Argonaute-mediated strand displacement exponential amplification method and application

Abstract

The application provides an Argonaute-mediated chain displacement exponential amplification method and application. First, TtAgo enzyme is specifically recognized and cut under the guidance of gDNA, the cutting site is located in the complementary fragment formed by gDNA and a target gene or a DNA fragment, a pair of amplification primers are extended to form a double strand under the action of a polymerase, the double strand is continuously recognized and cut by the protein due to the existence of the cutting site, and the single strand replaced can be used as a substrate of cycle two; the sequence replaced in the extension process of cycle one can be combined with the amplification primer in a complementary manner and is extended under the action of the polymerase, the product extended also has a cutting site, and a single strand formed under the action of TtAgo enzyme can continue to be used as a substrate of cycle two to participate in the cycle. The application realizes efficient amplification, significantly shortens the time required for the amplification reaction, and gradually detects in the amplification process, thereby realizing significant distinction of single-base differences on DNA.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, and specifically relates to an Argonaute-mediated strand substitution index amplification method, which is applied to the detection of single-base mutations in genes. Background Technology

[0002] Molecular diagnostics has entered a new stage of precision and personalization. Analyzing changes in gene structure or expression levels using molecular diagnostic techniques can aid in the accurate diagnosis of diseases, providing a reliable basis for developing individualized treatment plans, assessing treatment effectiveness, and managing patient prognosis. Because the concentration of the target gene in biological samples is often very low, efficient nucleic acid amplification methods are needed to improve detection sensitivity.

[0003] Nucleic acid amplification technology is commonly used for the detection of nucleic acid biomarkers, including proto-oncogenes and viral genetic material. Highly efficient nucleic acid amplification, such as polymerase chain reaction (PCR), can significantly improve detection sensitivity and is therefore widely used in clinical nucleic acid testing. However, because the PCR process involves approximately 30 temperature cycles of denaturation (95°C) → annealing (~52°C) → extension (72°C), PCR-based detection often relies on instruments capable of precise temperature control, which is not conducive to on-site testing. Furthermore, the repeated heating / cooling cycles result in long reaction times, making it difficult to meet the demands of large-scale, rapid nucleic acid testing. On the other hand, the detection of nucleic acid biomarkers such as proto-oncogene-related mutations and viral genotyping requires nucleic acid detection technologies capable of distinguishing single-base differences. Traditional nucleic acid amplification technologies, such as PCR, often rely on complex primer or probe designs to differentiate single-base differences, and false-positive signals caused by non-specific amplification still severely interfere with the accuracy of the final detection signal. In summary, the development of highly efficient and specific nucleic acid amplification technologies is of great significance for the screening of nucleic acid biomarkers.

[0004] PCR is the most representative nucleic acid amplification technology. It allows for rapid and accurate large-scale nucleic acid testing results. However, its dependence on precise temperature control equipment and time-consuming thermal cycling process still make it difficult to meet the demands for rapid, on-site testing.

[0005] In contrast, isothermal amplification technology offers constant reaction conditions, eliminates the need for time-consuming thermal cycling processes, and has lower requirements for equipment, making it more suitable for on-site detection. Strand displacement amplification (SDA) is one of the earliest developed isothermal amplification techniques. It utilizes nicking enzymes to create sites on double-stranded DNA that can be extended by polymerases. Then, DNA polymerases with both polymerization and strand displacement activities are used to replicate the target gene fragment. Through the alternating action of these two enzymes, exponential nucleic acid amplification is achieved under a constant temperature of 37°C. However, this technology has not been widely adopted, largely because nicking enzymes only recognize 4-8 base sequences fixed on double-stranded DNA. This limits SDA to amplifying genes containing only 1-2 nicking enzyme action sites. To address this challenge, some studies have designed nicking enzyme recognition sites on primers to synthesize double-stranded DNA templates suitable for SDA reactions under the action of DNA polymerases. However, a denaturation-annealing-extension process is still required at the beginning of the reaction to ensure primer hybridization and extension. Therefore, this method increases the complexity of the reaction system and is not advantageous in practical applications. In recent years, CRISPR / Cas9 has developed rapidly and its applications have become increasingly widespread. By designing its guide RNA targeting region, CRISPR / Cas9 can act as a programmable "gene scissors" to target and cleave any double-stranded DNA containing a pre-intercalation region adjacent motif (PAM, 2-3 specific nucleotides adjacent to the target region). Therefore, some studies have used CRISPR / Cas9 to achieve specific cleavage of double-stranded DNA and primer annealing hybridization under a constant temperature of 37°C. However, because CRISPR / Cas9 can only recognize and cleave one substrate double-stranded DNA and binds firmly to the cleavage product, it cannot be used to directly mediate strand substitution index amplification reactions. Subsequent amplification still depends on primers and nicking enzymes containing nicking enzyme recognition sites. Therefore, the application scope of this method is still limited by the PAM and the complexity of the system.

[0006] TtAgo (Thermus thermophiles Argonaute) is a prokaryotic protein from Gram-negative thermophilic bacteria that acts as a DNA-mediated endonuclease under the guidance of 5'-phosphorylated single-stranded DNA. Compared to CRISPR / Cas9, it has the following advantages: it does not require a long RNA chain as a guide sequence, but uses a short DNA segment (~18 nt); it can recognize any DNA or RNA without requiring a specific PAM sequence; one TtAgo can catalyze the breakage of multiple DNA or RNA sequences without binding to the cleavage substrate and hindering the replication of the cleavage substrate sequence by the polymerase; higher reaction temperatures can effectively reduce primer dimer formation and improve the specificity of the amplification reaction. Based on these advantages, some methods have applied TtAgo enzymes to nucleic acid detection. However, these methods usually only utilize TtAgo enzymes for highly specific recognition and cleavage of the target gene or amplification product, without fundamentally improving the nucleic acid amplification method itself. Summary of the Invention

[0007] The purpose of this invention is to provide an Argonaute-mediated strand substitution index amplification method. By utilizing the programmability of the TtAgo enzyme, this method solves the problem of traditional strand substitution amplification being limited by the target gene sequence. Under high-temperature reaction conditions, this method achieves "stepwise self-testing" during the amplification process and significant differentiation of single base differences on DNA, greatly improving the specificity of the amplification reaction while shortening the reaction time.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] An Argonaute-mediated strand substitution exponential amplification method includes the following steps:

[0010] Step 1: Design two gDNAs using the target gene or DNA fragment to be detected as the target sequence. The 5' T bases of the two gDNAs are modified with phosphate groups. gDNA1 is complementary to the 5' end of the forward strand of the target sequence, and gDNA2 is complementary to the 5' end of the reverse strand of the target sequence.

[0011] Step 2: gDNA1 guides the TtAgo enzyme to bind to the 5' end of the forward strand of the target sequence and cleave it, while gDNA2 guides the TtAgo enzyme to bind to the 5' end of the reverse strand of the target sequence. The cleavage site is located within the complementary fragment formed by the gDNA and the target sequence.

[0012] Step 3: Design strand substitution amplification primers, which include amplification primer P1 that binds to the reverse strand of the target sequence and amplification primer P2 that binds to the forward strand of the target sequence. Amplification primers P1 and / or P2 carry single-base mutation sites.

[0013] Under the action of polymerase, amplification primer P1 extends to form double strand A using the reverse strand obtained from the cleavage in step two as a template.

[0014] Under the action of polymerase, amplification primer P2 extends using the forward strand obtained from the cleavage in step two as a template to form double-stranded B;

[0015] Step 4, Loop 1:

[0016] gDNA1 guides TtAgo enzyme to bind to and cleave the 5' end of the forward strand of double-stranded A in step 3. Under the action of polymerase, amplification primer P1 extends to form double-stranded A using the reverse strand of double-stranded A in step 3 as a template.

[0017] gDNA2 guides TtAgo enzyme to bind to and cleave the 5' end of the reverse strand of double-stranded B in step 3. Under the action of polymerase, amplification primer P2 extends with the reverse strand of double-stranded B in step 3 as a template to form double-stranded B.

[0018] Step 5, Loop 2:

[0019] The amplification primer P1 is extended using the reverse strand of the double-stranded B obtained from step four as a template under the action of polymerase. Then, it is cleaved by TtAgo enzyme guided by gDNA1 to obtain double-stranded C. The single strand of double-stranded C continues to participate in cycle two as a substrate.

[0020] The amplification primer P2 is extended using the forward strand of the double-stranded A obtained in step four as a template under the action of polymerase. Then, it is cleaved by TtAgo enzyme guided by gDNA2 to obtain double-stranded C. The single strand of double-stranded C continues to participate in cycle two as a substrate.

[0021] As a preferred technical solution of the present invention: the cleavage site is located between the 10th and 11th bases at the 5' end of the complementary fragment formed by the gDNA and the target sequence.

[0022] As a more preferred technical solution of the present invention: the TtAgo enzyme cleavage process involves adding two gDNAs to the TtAgo enzyme mixture for incubation, and then adding a reaction system containing the target gene or DNA fragment and Vent enzyme after incubation.

[0023] As a preferred technical solution of the present invention: the reaction system contains Mg 2+ .

[0024] As a more preferred technical solution of the present invention: the Mg 2+ The concentration is 2-8 mM.

[0025] As a more preferred technical solution of the present invention: the Mg 2+ The concentration is 8 mM.

[0026] As a preferred technical solution of the present invention, the molar ratio of the two gDNAs is 1:1.

[0027] As a more preferred technical solution of the present invention: the temperature of the TtAgo enzyme cleavage reaction is 75-85℃;

[0028] Another objective of this invention is to provide the application of the Argonaute-mediated strand substitution index amplification method in the detection of single-base mutations in genes.

[0029] This invention utilizes a programmable TtAgo enzyme-mediated exponential chain displacement amplification reaction. While achieving highly efficient amplification, it significantly shortens the reaction time by avoiding temperature cycling. Furthermore, leveraging the high specificity of TtAgo enzyme's recognition and cleavage capabilities, and through the rational design of gDNA and primer sequences, significant differentiation of single-base differences in DNA is achieved through "stepwise self-checking" during amplification. Compared to Argonaute-mediated PCR, this avoids complex temperature fluctuations, thus shortening the reaction time without relying on equipment such as thermal cyclers.

[0030] In this invention, the TtAgo enzyme specifically recognizes and cleaves the target sequence between the 10th and 11th bases at the 5' end of the complementary fragment formed by the gDNA and the target sequence. Compared to traditional SDA amplification, this invention uses the TtAgo enzyme instead of the nicking enzyme to achieve the first step of cleavage. Furthermore, compared to the nicking enzyme, the guide sequence of the TtAgo enzyme can be edited and is not limited by fixed recognition sites. After the TtAgo enzyme cleaves the nucleic acid sequence, a double-stranded DNA fragment with sticky ends is formed. In this invention, cycle one involves primers attaching to the target gene or DNA fragment cleavage product and extending it. A pair of designed amplification primers are extended into a double strand under the action of polymerase. This double strand has cleavage sites and can continue to be recognized and cleaved by proteins. The displaced single strand can serve as a substrate for cycle two. In this invention, cycle one involves primers attaching to the replacement product of cycle one and extending it. During the extension process of cycle one, the displaced sequence can bind complementaryly to the primers and extend under the action of polymerase. The extended product also has cleavage sites of the TtAgo enzyme and forms a single strand under the action of protein cleavage, which can continue to serve as a substrate for cycle two. Attached Figure Description

[0031] Figure 1 This is a gel electrophoresis image after the reaction in Example 1 of the present invention;

[0032] Figure 2 This is a gel electrophoresis image after the reaction in Example 2 of the present invention;

[0033] Figure 3 This is a gel electrophoresis image after the reaction in Example 3 of the present invention;

[0034] Figure 4This is a gel electrophoresis image after the reaction in Example 3 of the present invention;

[0035] Figure 5 This is a schematic diagram of the Argonaute-mediated strand substitution exponential amplification method described in this invention. Detailed Implementation

[0036] The invention is further defined in the following embodiments. Based on the following description and these embodiments, those skilled in the art can determine the basic features of the invention, and various changes and modifications can be made to the invention to make it suitable for various uses and conditions without departing from the nature and scope of the invention.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; and the materials and reagents used are commercially available unless otherwise specified.

[0038] Example 1

[0039] The forward strand of the mutant double-stranded target sequence (MT) is shown in SEQ ID NO:1, and the reverse strand is shown in SEQ ID NO:2. The forward strand of the wild-type (WT) is shown in SEQ ID NO:3, and the reverse strand is shown in SEQ ID NO:4. Both MT and WT are 100 bp in length. The gene sequence of MT relative to WT forms a single base mismatch at position 31; position 31 of the wild-type is T, while position 31 of the mutant is G. The 5' T bases of the used gDNA1 and gDNA2 are modified with phosphate groups. The nucleotide sequence of gDNA1 is shown in SEQ ID NO:5, with a length of 17 nt, and the nucleotide sequence of gDNA2 is shown in SEQ ID NO:6, with a length of 18 nt. gDNA1 and gDNA2 form complementary fragments at the 5' end of the mutant gene of the target gene, with the splicing site located between the 10th and 11th bases at the 5' end of the complementary fragment. The gDNA used was synthesized by Shanghai Sangon Biotech Co., Ltd., and the double-stranded target sequence used was synthesized by Hippo Biotechnology Co., Ltd. The TtAgo enzyme used was purchased from NEB, and the buffer used was an accessory product of NEB. The 1× buffer contained: 20 mM Tris-HCl, 10 mM KCl, 10 mM NH4)2SO4, 2 mM MgSO4 and 0.1% Triton X-100, with a pH of 8.8.

[0040] The MT sequence is as follows:

[0041] Forword(SEQ ID NO:1):CGCAGCATGTCAAGATCACAGATTTTG g / GCGGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGA AGGAGGCAAAGTAAGGAGGTGGCTTTA;

[0042] Reverse (SEQ ID NO: 2): TAAAGCCACCTCCTTACTTTGCC / TCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCCCGCCCAAAATCTGTGATCTTGACATGCTGCG.

[0043] The WT sequence is as follows:

[0044] Forword(SEQ ID NO:3):CGCAGCATGTCAAGATCACAGATTTTGt / GCGGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCTTTA;

[0045] Reverse (SEQ ID NO: 4): TAAAGCCACCTCCTTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCCAGCCCAAAATCTGTGATCTTGACATGCTGCG.

[0046] Note: Lowercase letters indicate mutation sites, and forward slashes indicate splicing sites; sequence(5'-3')

[0047] gDNA1 sequence (SEQ ID NO:5): p-TTTTGGCCCGC / CCAAAAT-C6;

[0048] gDNA2 sequence (SEQ ID NO: 6): p-TGCAGAAGGA / GGCAAAGT-C6.

[0049] Note: The forward slash indicates the cutoff point; sequence(5'-3'); sequence(5'-3').

[0050] First, gDNA containing TtAgo enzyme is added and incubated. After incubation, a mutant target sequence containing the target gene, two primer sequences, and Vent enzyme are added to form the reaction system.

[0051] The incubation system for TtAgo enzyme and gDNA is as follows:

[0052] Name Volume (μL) TtAgo enzyme 0.75 <![CDATA[Mg 2+ ]]> 0.75 10×buffer 0.75 gDNA1 0.75 gDNA2 0.75

[0053] The specific steps are as follows: First, mix equal amounts of TtAgo enzyme (0.75 μL) with gDNA1 (0.75 μL) and gDNA2 (0.75 μL) in 0.75 μL of 1× buffer and incubate for 25 minutes. After incubation, divide the mixture into three groups: 3.75 μL for each of groups 1, 2, and 3, and 3.75 μL for each of groups 4, 5, and 6. Mix groups 1 and 4 (A); mix groups 2 and 5 (B); and mix groups 3 and 6 (C).

[0054] The gDNA1 incubation system is as follows:

[0055]

[0056] The gDNA2 incubation system is as follows:

[0057]

[0058] After mixing, the mutant target sequence and Vent enzyme were added to the system, and the reaction temperature was set in the PCR instrument as shown below:

[0059]

[0060] Using the fragment generated after cleavage of the target sequence as a template, amplification primers P1 and P2 were designed. The sequence of P1 is shown in SEQ ID NO:7, and the sequence of P2 is shown in SEQ ID NO:8. The primers used were 21 nt in length and were synthesized at Shanghai Sangon Biotech Co., Ltd. The sequences are as follows:

[0061] P1 (SEQ ID NO:7): CGCAGCATGTCAAGATCACAGATT;

[0062] P2 (SEQ ID NO:8): TAAAGCCACCTCCCTTACTTTGCCT.

[0063] Note: The Vent enzyme used in sequence (5'-3') was purchased from Takara.

[0064] The amplification system is shown below:

[0065] Name Volume (μL) Primer-F 0.75 Primer-R 0.75 Vent enzyme 0.75 dNTP 1.5

[0066] After the reaction, gel electrophoresis was performed using a 10% PAGE gel. The gel electrophoresis results are as follows: Figure 1As shown, lane 1 contains the mutant target gene, gDNA sequence, primer sequence, and Vent enzyme; lane 2 contains the gDNA sequence, primer sequence, and Vent enzyme; lane 3 contains the mutant target gene and gDNA sequence; lane 4 contains the mutant target gene, primer sequence, and Vent enzyme; lane 5 contains the primer sequence and Vent enzyme; lane 6 contains the mutant target gene and Vent enzyme; lane 7 contains the mutant target gene; and lanes 8, 9, 10, 11, and 12 contain the positive control, gDNA1, gDNA2, Primer-F, and Primer-R, respectively. Figure 1 Lane 1 is where the reaction occurs when the mutant target gene, gDNA sequence, primer sequence, and vent enzyme are present simultaneously. The resulting product is in the same position as the positive control, indicating that the target amplification product has been generated.

[0067] Example 2

[0068] This study investigated the effect of magnesium ions on the splicing efficiency of mutant target genes.

[0069] The forward strand of the mutant double-stranded target sequence (MT) is shown in SEQ ID NO:1, and the reverse strand is shown in SEQ ID NO:2. The forward strand of the wild-type (WT) is shown in SEQ ID NO:3, and the reverse strand is shown in SEQ ID NO:4. Both MT and WT are 100 bp in length. The gene sequence of MT relative to WT forms a single base mismatch at position 31, with T at position 31 in the wild-type and G at position 31 in the mutant. The 5' T bases of the used gDNA1 and gDNA2 are modified with phosphate groups. The nucleotide sequence of gDNA1 is shown in SEQ ID NO:5, with a length of 17 nt, and the nucleotide sequence of gDNA2 is shown in SEQ ID NO:6, with a length of 18 nt. gDNA1 and gDNA2 form complementary fragments at the 5' end of the mutant gene of the target gene, with the splicing site located between the 10th and 11th bases at the 5' end of the complementary fragment. The gDNA used was synthesized by Shanghai Sangon Biotech Co., Ltd., and the double-stranded target sequence used was synthesized by Hippo Biotechnology Co., Ltd. The TtAgo enzyme used was purchased from NEB Corporation, and the 10× buffer used was a by-product of NEB Corporation.

[0070] TtAgo enzyme and gDNA were incubated separately. After incubation, different concentrations of magnesium ions and the target sequence were added. The incubation system for TtAgo enzyme and gDNA1 was as follows:

[0071] Name Volume (μL) <![CDATA[H2O]]> 6μL 10×buffer 2μL TtAgo enzyme 1μL gDNA1 5μL

[0072] The incubation system for TtAgo enzyme and gDNA2 is as follows:

[0073] Name Volume (μL) <![CDATA[H2O]]> 6μL 10×buffer 2μL TtAgo enzyme 1μL gDNA2 5μL

[0074] The specific steps are as follows:

[0075] TtAgo enzyme and gDNA were incubated in a 1×buffer mixture for 25 min at 75℃. After incubation, 4 μL of magnesium ion solution (2 mM, 4 mM, 6 mM, 8 mM) and mutants (ssDNAMT-Forward and ssDNAMT-Reverse) at a concentration of 400 nM were added. The reaction was carried out at 75℃ for 40 min. The results of gel electrophoresis after the reaction are shown below. Figure 2 As shown, the shearing efficiency increases with the increase of magnesium ion concentration, and the target sequence is completely sheared when the magnesium ion concentration is 8 mM.

[0076] Example 3

[0077] This embodiment investigates whether gDNA can cleave primers. The primers and gDNA partially have complementary base pairings; if the gDNA can cleave the primers, step three cannot be performed. The 5' T bases of gDNA1 and gDNA2 used are modified with phosphate groups. The nucleotide sequence of gDNA1 is shown in SEQ ID NO:5, with a length of 17 nt, and the nucleotide sequence of gDNA2 is shown in SEQ ID NO:6, with a length of 18 nt. gDNA1 and gDNA2 form complementary fragments at the 5' end of the target gene in the mutant gene sequence, with the cleavage site located between the 10th and 11th bases at the 5' end of the complementary fragment. The gDNA used was synthesized by Shanghai Sangon Biotech Co., Ltd., and the double-stranded target sequence was synthesized by Hippo Biotechnology Co., Ltd. The amplification primers are shown in SEQ ID NO:7 and SEQ ID NO:8. The TtAgo enzyme used was purchased from NEB, and the 10× buffer used was an accompanying product of NEB. The TtAgo enzyme and gDNA were mixed and incubated separately at 75°C for 25 min. After incubation, the amplification primer sequence was added.

[0078] The incubation system for TtAgo enzyme and gDNA of EGFR-MTR chain is as follows:

[0079] Name Volume (μL) <![CDATA[H2O]]> 4.5 10×buffer 1 <![CDATA[MgSO4]]> 1 TtAgo (1μM) 0.5 gDNA2-C6 (5μM) 0.5

[0080] The incubation system for TtAgo enzyme and gDNA of EGFR-MTF chain is as follows:

[0081] Name Volume (μL) <![CDATA[H2O]]> 4.5 10×buffer 1 <![CDATA[MgSO4]]> 1 TtAgo (1μM) 0.5 gDNA1-6C6 (5μM) 0.5

[0082] The specific steps are as follows:

[0083] TtAgo and gDNA were incubated in a 1× buffer solution for 25 min at 75℃. After incubation, primer sequences and mutants (ssDNAMT-Forward and ssDNAMT-Reverse) were added as cleavage controls. Gel electrophoresis was performed after the reaction, and the results are shown below. Figure 3 and 4 As shown, the study investigated whether gDNA could cleave three primers of different lengths. At the same time, a target sequence was added as a pair to verify the protein cleavage activity. It was found that the three primers of different lengths were not cleaved when the protein had cleavage activity.

[0084] like Figure 5 As shown, the Argonaute-mediated strand substitution index amplification method provided by this invention first involves the TtAgo enzyme specifically recognizing and cleaving the nucleic acid sequence at positions complementary to the 10th and 11th bases of the gDNA under the guidance of gDNA. Compared with traditional SDA amplification, this invention uses the TtAgo enzyme instead of the nicking enzyme to achieve the first step of cleavage. Furthermore, compared to the nicking enzyme, the guide sequence of the TtAgo enzyme can be edited and is not limited by fixed recognition sites. After the TtAgo enzyme cleaves the nucleic acid sequence, a double-stranded DNA fragment with sticky ends is formed. First, primers attach to the EGFR-MT cleavage product and extend (cycle one): a pair of primers v are extended under the action of polymerase to form a double strand. This double strand contains cleavage sites that can be recognized and cleaved by proteins. The displaced single strand can then serve as the substrate for cycle two. Then, the primers attach to the replacement product of cycle one and extend (cycle two): the sequence that is replaced during the extension process of cycle one can bind complementaryly to the primers and extend under the action of polymerase. The extended product also has the cleavage site of TtAgo enzyme. Under the cleavage action of TtAgo enzyme, a single strand is formed and can continue to participate in the cycle as a substrate of cycle two.

[0085] Although embodiments of the present invention have been shown and described above, it is understood that the embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the embodiments within the scope of the present invention.

Claims

1. An Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes, characterized by: It comprises the following steps: Step one: design two gDNAs with the target gene or DNA fragment to be detected as the target sequence, the 5' end of the two gDNAs is modified by a phosphate group, gDNA1 and the positive strand of the target sequence form a complement at the 5' end, and gDNA2 and the reverse strand of the target sequence form a complement at the 5' end; Step two: gDNA1 guides TtAgo enzyme to bind to the 5' end of the positive strand of the target sequence and cut, and gDNA2 guides TtAgo enzyme to bind to the 5' end of the reverse strand of the target sequence, and the cutting site is located in the complementary fragment formed by gDNA and the target sequence; Step three: design strand displacement amplification primers, including amplification primer P1 combined with the reverse strand of the target sequence and amplification primer P2 combined with the positive strand of the target sequence, the amplification primer P1 or / and P2 has a single base mutation site, and the amplification primer P1 is extended to form double-stranded A under the action of polymerase with the reverse strand cut in step two as the template, and the amplification primer P2 is extended to form double-stranded B under the action of polymerase with the positive strand cut in step two as the template; Step four: cycle one: gDNA1 guides TtAgo enzyme to bind to the 5' end of the positive strand of double-stranded A in step three and cut, and the amplification primer P1 is extended to form double-stranded A under the action of polymerase with the reverse strand of double-stranded A in step three as the template; gDNA2 guides TtAgo enzyme to bind to the 5' end of the reverse strand of double-stranded B in step three and cut, and the amplification primer P2 is extended to form double-stranded B under the action of polymerase with the reverse strand of double-stranded B in step three as the template; Step five: cycle two: the amplification primer P1 is extended under the action of polymerase with the reverse strand cut after double-stranded B in step four as the template, and then double-stranded C is obtained after being cut by gDNA1 guided TtAgo enzyme, and the single strand of double-stranded C is used as a substrate to continue participating in cycle two; the amplification primer P2 is extended under the action of polymerase with the positive strand cut after double-stranded A in step four as the template, and then double-stranded C is obtained after being cut by gDNA2 guided TtAgo enzyme, and the single strand of double-stranded C is used as a substrate to continue participating in cycle two.

2. The Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes according to claim 1, wherein: The cutting site is located between the 10th and 11th bases at the 5' end of the complementary fragment formed by gDNA and the target sequence.

3. The Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes according to claim 1, wherein, The TtAgo enzyme cutting process is to add two gDNAs into the TtAgo enzyme mixed incubation, and then add the reaction system containing the target gene or DNA fragment and Vent enzyme after the incubation is completed.

4. The Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes according to claim 3, wherein: The reaction system contains Mg 2+ .

5. The Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes according to claim 4, wherein: The Mg 2+ at a concentration of 2-8 mM.

6. The Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes according to claim 5, wherein: The Mg 2+ concentration is 6-8 mM.

7. The Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes according to claim 4, wherein: The molar ratio of the two gDNAs is 1:

1.

8. The Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes according to claim 4, wherein: The temperature of the TtAgo enzyme cutting reaction is 75-85℃.

9. The application of the Argonaute-mediated strand displacement exponential amplification method for non-disease diagnostic purposes in detecting single base mutations of genes.

Images