT CGGTACAAGGAAAGGAACAGGGACT;

[0012] 549245R: GGTAACTCCGTGCATCAACAAGACTGTAT;

[0013] The detection P 339 The primer sets for locus genotyping are as follows:

[0014] 549264F1: GAAGGTGACCAAGTTCATGCT GGGACCGTGTCTTATACAGTCTTGT;

[0015] 549264F2: GAAGGTCGGAGTCAACGGATT GGGACCGTGTCTTATACAGTCTTGC;

[0016] 549264R: CCATTTTCTGTTTTCTCGGTAACTCCGTGC.

[0017] The SNP site corresponding to the 3' end of the primer set 549245F1 / 549245F2 is the upstream P of the uncharacterized gene LOC113820209 of Penaeus vannamei. 358 Site (corresponding to the 101st nucleotide of SEQ ID NO.1 in the sequence listing), wherein the underlined portion of the 549245F1 primer is a FAM fluorescent specific label sequence, and the underlined portion of the 549245F2 primer is a HEX fluorescent specific label sequence.

[0018] The SNP site corresponding to the 3' end of the primer set 549264F1 / 549264F2 is the upstream P of the uncharacterized gene LOC113820209 of Penaeus vannamei. 339 Site (corresponding to the 120th nucleotide of SEQ ID NO.1 in the sequence listing), wherein the underlined portion of the 549264F1 primer is a FAM fluorescent specific label sequence, and the underlined portion of the 549264F2 primer is a HEX fluorescent specific label sequence.

[0019] The present invention also provides the use of the primer set in preparing a kit for detecting the resistance trait of hepatoenterozoa of Litopenaeus vannamei.

[0020] The present invention also provides a kit, which comprises the above primer set.

[0021] The present invention also provides the use of the above molecular marker combination, primer set or kit in molecular detection of hepatoenterozoan resistance traits of Litopenaeus vannamei.

[0022] The present invention also provides the application of the above molecular marker combination, primer set or kit in molecular genetic breeding of Penaeus vannamei.

[0023] Preferably, the method is used in the breeding of hepatocellular carcinoma resistance of Penaeus vannamei.

[0024] The present invention also provides a method for detecting the resistance trait of Penaeus vannamei to hepatoenterocystis, comprising the following steps:

[0025] (1) obtaining genomic DNA of a sample to be tested;

[0026] (2) using genomic DNA as a template and performing PCR amplification using the above primer set;

[0027] (3) Collect the fluorescent signals generated by each reaction well, determine the genotype of the molecular marker according to the type of fluorescent signal, and then determine the resistance of Penaeus vannamei to enterocytosis.

[0028] Preferably, P 358 Fluorescence detection of genotype at the locus:

[0029] If only FAM fluorescence is detected, then P 358 The locus is C / C homozygous genotype;

[0030] If only HEX fluorescence is detected, P 358 The locus is T / T homozygous genotype;

[0031] If both FAM and HEX fluorescence are detected, P 358 The locus is C / T heterozygous.

[0032] Preferably, P 339 Fluorescence detection of genotype at the locus:

[0033] If only FAM fluorescence is detected, then P 339 The locus is T / T homozygous genotype;

[0034] If only HEX fluorescence is detected, P 339 The locus is C / C homozygous genotype;

[0035] If both FAM and HEX fluorescence are detected, P 339 The locus is T / C heterozygous.

[0036] The present invention provides a combination molecular marker for the resistance to hepatocellular carcinoma of Penaeus vannamei, a KASP detection primer and its application. The combination molecular marker is located upstream of the uncharacterized gene LOC113820209 in the genome of Penaeus vannamei. 358 Site and P 339 site, where P 358 The locus is a C / T type SNP marker, P 339 The site is a T / C type SNP marker. This combination of molecular markers is detected using KASP technology, including 358 The three primer combinations for locus genotype and for detecting P 339 The three primer combinations for the locus genotype. 358 Site and P 339 When the genotype combination of the locus is T / T and C / C, the resistance of Penaeus vannamei to hepatocellular carcinoma is stronger. 358 Site and P 339 When the genotype combination of the locus is other types, it is sensitive to hepatocellular carcinoma. This combination of molecular markers and KASP detection primers can be used to detect P 358 Site and P 339 The locus genotype is used for the screening of breeding materials of Penaeus vannamei, which is of great significance for promoting the breeding of shrimp resistant to hepatocellular carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The results of fluorescence detection of genotypes at the P358 locus of 96 shrimps. Squares: individuals with T / T genotype; rounds: individuals with C / C genotype; triangles: individuals with T / C genotype.

[0038] Figure 2 The results of fluorescence detection of genotypes at the P339 locus of 96 shrimps. Squares: individuals with C / C genotype; rounds: individuals with T / T genotype; triangles: individuals with C / T genotype. DETAILED DESCRIPTION

[0039] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0040] Example 1

[0041] Obtaining molecular markers related to the resistance of Penaeus vannamei to enterocytosis.

[0042] (1) Sampling and trait grading of Penaeus vannamei

[0043] Shrimp samples from different farms and markets were collected, with 50 shrimps in each batch. The hepatopancreas was taken for semi-quantitative PCR detection of hepatopancreatic hepatopancreatic enterocytosis. The infection degree of hepatopancreatic enterocytosis of shrimps was distinguished by the carrying amount. Among the same batch of shrimps, the uninfected shrimps (PCR negative) were identified as having strong resistance to hepatopancreatic enterocytosis, and the rest were divided into mild infection, moderate infection, and severe infection according to the brightness of the bands detected by PCR. Among them, the proportion of uninfected shrimps in the same batch of shrimps was ≤5%. The sampling batches that did not meet this condition were eliminated, and a total of 75 samples with different infection degrees (EH) of hepatopancreatic enterocytosis were obtained. A similar method was used to obtain 75 samples graded by Vibrio infection degree (AB), 75 samples graded by growth traits (GW), and 75 samples graded by hepatopancreatic index (EI), totaling 300 samples.

[0044] (2) Whole-genome association analysis to identify SNPs associated with hepatocellular carcinoma traits

[0045] DNA was extracted from 300 samples, and conventional second-generation sequencing libraries were constructed and sequenced (Beijing Biomarker Biotechnology Co., Ltd.). The sequencing results were compared with the reference genome of Penaeus vannamei. GATK (V3.4.6) software was used to search for SNPs and InDels. SNP sites were filtered based on minor allele frequency and site integrity, and high consistency and confirmed SNP sites were retained. Combined with EMMAX software, a mixed linear model was used for association analysis, and Bonrroni correction was used for candidate sites in trait association analysis (Beijing Biomarker Biotechnology Co., Ltd.).

[0046] (3) Mining of molecular markers related to resistance to hepatocellular carcinoma

[0047] According to the P value of the SNP sites associated with the traits analyzed by GWAS, the unique SNP sites significantly associated with the resistance to hepatocellular carcinoma were screened, and the SNPs located in the promoter region of the gene and the SNPs causing amino acid coding mutations within the gene were screened. The results showed that 358 sites upstream of the uncharacterized gene LOC113820209 (P 358 ) and upstream 339 sites (P 339 ) was significantly correlated with resistance to hepatocellular carcinoma (P<0.05), P 358 and P 339 The difference is only 19 bases, all located in the upstream promoter region of the uncharacterized gene LOC113820209. 358 and P 339 The site and upstream and downstream sequences are shown in SEQ ID NO.1.

[0048] The sequence shown in SEQ ID NO.1 is as follows:

[0049] GAGGAAGGAGAAATTTCGCACTCTTTCAGTCAGGTATAGCGATGGTGAATAGTTGTGA

[0050] TGTTTCGTTGTGGTGTGGCGGTACAAGGAAAGGAACAGGGACCGTGTCTTATACAGTC

[0051] TTGTTGATGCACGGAGTTACCGAGAAACAGAAAATGGGTGGAGCTTAAGCATTACTCA

[0052] TTCTGACGTCATGGGCCCAGTCATGAACGATGCCAAAGGTCACTATTCGCTTAGATTGA

[0053] AAAAAAAAAAACGTTATAAACTTTTAACAGATAAAATATCATCAATTCGTTCTC

[0054] ATGATAATGATCAATCTCACCACATTATGCAGACGGATCTTTACTGAATAAATAAAACG

[0055] GAAAATCAAGTAAAATAATAATAAGTATACAAAGCAGGCAACCCACACGAAGAGA

[0056] TCGTTATCCCGTTGAATCCGCTGCTCATTCACATCAGTCTTCAGTTGTG TTT GTGATCCC

[0057] AAGGTGAAGAGACATACGTGCTTATTAATTTGATTATCATCACTATTTTTTTCTCTTTAAC

[0058] TGTATTCAAGTGCACCAGTTTACTTATTCTAATCGAATTTAAAAGAAAAAAGAA

[0059] AAACGTTTGTTGTGATAATGGTGAACCTCAAAACCGGATAAACAAGATAAGGATAAAA

[0060] AACACACAAAATCGTGTTTTTTCCGACGACTTTGGATTTATTTCTCCTTCGCCGCCC

[0061] GCAACCAACTACCCCCCTTCAGAATGGACGGCGACGCGGAGTGGGTGGGAGTGGACT

[0062] TTGGTGAGTCTCGTCGTCGACCGCCCATTGCAGCTCGTTAGCCCTCGTTGAGCTCTCACGTAACCTGACCACG.

[0063] GWAS analysis results showed that shrimp individuals with strong resistance to hepatocellular carcinoma (not infected) P 358 and P 339 The locus genotype was significantly correlated with the T / T and C / C genotype combinations. The genotype combinations of shrimp individuals susceptible to enterocytosis (mild infection, moderate infection, and severe infection) were other types of genotype combinations.

[0064] Example 2

[0065] Design of primers for detecting KASP molecular marker locus of hepatocellular carcinoma resistance trait of Penaeus vannamei.

[0066] Based on the upstream P of the uncharacterized gene LOC113820209 in Litopenaeus vannamei 358 and P 339 The upstream and downstream sequences of the site were used to design the KASP primer set.

[0067] Detection of P 358 The sequences of the primer combinations for the locus genotype are shown in SEQ ID NO.2-4, which are as follows:

[0068] 549245F1: GAAGGTGACCAAGTTCATGCT CGGTACAAGGAAAGGAACAGGGACC;

[0069] 549245F2: GAAGGTCGGAGTCAACGGATT CGGTACAAGGAAAGGAACAGGGACT;

[0070] 549245R: GGTAACTCCGTGCATCAACAAGACTGTAT;

[0071] The SNP site corresponding to the 3' end of primers 549245F1 / 549245F2 is upstream of the uncharacterized gene LOC113820209 in Litopenaeus vannamei. 358 site, wherein the underlined portion of the 549245F1 primer is a FAM fluorescent specific label sequence, and the underlined portion of the 549245F2 primer is a HEX fluorescent specific label sequence.

[0072] Detection of P339 The sequences of the primer combinations for the locus genotype are shown in SEQ ID NO.5-7, which are as follows:

[0073] 549264F1: GAAGGTGACCAAGTTCATGCT GGGACCGTGTCTTATACAGTCTTGT;

[0074] 549264F2: GAAGGTCGGAGTCAACGGATT GGGACCGTGTCTTATACAGTCTTGC;

[0075] 549264R: CCATTTCTTGTTTCTCGGTAACTCCGTGC.

[0076] The SNP site corresponding to the 3' end of primers 549264F1 / 549264F2 is upstream of the uncharacterized gene LOC113820209 in Litopenaeus vannamei. 339 site, wherein the underlined portion of the 549264F1 primer is a FAM fluorescent specific label sequence, and the underlined portion of the 549264F2 primer is a HEX fluorescent specific label sequence.

[0077] Example 3

[0078] KASP detection of KASP molecular marker loci for the hepatocellular carcinoma resistance trait of Penaeus vannamei.

[0079] The method for detecting the combined molecular marker KASP using the primer set designed in the above Example 2 comprises the following steps:

[0080] (1) Shrimp genome extraction

[0081] The ends of the shrimp appendages were cut or feces samples were taken, and the shrimp genomic DNA was extracted using the Marine Animal Genome Extraction Kit (Tiangen Biochemical, China).

[0082] (2) Preparation of KASP amplification system

[0083] P upstream of the uncharacterized gene LOC113820209 in Litopenaeus vannamei 358 and P 339 The KASP amplification system for site detection is shown in Table 1. Flu-Arms 2×PCR mix was purchased from Guangzhou Good Biotechnology Co., Ltd., and the primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0084] Table 1. KASP amplification system for detecting SNP sites in the shrimp genome

[0085] KASP components Dosage DNA template 20-100ng Flu-Arms 2×PCR mix 5μL Upstream F1 primer (10 μM) 0.1μL Upstream F2 primer (10 μM) 0.1μL Upstream R primer (10 μM) 0.1μL <![CDATA[ddH2O]]> Make up to a total volume of 10 μL

[0086] (3) KASP amplification procedure

[0087] Fluorescence quantitative PCR instrument (Tianlong TL988) was used for amplification. Amplification conditions: 95℃ pre-denaturation for 10min; 95℃ denaturation for 15sec, 61-55℃ annealing and extension for 60sec, 10 cycles, 0.6℃ lowered for each cycle; 95℃ denaturation for 15sec, 55℃ annealing and extension for 60sec, 35 cycles; 30℃ to end amplification.

[0088] (4) Plate reading test

[0089] After amplification, the PCR amplification products on the PCR plate were directly scanned. The excitation wavelength of FAM was 485 nm, the emission wavelength was 520 nm, the excitation wavelength of HEX was 528 nm, the emission wavelength was 560 nm, and the excitation wavelength of the system reference fluorescence ROX was 575 nm, the emission wavelength was 610 nm.

[0090] P 358 If only FAM fluorescence is detected in the amplification product of the site molecular marker, it is recorded as C / C genotype; if only HEX fluorescence is detected in the amplification product, it is recorded as T / T genotype; if both FAM and HEX signals are detected in the amplification product, it is recorded as C / T heterozygote.

[0091] P 339 If only FAM fluorescence is detected in the amplification product of the site molecular marker, it is recorded as T / T genotype; if only HEX fluorescence is detected in the amplification product, it is recorded as C / C genotype; if both FAM and HEX signals are detected in the amplification product, it is recorded as heterozygous T / C heterozygote.

[0092] Uncharacterized gene LOC113820209 upstream P 358 Site and P 339 The shrimp individuals with genotype combinations of T / T and C / C at the locus were judged to have strong resistance to infection with hepatocellular carcinoma, P 358 Site and P 339 Other genotype combinations of the loci were judged to be susceptible to Enterocytosis.

[0093] Example 4

[0094] Verification of KASP molecular marker for resistance to enterocytosis in Litopenaeus vannamei.

[0095] Different batches of shrimp were sampled, 50 in each batch, and the degree of resistance to hepatocellular carcinoma infection was graded using the method in Example 1. The proportion of uninfected shrimp in each batch was ≤5%. A total of 4 batches of shrimp met the requirements, and a total of 96 vannamei shrimp were sampled, with a body length of 9-11 cm. The results of the hepatocellular carcinoma infection detection of 96 shrimps are shown in Table 2. Among the 96 shrimps, 4 shrimps were detected to be uninfected with hepatocellular carcinoma.

[0096] Using the primer combination in Example 2 and the KASP detection method in Example 3, 96 shrimps were tested for P 339 Site and P 339 Locus genotype detection. 358 The results of site genotype fluorescence detection are as follows Figure 1 As shown, P 339 The results of site genotype fluorescence detection are as follows Figure 2 As shown. P of 96 shrimps 358 and P 339 The results of the site genotype detection are shown in Table 2. There were 3 shrimps with the above two site genotype combinations of T / T and C / C, and none of the 3 shrimps were infected with Enterocytosis.

[0097] Table 2. 96 tail shrimp P 358 and P 339 Site genotype detection and infection status detection

[0098]

[0099]

[0100]

[0101] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A primer set for amplifying a molecular marker combination associated with the resistance of Penaeus vannamei to hepatoenterozoa, characterized in that: The molecular marker combination related to the resistance to hepatoenterozoa of Penaeus vannamei is located upstream of the uncharacterized gene LOC113820209 in the Penaeus vannamei genome. 358 Site and P 339 site, the P 358 The site is located at the 549245th base of the Scaffold fragment NW_020870611.1 of the vannamei shrimp genome, and the base is C / T; the P 339 The site is located at the 549264th base of the Scaffold fragment NW_020870611.1 of the vannamei genome, and the base is T / C; When P 358 Site and P 339 When the genotype combination of the locus is T / T and C / C, the resistance of Penaeus vannamei to hepatocellular carcinoma is stronger. 358 Site and P 339 When the genotype combination of the loci was other types, Litopenaeus vannamei was susceptible to enterocytosis; The primer set is composed of detection P 358 Primer set for locus genotype and detection P 339 Primer set composition for locus genotype; The detection P 358 The primer sets for locus genotyping are as follows: 549245F1: GAAGGTGACCAAGTTCATGCT CGGTACAAGGAAGGAACAGGGACC; 549245F2: GAAGGTCGGAGTCAACGGATT CGGTACAAGGAAGGAACAGGACT; 549245R: GGTAACTCCGTGCATCAACAAGACTGTAT; The detection P 339 The primer sets for locus genotyping are as follows: 549264F1: GAAGGTGACCAAGTTCATGCT GGGACCGTGTCTTATACAGTCTTGT; 549264F2: GAAGGTCGGAGTCAACGGATT GGGACCGTGTCTTATACAGTCTTGC; 549264R: CCATTTCTTGTTTCTCGGTAACTCCGTGC.

2. Use of the primer set according to claim 1 in preparing a kit for detecting the resistance trait of hepatoenterozoa in Penaeus vannamei.

3. A kit, characterized in that: Comprising the primer set of claim 1.

4. Use of the primer set according to claim 1 or the kit according to claim 3 in molecular detection of resistance traits to enterocytosis in Litopenaeus vannamei.

5. Use of the primer set according to claim 1 or the kit according to claim 3 in molecular genetic breeding of Penaeus vannamei.

6. The use according to claim 5, characterized in that: It is used in the breeding of hepatocellular carcinoma resistance of Penaeus vannamei.

7. A method for detecting the resistance of Penaeus vannamei to hepatocellular carcinoma, characterized in that: The following steps are involved: (1) Obtaining genomic DNA of the sample to be tested; (2) using genomic DNA as a template and performing PCR amplification using the primer set described in claim 1; (3) Collect the fluorescent signals generated by each reaction well, determine the genotype of the molecular marker according to the type of fluorescent signal, and then determine the resistance of Penaeus vannamei to enterocytosis; P 358 Fluorescence detection of genotype at the locus: If only FAM fluorescence is detected, then P 358 The locus is C / C homozygous genotype; If only HEX fluorescence is detected, P 358 The locus is T / T homozygous genotype; If both FAM and HEX fluorescence are detected, P 358 The locus is C / T heterozygous; P 339 Fluorescence detection of genotype at the locus: If only FAM fluorescence is detected, then P 339 The locus is T / T homozygous genotype; If only HEX fluorescence is detected, P 339 The locus is C / C homozygous genotype; If both FAM and HEX fluorescence are detected, P 339 The locus is T / C heterozygous; When P 358 Site and P 339 When the genotype combination of the locus is T / T and C / C, the resistance of Penaeus vannamei to hepatocellular carcinoma is stronger. 358 Site and P 339 When the genotype combination of the loci is other types, it is sensitive to enterocytosis.

Images