Application of gene OsPIN10b in plant root elongation

Abstract

The application is a divisional application of 202011444476.6. The application relates to the field of plant growth and development molecular biology, in particular to the application of gene OsPIN10b in plant root elongation, the gene OsPIN10b has a nucleotide sequence shown in SEQ ID NO:1, and the application of the gene OsPIN10b in regulating the length of plant roots. By cloning the gene OsPIN10b, a transgenic vector is constructed, overexpression and knockout transgenic materials are obtained, the phenotype of the transgenic materials is measured, the root morphogenesis of different materials is significantly changed, the overexpression materials have the characteristics of increased root length and the like compared with the knockout transgenic materials and wild type materials, and it is indicated that the OsPIN10b gene plays an important regulating function in the development process of rice root elongation.

Description

[0001] The present patent application is a divisional application. The original application number is 202011444476.6, the application date is December 11, 2020, and the invention name is: Genetic engineering application of gene OsPIN10b. TECHNICAL FIELD

[0002] The present application relates to the field of molecular biology of plant growth and development, and in particular, to the application of gene OsPIN10b in plant root elongation. BACKGROUND

[0003] Auxin is the only plant hormone with unambiguous polar transport properties, which requires the assistance of import and export carriers to enter and exit the cell. AUX family proteins belong to import carriers, which affect the transport of auxin into the cell, while PIN family proteins belong to auxin export carriers, which are responsible for transporting auxin from the cell to the extracellular (Rutschow et al., 2014; Zhou et al., 2018). The auxin concentration gradient formed by the polar transport of auxin can affect many physiological processes of plants, including root growth and development and tropic growth (Woodward et al., 2005; Vanneste et al., 2009). The polar transport of auxin in plant tissues is largely due to the highly regulated and polarly localized PIN family proteins (Friml et al., 2002). In Arabidopsis, a total of 8 genes of the PIN family have been cloned (Benkova et al., 2003); 12 PIN homologous genes are predicted in rice (Wang et al., 2009); 12 PIN homologous genes have also been reported in maize (Forestan et al., 2012); and PIN homologous genes have also been found in soybean, wild cherry and poplar (Zazimalova et al., 2007). The auxin polar transport protein PIN1 is involved in the basipetal transport of auxin in the stem and the acropetal transport of auxin in the root (Blilou et al., 2005), so the up-regulation of PIN1 expression at the transcriptional and protein levels can promote the transport of auxin from the stem to the root tip, which may be one of the reasons for the increase of auxin in the root. PIN3 and PIN7 localized in the columella cells have the function of transporting auxin laterally and maintaining the auxin concentration gradient in this region (Petrásek et al., 2009; Ganguly et al., 2010), while PIN4 expressed in the quiescent center and cells below the root tip has the function of maintaining the auxin level and concentration gradient in this region and participating in the regulation of root tip meristem development (Friml et al., 2002). Therefore, PIN family genes play a very important regulatory role in the growth and development of rice. The functions of PIN family genes in rice need to be further discovered. SUMMARY

[0004] The rice OsPIN10b gene is homologous to PIN1 in Arabidopsis thaliana, encoding 592 amino acids with a molecular weight of 62.93124 KD. Transgenic lines obtained by cloning the OsPIN10b gene and ligating it into an overexpression vector revealed significant changes in root development, leaf angle, leaf length, and plant height. These changes manifested as increased root length, a significant decrease in the number of lateral roots, increased root angle, increased leaf angle, shorter leaf length, and decreased plant height. This indicates that the OsPIN10b gene plays an important regulatory role in the growth and development of rice roots, leaf angle, and plant height.

[0005] The first aspect of the present invention provides the following technical solution:

[0006] Genetic engineering application of gene OsPIN10b, wherein the gene OsPIN10b has the nucleotide sequence shown in SEQ ID NO:1, and the application of the gene OsPIN10b in regulating at least one trait of plant root development, leaf development, and plant height.

[0007] Furthermore, the root development includes any one or more of root length, root angle, and number of lateral roots;

[0008] The leaf development includes any one or both of leaf angle and leaf length.

[0009] This invention clones the OsPIN10b gene, constructs a transgenic vector, and obtains overexpressing and knockout transgenic materials. Phenotypic measurements of these materials revealed significant changes in root morphology. Compared to knockout transgenic materials and wild rice materials, the overexpressing materials exhibited several key characteristics: firstly, increased root length and angle, and a significant decrease in the number of lateral roots, indicating that the OsPIN10b gene plays a crucial regulatory role in rice root growth and development; secondly, significant changes in leaf angle and leaf length were observed in the overexpressing materials, with increased leaf angle and shorter leaf length compared to knockout and wild rice materials, suggesting that the OsPIN10b gene also plays an important regulatory role in rice leaf growth and development; and thirdly, significant phenotypic changes in plant height were also observed, with a significantly reduced plant height compared to knockout and wild rice materials, indicating that the OsPIN10b gene plays a vital role in the growth and development of rice plant height.

[0010] In addition, the tissue localization of the OsPIN10b gene was detected using transgenic materials. It was found that the OsPIN10b gene is expressed in germinating seeds, root pericycles, mature lateral roots, root-stem junctions, vascular bundles, leaf veins, young spikelets, anthers, and seeds during the grain-filling stage.

[0011] Furthermore, overexpression of the OsPIN10b gene promotes root elongation, reduces the number of lateral roots, increases root angle, increases leaf angle, shortens leaf length, and reduces plant height.

[0012] The gene OsPIN10b involved in this invention has a significant effect on plant root development, indicating that it is closely related to root development, particularly the length and angle of the longest seed root and the number of lateral roots. Therefore, in practical applications, overexpression of the gene OsPIN10b can be used to alter the length, angle, and number of lateral roots in plants.

[0013] The gene OsPIN10b involved in this invention has a significant effect on the development of leaf angle and leaf length in plants, indicating that the gene OsPIN10b is closely related to the development of leaf angle and leaf length in plants. Therefore, in practical applications, the purpose of altering the leaf angle and leaf length in plants can be achieved by overexpressing the gene OsPIN10b.

[0014] The gene OsPIN10b involved in this invention has a significant effect on plant height development, meaning that it is closely related to plant height development. Therefore, in practical applications, overexpression of the OsPIN10b gene can be used to alter plant height.

[0015] In this invention, the genetic engineering application of the gene OsPIN10b can be as a molecular marker for plant root development, leaf angle, leaf length, and plant height. That is, by detecting whether a plant expresses the gene OsPIN10b, the root development, leaf angle, leaf length, and plant height of the plant can be relatively described, thereby providing good technical support for plant breeding.

[0016] In this invention, the plants include monocotyledonous plants and dicotyledonous plants;

[0017] The monocotyledonous plants include rice, corn, and wheat;

[0018] The dicotyledonous plants include soybean, cotton, and tobacco.

[0019] The second aspect of the present invention provides a method for detecting plant root development, leaf angle, leaf length, and plant performance, wherein the expression of the gene OsPIN10b in the sample to be tested is detected to determine its root development, leaf angle, leaf length, and plant performance.

[0020] The root system development includes root length and angle, as well as the number of lateral roots.

[0021] This involves determining the root length and angle, number of lateral roots, leaf angle, leaf length, and plant height of the target plant by analyzing the expression of the OsPIN10b gene in the sample being tested.

[0022] The present invention can detect whether a sample contains the gene OsPIN10b in a variety of ways, such as directly detecting whether the gene OsPIN10b itself is present, or detecting the products produced by the gene OsPIN10b. The products include direct products, indirect products, or secondary products, etc. The products can be genes, proteins, or certain compounds, etc.

[0023] Direct detection of the OsPIN10b gene can be achieved using specific primer pairs for OsPIN10b, or by using probes or chips designed specifically for the OsPIN10b gene. Furthermore, the sample to be tested can be detected using primer pairs, probes, or chips for the OsPIN10b gene.

[0024] The primer pairs, probes, or chips targeting the OsPIN10b gene involved in this invention can be designed using conventional methods.

[0025] Furthermore, the nucleic acid sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0026] However, the methods for detecting the OsPIN10b gene itself are not limited to this; any method that is feasible in molecular biology is within the scope of protection of this invention.

[0027] Similarly, the products generated by the OsPIN10b gene can be detected by various means, such as a variety of ELISA test kits.

[0028] Furthermore, the sample to be tested includes materials suitable for tissue culture of sexually reproducing, asexually reproducing, or regenerable cells.

[0029] These samples to be tested can be materials suitable for sexual reproduction, such as pollen, ovary, ovule, embryo sac, etc.

[0030] Suitable materials for asexual reproduction include roots, stems, cuttings, protoplasts, etc.

[0031] Materials suitable for tissue culture of regenerable cells can be selected from leaves, pollen, meristematic cells, roots, root tips, seeds, embryos, cotyledons, hypocotyls, and stems.

[0032] Specifically, the sample to be tested includes any one of the following materials: leaves, roots, stems, radicles, plumules, and seeds.

[0033] Among them, plants include monocots and dicots; for example, monocots include rice, corn, and wheat; dicots include soybeans, cotton, and tobacco.

[0034] A third aspect of the invention also provides the application of the gene OsPIN10b in the study of genetic diversity in plant populations.

[0035] Among them, plants include monocots and dicots; for example, monocots include rice, corn, and wheat; dicots include soybeans, cotton, and tobacco.

[0036] Compared with the prior art, the beneficial effects of the present invention include at least the following aspects:

[0037] (1) Through systematic research, this invention provides the biological function of the gene OsPIN10b for the first time.

[0038] (2) By constructing overexpression and knockout materials of the OsPIN10b gene, this invention found that overexpression of the OsPIN10b gene has a significant effect on root length and angle, as well as the number of lateral roots, leaf angle, leaf length and plant height.

[0039] (3) The OsPIN10b gene provided by this invention can be applied to plant root development, leaf angle, leaf length and plant performance, and the plants involved include rice, corn, wheat, soybean, cotton, tobacco and so on. Attached Figure Description

[0040] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0041] Figure 1 This is a graph showing the molecular detection results of the OsPIN10b gene overexpression material in Example 1 of the present invention;

[0042] Figure 2 This is a schematic diagram of molecular detection of the OsPIN10b gene knockout material in Example 2 of the present invention;

[0043] Figure 3 The following are root phenotypic diagrams of the transgenic material and the wild-type material in the embodiments of the present invention;

[0044] Figure 4 This is a bar chart showing the root length statistics of transgenic materials and wild-type materials in the embodiments of the present invention;

[0045] Figure 5 This is a bar chart showing the number of adventitious roots in the transgenic material and the wild-type material in the embodiments of the present invention;

[0046] Figure 6This is a bar chart showing the plant height of transgenic materials and wild-type materials in the embodiments of the present invention;

[0047] Figure 7 This is a bar chart showing the root angle measurement results of transgenic materials and wild-type materials in the embodiments of the present invention;

[0048] Figure 8 The following are root phenotypic diagrams of the transgenic material and the wild-type material in the embodiments of the present invention;

[0049] Figure 9 This is a bar chart showing the statistical number of lateral roots of transgenic materials and wild-type materials in the embodiments of the present invention;

[0050] Figure 10 This is a bar chart showing the number of lateral roots per unit length in transgenic materials and wild-type materials in the embodiments of the present invention;

[0051] Figure 11 These are phenotypic diagrams of the mature stage of the transgenic material and the wild-type material in the embodiments of the present invention;

[0052] Figure 12 This is a bar graph showing the mature plant height of the transgenic material and the wild-type material in the embodiments of the present invention;

[0053] Figure 13 Phenotypic diagrams of the leaf angle at the four-week seedling stage for transgenic materials and wild-type materials in embodiments of the present invention;

[0054] Figure 14 This is a columnar diagram showing the angle between the four large seedling leaves of the transgenic material and the wild-type material in the embodiments of the present invention;

[0055] Figure 15 The images show the leaf length phenotypes of the transgenic material and the wild-type material at four weeks of seedling stage in the embodiments of this invention.

[0056] Figure 16 This is a columnar diagram of the leaf length of the four-week seedling stage for both the transgenic material and the wild-type material in the embodiments of the present invention. Detailed Implementation

[0057] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0058] Example 1

[0059] Obtaining genetically modified plants involves the following steps:

[0060] 1) Extraction of total RNA

[0061] Rice seeds of Nipponbare were disinfected with 30% NaClO, germinated, and cultured until they reached the two-leaf stage. Uniformly sized rice plants were selected, endosperm removed, and transplanted into a 1 / 2 pH 5.5 IRRI nutrient solution from the International Rice Research Institute. When the plants reached the four-leaf stage, the solution was replaced with the IRRI complete nutrient solution from the International Rice Research Institute (Mao D R. The methods of plant nutrition research. Beijing: Beijing Agricultural University Press, 1994). After one week of culture, roots and leaves were quickly frozen in liquid nitrogen. Approximately 0.1g of the sample was weighed, ground with liquid nitrogen, and added to a 1.5ml centrifuge tube. 1ml of Trizol reagent and 0.2ml of chloroform were added. After centrifugation, the supernatant was collected, and 0.5ml of isopropanol was added. After centrifugation, the supernatant was discarded. The precipitate was washed with 70% ethanol. RNA was dissolved in DEPC water (1‰ v / v). RNA quality was detected by 1.0% agarose gel electrophoresis, and the concentration and purity of total RNA were determined using a spectrophotometer. If you pass the test, proceed to the next step.

[0062] 2) Total cDNA synthesis

[0063] 2 μg of each RNA sample was added to 50 μmol·L⁻¹ -1 Oligo dT18 was added to a final volume of 10 μL with 1‰ DEPC water. The mixture was incubated at 70°C for 5 min, then placed on ice for 5 min. Next, 0.5 μL of RNase inhibitor, 5 μL of 5xRT buffer, 2.5 μL of 10 mM dNTPs, and 1 μL of M-MLV reverse transcriptase were added sequentially. The final volume was brought to 25 μL with 1‰ DEPC water. The mixture was incubated at 42°C for 60 min, then incubated at 70°C for 10 min to terminate the reaction. (Oligo dT18 was synthesized by GenScript Biotech in Nanjing; the reverse transcription kit was purchased from Fermentas, Canada.)

[0064] 3) Obtaining the full-length cDNA of the OsPIN10b gene

[0065] Using the total cDNA from Nipponbare rice obtained above as a template, PCR primers were designed. The PCR product contained the complete OsPIN10b reading frame (from the start codon ATG to TAG). The primer sequences are as follows:

[0066] OsPIN10b-F:5'-ATGATATCGTGGCACGAGC-3';

[0067] OsPIN10b-R:5'-TCATAGTAGCCCAAGAATAAT-3'

[0068] The PCR program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 56℃ annealing for 45 s, 72℃ annealing and extension for 2 min, 35 cycles, followed by 72℃ for 7 min. The amplified PCR product was detected by 1% agarose gel electrophoresis, and its size was a 1776 bp fragment. After separation by agarose gel electrophoresis, the target PCR product was excised and recovered. The recovered fragment was ligated into the P-easy blunt vector. The total volume of the enzyme ligation system was 5 μL (containing 1 μL of vector and 4 μL of purified PCR product). After adding the sample, the mixture was thoroughly mixed, centrifuged to the bottom of the tube, and incubated at 28℃ for 15 min.

[0069] The enzyme-linked immunosorbent assay (ELISA) system was heat-transferred into *E. coli* DH5α competent cells at 42°C. 500-700 μL of antibiotic-free LB broth was added and the cells were shaken for 1 hour. The cells were then centrifuged at low speed to enrich them, and the mixture was plated onto a plate containing 100 μg / mL kanamycin. -1 After growing on LB solid medium for 12-14 hours, positive colonies were picked for DNA sequencing. The accession number of the OsPIN10b gene was AK240660, and the full length of the open reading frame (ORF) of OsPIN10b was 1776 bp. The bacterial culture with correct sequencing was added to an equal volume of 50% glycerol and stored at -70℃ for later use. The P vector containing the OsPIN10b open reading frame was named pOsPIN10binP.

[0070] 4) Construction of the overexpression vector pUbi-OsPIN10b

[0071] Based on the cDNA sequence of the rice auxin transporter gene OsPIN10b, PCR primers were designed. The PCR product contains the complete OsPIN10b gene reading frame (from the start codon ATG to the stop codon TAG). Restriction endonuclease sites KpnI and SpeI were introduced into the upstream and downstream primers, respectively. The primer sequences are as follows:

[0072] overOsPIN10b-F: 5'-gaGGTACC ATGATATCGTGGCACGAGC-3'KpnI

[0073] overOsPIN10b-R:5'-atACTAGTTCATAGTAGCCCAAGAATAAT-3'SpeI

[0074] Using the pOsPIN10binP plasmid obtained above as a template, the PCR program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 56℃ annealing for 45 s, 72℃ annealing extension for 2 min, 35 cycles, followed by 72℃ for 7 min. The amplified PCR product was detected by 1% agarose gel electrophoresis, and the PCR product size was approximately 1800 bp. The target PCR product was separated by agarose gel electrophoresis and then recovered by gel excision. The recovered product was digested with restriction endonucleases KpnI and SpeI. Simultaneously, the plant overexpression vector pTCK303 plasmid was double-digested with KpnI and SpeI. The digested PCR fragment and vector were then recovered separately. The vector was dephosphorylated and recovered again. After recovery, the linearized vector and the digested PCR fragment were ligated using T4 ligase at 16℃ overnight. The ligation was then transformed into *E. coli* DH5α competent cells and plated onto a plate containing 50 μg / mL kanamycin. -1 After growing on LB solid medium for 12 hours, positive colonies were picked, and plasmids were extracted. After verifying the fragment size by KpnI and SpeI enzyme digestion, the bacterial culture was sequenced for DNA. The bacterial culture containing the correctly sequenced clone was added to an equal volume of 50% glycerol and stored at -70℃. The positive clone plasmid was extracted and named pUbi-OsPIN10b.

[0075] Finally, the pUbi-OsPIN10b plasmid was transformed into competent Agrobacterium tumefaciens EHA105 cells by electroporation, and the cells were plated on a substrate containing 50 μg / mL kanamycin and streptomycin. -1 After growing on YEP solid medium for 48 hours, positive colonies were picked, plasmids were extracted, and after double digestion with KpnI and SpeI to confirm that they were correct, the bacterial culture was added with an equal volume of 50% glycerol and stored at -70℃ for transgenic use.

[0076] 5) Obtaining transgenic plants

[0077] To avoid cytoplasmic gene mutations in plants during the transgenic process, we conducted transgenic experiments in different batches. From July to October 2018 and from December 2018 to February 2019, Agrobacterium carrying the pUbi-OsPIN10b plasmid obtained above was used to infect rice callus tissue, and cultured for 3 days. After selection, differentiation, rooting, and hardening of resistant callus tissue, T0 generation transgenic plants from different years and batches were obtained. To avoid changes in plant traits caused by cytoplasmic chimerism due to non-genomic insertion, we propagated all transgenic materials twice to obtain stably inherited T2 generation plants, and then performed physiological measurements on the stably inherited T2 generation materials.

[0078] The specific preparation of transgenic plants is as follows:

[0079] 5.1) Agrobacterium-mediated rice transformation

[0080] Callus induction: Peeled rice seeds (14 seeds per dish) are placed in an Erlenmeyer flask and soaked in 70% ethanol for 1 minute (enough to submerge the seeds). The 70% ethanol is then discarded, and the seeds are rinsed 5-6 times with sterile water. Next, the seeds are soaked in 30% sodium hypochlorite solution for 30 minutes, followed by rinsing with sterile water 5-6 times until the solution is clear. The seeds are then transferred to sterile filter paper with tweezers to absorb excess moisture. Finally, the seeds are placed on the induction medium and cultured in a 32℃ light incubator for 5 days.

[0081] Preparation of Agrobacterium: Agrobacterium strain EHA105 with the appropriate vector was streaked onto AB medium (50 mg / L Kan) and incubated in the dark at 28°C for 3 days. The Agrobacterium colonies were scraped off with a sterile spoon and resuspended in AAM medium (containing As), with an OD600 of approximately 0.1.

[0082] Infection and co-culture of callus: Pick rice callus from the subculture medium and place it into a centrifuge tube, ensuring the callus tissue covers the conical portion of the 50ml centrifuge tube (select pale yellow, round, and resilient callus tissue). Transfer 1ml of the cultured bacterial solution to a 1.5ml centrifuge tube, centrifuge at 5000rpm for 1 min at 4℃, and discard the supernatant. Use a solution containing 200μmol·L⁻¹... -1 Prepare a suspension of collected bacterial cells using 30 ml of acetylsylgenin (As) inoculation solution. Pour this suspension into the selected callus tissue and infect for 5 minutes. Discard the liquid, remove the callus tissue, and place it on a sterile culture dish lined with absorbent paper to drain for 30-40 minutes. Place the callus tissue on a co-culture medium (with a 9 cm layer of sterile filter paper on top) and incubate in the dark at 25°C for 3 days.

[0083] Bacterial washing and antibiotic screening culture: The callus tissue was removed from the co-culture medium and rinsed 5 times with sterile water, shaking continuously for 5 minutes each time. Then it was rinsed with a solution containing 500 mg / L... -1 Soak the callus tissue in sterile water with carbenicillin (CAR) for 40-60 minutes. Finally, drain on sterile filter paper for 2 hours. First round of screening: Transfer the dried callus tissue into a solution containing 400 mg / L... -1 Carbenicillin (CAR) and 50 mg / L -1 The first selection was carried out on hygromycin (Hyg) selective medium, and cultured at 32°C under light for two weeks;

[0084] Second round of screening: Vigorously growing callus was transferred to differentiation medium containing 50 mg / L hygromycin B and 250 mg / L carboxybenzyl to induce differentiation, and then continuously irradiated at 28°C for about two weeks.

[0085] Induction and rooting of resistant callus: Select bright yellow resistant callus and transfer it into a differentiation pot containing differentiation medium. Place it in a constant temperature culture room and wait for it to differentiate into seedlings (about 30 days, culture conditions in the tissue culture room are 24-30℃, 14h light / 8h dark). When the seedlings grow to about 5cm, place them in a rooting medium to strengthen them.

[0086] Hardening and transplanting of transgenic seedlings: Select test tubes with well-differentiated roots and stems (open the cap in time when the seedlings grow to the top of the test tube), open the sealing film, add an appropriate amount of sterile water (to prevent bacterial growth on the culture medium), harden the seedlings for about 3 to 7 days, then wash off the agar and transplant them to a greenhouse for hydroponic or soil culture for growth and testing.

[0087] 5.2) Rapid detection of hygromycin to obtain T0 generation plants from transgenic seedlings

[0088] Cut and collect fresh green leaves about 1 cm long from the seedlings to be tested (leaving cuts at both ends), and lay them flat on a container containing hygromycin (80 mg / L). -1 On culture medium, plants whose leaves remained bright green after 16h / 8h (light / dark) incubation for 48h at 30℃ were considered positive, while negative seedlings showed patchy necrosis of leaves (Zheng Ye. Establishment and Application of High-Efficiency Transgenic Rice System. 2008). Sixty positive T0 lines were obtained through hygromycin screening. From April to November 2019, T0 generation seeds were obtained by planting the overexpression material in the greenhouse of Henan Agricultural University.

[0089] 5.3) Molecular identification of OsPIN10b overexpression lines

[0090] After germination of T0 generation seeds, T1 generation transgenic seedlings were obtained. RNA was extracted from the flag leaves of both the transgenic material OX-OsPIN0b and the wild-type material Nipponbare at the tillering stage. After reverse transcription, qRT-PCR was performed for quantitative PCR identification. The results are as follows: Figure 1 As shown, stable genetically inherited OX-12, OX-19, and OX-20 transgenic lines were obtained.

[0091] Example 2

[0092] Obtaining OsPIN10b gene knockout plants:

[0093] 1) Selecting the target:

[0094] Based on the NCBI OsPIN10b gene sequence, two target sites were designed at the first exon of the gene.

[0095] Target 1:gaggacgccccaccaccgcacgg

[0096] Target 2: gccggagtaagggccgtacatgg

[0097] 2) Constructing an intermediate carrier

[0098] 2.1 Synthesis of intermediate vector primers

[0099] KOOsPIN10b-Y1 primers:

[0100] KOOsPIN10b--Y1+:cagtGGTCTCatgcagaggacgccccaccaccgca

[0101] KOOsPIN10b--Y1-:cagtGGTCTCaaaactgcggtggtggggcgtcctc

[0102] KOOsPIN10b--B1 primer:

[0103] KOOsPIN10b--B1+:cagtGGTCTCatgcagccggagtaagggccgtaca

[0104] KOOsPIN10b--:cagtGGTCTCaaaactgtacggcccttactccggc

[0105] The primers were denatured and annealed to obtain the gRNA fragment. The PCR reaction system was as follows: 5 μl of each of the forward and reverse primers, and 40 μl of water was added to bring the total volume to 40 μl. The PCR reaction program was as follows: denaturation at 95℃ for 10 min, annealing at 55℃ for 10 min, and cooling at 14℃ for 5 min.

[0106] 2.2 Enzyme digestion and ligation to construct intermediate vector

[0107] The KOOsPIN10b-Y1 restriction enzyme digestion and ligation system is as follows: gRNA fragment: 2 μl; empty vector 1 (pBWA(V)hu-cas9yl): 1.5 μl; ECO31I: 0.5 μl; T4-ligase: 0.5 μl; T4-buffer: 1 μl; H2O: 4.5 μl

[0108] The KOOsPIN10b--B1 restriction enzyme digestion and ligation system is as follows: gRNA fragment: 2 μl; empty vector 2 (pBWD(LB)DNAi): 1.5 μl; ECO31I: 0.5 μl; T4-ligase: 0.5 μl; T4-buffer: 1 μl; H2O: 4.5 μl

[0109] Place the prepared system in a 37°C incubator and react for 2 hours.

[0110] The ligation system was transformed into *E. coli* DH5α competent cells, and positive colonies were picked. Plasmids were extracted and sequenced. The correctly sequenced plasmids were named KOOsPIN10b Y1-1 and KOOsPIN10b B1-1, respectively.

[0111] 3) Construct dual-target enzyme digestion ligation

[0112] The correctly sequenced plasmid was used for dual-target enzyme digestion and ligation. The enzyme digestion and ligation system was as follows: KOOsPIN10b Y1-1 (plasmid): 1 μl; KOOsPIN10b B1-1 (plasmid): 1.5 μl; LguI: 0.5 μl; T4-ligase: 0.5 μl; T4-buffer: 1 μl; H2O: 5.5 μl. The prepared system was incubated at 37℃ for 2 h, and after transformation, bacterial testing was performed. The bacterial testing system was as follows: 2*Mix: 10 μl; pyl-R (forward detection primer): 1 μl; Pbw2- (reverse detection primer): 1 μl; H2O: 8 μl. The bacterial testing primer sequences were as follows: pyl-R: accggtaaggcgcgccgtagt; Pbw2-: gcgattaagttgggtaacgccaggg. Bands with a size of approximately 1000 bp were picked, cultured, plasmids were extracted, and sequenced after enzyme digestion verification. The correct plasmid was named Pyl-HU-OsPIN10b. It was transformed into Agrobacterium, and the positive Agrobacterium was used to infect rice callus to obtain OsPIN10b gene knockout material. The transformation steps were the same as in Example 1.

[0113] 4) Identification of gene knockout materials

[0114] DNA was extracted from leaves of transgenic and wild-type Nipponbare seedlings. Forward and reverse primers were designed at both ends of the target sites (target 1: gggacgccccaccaccgcacgg; target 2: gccggagtaagggccgtacatgg). The primers were KO-OsPIN10b-F: CAACACACTAATCGCACGCT

[0115] KO-OsPIN10b-R:ACGAGCTGATCGAGTAGATCTC

[0116] The PCR amplification products were subjected to Sanger sequencing, and the sequencing results were compared with those of the Nipponbare amplification products to determine whether the gene knockout was successful.

[0117] Test results as follows Figure 2 As shown.

[0118] To avoid changes in plant traits caused by cytoplasmic chimeras resulting from non-genomic insertions, all obtained T0 generation transgenic knockout plants were propagated twice to obtain stably inherited T2 generation plants, and physiological measurements were performed on the stably inherited T2 generation materials.

[0119] Test case

[0120] 1. T2 generation transgenic materials and wild-type materials were sterilized and germinated at 28°C for one day, followed by 16 hours of light and 8 hours of darkness, and then cultured at 28°C for five days. Root phenotypes at the seedling stage were then analyzed using a root scanner. Eight replicates were performed for each line. Results are shown below. Figures 3-6 As shown.

[0121] from Figures 3-5 It can be seen that the number of adventitious roots in the T2 generation OsPIN10b gene overexpression materials (OX-12, OX-19, OX-20) did not change significantly compared with the wild type (Nipponbare), but the length of the longest seed root increased significantly. Figure 3 and Figure 6 It can be seen that the plant height of the short-term cultured T2 generation OsPIN10b gene overexpression materials (OX-12, OX-19, OX-20) did not change significantly compared with the wild type (Nipponbare).

[0122] right Figure 3 The angle of the longest seed root from the vertical direction was measured using a protractor, and the result is as follows: Figure 7 As shown. From Figure 7 It can be seen that the root angles of the overexpressed materials (OX-12, OX-19, OX-20) were significantly greater than those of the wild type (Nipponbare) and the knockout materials (KO-42, KO-31, KO-42). This indicates that the OsPIN10b gene has a significant effect on the angle of seed roots.

[0123] 2. The longest seed root in the above materials was stripped and further tested.

[0124] The results are as follows Figures 8-10 As shown.

[0125] Figure 9 The table shows the number of lateral roots in the longest seed root for each sample. From... Figure 8 and Figure 9 It can be seen that the number of lateral roots in OsPIN10b overexpression materials (OX-12, OX-19, OX-20) is significantly reduced compared to wild type (Nipponbare) and knockout materials (KO-42, KO-31, KO-42).

[0126] The number of lateral roots per unit length was calculated, and the results are as follows: Figure 10As shown, at the longest seed root per unit length, the number of lateral roots in OsPIN10b overexpression materials (OX-12, OX-19, OX-20) was significantly less than that in wild-type (Nipponbare) and knockout materials (KO-42, KO-31, KO-42). Among them, the knockout materials (KO-42, KO-31, KO-42) had an increase compared to the wild-type.

[0127] The above information indicates that the OsPIN10b gene has a significant impact on the number of lateral roots.

[0128] In this invention, the seed root develops from the radicle, the adventitious roots emerge from the root-stem junction (stem base), and the lateral roots originate from specific pericycle cells.

[0129] 3. Statistical analysis of agronomic traits at rice maturity

[0130] Thirty-five days after flowering, the plant height of T2 generation OsPIN10b transgenic and overexpression materials planted in the field was statistically analyzed. The plant height of the aboveground parts was measured using a meter stick, with eight replicates for each line.

[0131] The results are as follows Figures 11-12 As shown.

[0132] Figure 12 The results showed that the OsPIN10b overexpression materials (OX-12, OX-19, OX-20) had significantly lower plant heights compared to the wild type (Nipponbare) and knockout materials (KO-22, KO-31, KO-42).

[0133] 4. Analyze the leaf angle of overexpression and knockout materials.

[0134] T2 generation transgenic materials and wild-type materials from Nipponbare were sterilized and germinated at 28°C for one day, followed by 16 hours of light and 8 hours of darkness, and cultured at 28°C for four weeks. The angle of the second fully unfolded leaf from the top off the vertical direction was measured using a protractor, with eight replicates for each line. Results are as follows: Figure 13 and Figure 14 The results showed that the leaf angle of OsPIN10b overexpression materials (OX-12, OX-19, OX-20) was significantly increased compared with that of wild type (Nipponbare) and knockout materials (KO-22, KO-31, KO-42).

[0135] 5. Analysis of the leaf length of the sword-shaped leaves of the overexpression and knockout materials.

[0136] T2 generation transgenic materials and wild-type materials from Nipponbare were sterilized and germinated at 28°C for one day, followed by 16 hours of light and 8 hours of darkness, and cultured at 28°C for four weeks. The length of the first fully unfolded leaf from the top was measured with a ruler, with eight replicates for each line. Results are as follows: Figures 15-16The results showed that the leaf length of OsPIN10b overexpression materials (OX-12, OX-19, OX-20) was significantly shorter than that of wild type (Nipponbare) and knockout materials (KO-22, KO-31, KO-42).

[0137] In summary, the OsPIN10b gene has a significant impact on root development, plant height, leaf angle, leaf length, and leaf length.

[0138] The reagents and solutions involved in this invention are as follows:

[0139] 1. Induction culture medium

[0140]

[0141] Sterilize at pH 5.8 and 115℃ for 20 minutes.

[0142] 2. Co-culture medium

[0143]

[0144] Sterilize at pH 5.2 and autoclave at 115℃ for 20 minutes.

[0145] 3. Select culture medium

[0146]

[0147]

[0148] Sterilize at pH 5.8 and 115℃ for 20 minutes.

[0149] 4. Differentiation culture medium

[0150]

[0151] Sterilize at pH 5.8 and 115℃ for 20 minutes.

[0152] 5. Rooting medium

[0153]

[0154]

[0155] Sterilize at pH 5.8 and 115℃ for 20 minutes.

[0156] 6. AAM culture medium

[0157]

[0158] Sterilize at pH 5.2 and autoclave at 115℃ for 20 minutes.

[0159] 7. AB medium

[0160]

[0161]

[0162] Sterilize at pH 7.2 and autoclave at 115℃ for 20 minutes.

[0163] 8. Culture medium stock solution formula:

[0164] N6 Macroelements (20X)

[0165]

[0166] Dissolve each of the above reagents one by one, then dilute to volume with distilled water at room temperature, label the preparer and preparation date, and store at 4℃.

[0167] N6 Trace Elements (1000X)

[0168]

[0169] Dissolve the above reagents at room temperature and dilute to volume with distilled water. Label the preparer and preparation date, and store at 4°C.

[0170] N6 organic compounds (100X)

[0171]

[0172] Add distilled water to make up to volume, label the preparer and preparation date, and store at 4°C for no more than 1 month.

[0173] MS Large Elements (20X)

[0174]

[0175] Dissolve each of the above reagents one by one, then dilute to volume with distilled water at room temperature, label the preparer and preparation date, and store at 4℃.

[0176] MS Trace Elements (1000X)

[0177]

[0178] Dissolve the above reagents at room temperature and dilute to volume with distilled water. Label the preparer and preparation date, and store at 4°C.

[0179] MS organic matter (100X)

[0180]

[0181] Add distilled water to make up to volume, label the preparer and preparation date, and store at 4°C for no more than 1 month.

[0182]

[0183]

[0184]

[0185]

[0186]

[0187] For the iron salt (100X): Dissolve 3.73g of disodium ethylenediaminetetraacetate (Na2EDTA·2H2O) and 2.78g of FeSO4·7H2O separately, mix them together, and use them together. Make up to 1000ml with distilled water, incubate at 70℃ for 2 hours, cool, label with the preparer and preparation date, and store at 4℃.

[0188] 50mg / ml Myo-Inositol: Add 5g of myo-inositol to 100ml of distilled water, label with the concentration, preparer, and preparation date, and store at 4℃.

[0189] 5mg / ml copper sulfate (CuSO4·5H2O): 0.5g CuSO4·5H2O, bring the volume to 100ml, label the concentration, preparer, and preparation date, and store at 4℃.

[0190] 5 mg / ml cobalt chloride (CoCl2·6H2O): 0.5 g CoCl2·6H2O, bring the volume to 100 ml, label the concentration, preparer, and preparation date, and store at 4℃.

[0191] 2,4-D (1 mg / ml): Place 100 mg of 2,4-D in a 100 ml beaker, add 20 ml of water, then add 3 ml of 1 N KOH. After it is completely dissolved, add water to make up to 100 ml. Label the concentration, the person who prepared it, and the preparation date. Store at 4 °C.

[0192] KT (1mg / ml): Place 100mg Kinetin (KT for short) in a 100ml beaker, add 20ml of water, then add 5ml of 1N HCl. After it is completely dissolved, add water to make up to 100ml. Label the concentration, the person who prepared it, and the preparation date. Dispense and store at -20℃.

[0193] NAA (1mg / ml): Place 100mg NAA in a 100ml beaker, add 20ml of water, then add 3ml of 1N KOH. After it is completely dissolved, add water to make up to 100ml. Label the concentration, the person who prepared it, and the preparation date. Store at 4℃.

[0194] 1N KOH: Dissolve 5.6g KOH in 100ml of water, label the concentration, preparer, and preparation date, and store at room temperature.

[0195] 1N NaOH: Dissolve 4g NaOH in 100ml of water, label the concentration, preparer, and preparation date, and store at room temperature.

[0196] 1N HCl: Add water to 12.5ml of concentrated hydrochloric acid and dilute to 100ml. Label the concentration, preparer, and preparation date. Store at room temperature.

[0197] Kan (50mg / ml): Dissolve Kanamycin (abbreviated as Kan) in sterile water at a concentration of 50mg / ml, filter to sterilize, label with the concentration, preparer, and preparation date, and store at -20℃.

[0198] Rif (50 mg / ml): Prepare a 50 mg / ml stock solution of rifampicin (Rif) using DMSO, label the concentration, preparer, and preparation date, and store at -20℃.

[0199] Cb (500mg / ml): Dissolve 1g of carbenicillin in 2ml of sterile water in a clean bench, filter to sterilize, label with the concentration, preparer, and preparation date, and store at -20℃.

[0200] AS (100mM): Dissolve 0.196g AS in 10ml DMSO, divide into 1ml tubes, label with concentration, preparer, and preparation date, and store at -20℃.

[0201] The abbreviations used in the culture medium in this invention are as follows: Cb (Carbenicillin); NAA (Napthalene acetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid); AS (Acetosringone); CH (Casein Enzymatic Hydrolysate); L-pro (L-proline); L-Glu (L-glutamine); MES (2-(N-Morpholino)EthaneSulfonic Acid); N6 (N6 macro-element solution); B5 (B5 micro-element solution).

[0202] Although the invention has been illustrated and described with reference to specific embodiments, it should be understood that many other changes and modifications can be made without departing from the spirit and scope of the invention. Therefore, it is intended that all such changes and modifications falling within the scope of the invention be included in the appended claims.

Claims

1. Application of gene OsPIN10b in plant root elongation, wherein the gene OsPIN10b has the nucleotide sequence shown in SEQ ID NO:1, and the application is the application of overexpressing gene OsPIN10b in promoting root elongation of rice seeds.

Images