Application of peccr gene in increasing flavonoid content of bamboo
By knocking out or knocking down the PeCCR gene in bamboo, and using CRISPR/Cas9 vector and Agrobacterium infection technology, the problem of low flavonoid content in bamboo was solved, and a significant increase in flavonoid content was achieved.
Patent Information
- Application Number
- CN202211579890.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-06
- Publication Date
- 2025-12-30
- Estimated Expiration
- 2042-12-06
AI Technical Summary
Bamboo contains low levels of flavonoids, which are difficult to increase effectively using current technologies.
By knocking out or down the PeCCR gene in bamboo, gene editing of the PeCCR gene was performed using a CRISPR/Cas9 vector and gRNA, and gene editing was carried out by infecting bamboo leaves with Agrobacterium, resulting in a significant increase in flavonoid content.
Significantly increases the flavonoid content in bamboo; gene editing can increase the flavonoid content by approximately 7.1%.
Smart Images

Figure CN116262932B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant gene editing technology, specifically relating to the application of the PeCCR gene in increasing the flavonoid content of bamboo. Background Technology
[0002] Flavonoids are an important class of secondary metabolites in plants, possessing significant health-promoting effects, including antibacterial, antiviral, immune-enhancing, and cardiovascular protective functions. Furthermore, current research has revealed an interaction between flavonoids and the gut microbiota; higher flavonoid content is associated with lower microbial diversity and virulence factors, as well as a greater variety of cellulose-degrading microorganisms.
[0003] Currently, flavonoids mainly exist in bound (flavonoid glycosides) or free (flavonoid aglycones) forms in many food plants such as fruits, vegetables, legumes, and tea. In addition, current research has found that bamboo also contains flavonoids, and a rich variety of 97 different types, more than fruits, vegetables, legumes, and tea. Therefore, bamboo is an important source of flavonoids. Bamboo is an important economic plant with a wide planting area in my country. The application of flavonoids from bamboo will not only broaden the sources of flavonoids but also expand the application value of bamboo.
[0004] However, the flavonoid content in bamboo is not very high. Therefore, it is of great significance to study a method to increase the flavonoid content in bamboo. Summary of the Invention
[0005] To address the above problems, this invention has discovered a PeCCR gene that can regulate the flavonoid content in bamboo. Knocking out or down the PeCCR gene in bamboo can significantly increase the flavonoid content in bamboo.
[0006] To achieve the above objectives, the present invention can adopt the following technical solutions:
[0007] In one aspect, this invention provides the application of the PeCCR gene in increasing the flavonoid content of bamboo, wherein the PeCCR gene is selected from one or more sequences shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
[0008] Another aspect of the present invention provides a bamboo gene editing reagent for knocking down or knocking out the PeCCR gene in bamboo, wherein the PeCCR gene is selected from one or more sequences shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
[0009] In another aspect, the present invention provides a biomaterial comprising the above-described bamboo gene-editing reagent.
[0010] Another aspect of the present invention provides a method for increasing the flavonoid content in bamboo, comprising infecting bamboo with the aforementioned bamboo gene editing reagent.
[0011] The beneficial effects of this invention include: by knocking out or knocking down the PeCCR gene in bamboo, as shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, the content of flavonoids in bamboo can be significantly increased, by about 7.1% compared with the flavonoid content of bamboo that has not undergone gene editing. Attached Figure Description
[0012] Figure 1 The structure of the PeCCR gene in moso bamboo in Example 1 is shown; the red area indicates the location of the KNWYCYGK domain in the coding region.
[0013] Figure 2 This is a schematic diagram of the CRISPR / Cas9 expression vector structure of the PeCCR and endogenous tag PeVDE genes in Example 1;
[0014] Figure 3 NPQ analysis of chlorophyll fluorescence parameters of moso bamboo leaves transformed with Agrobacterium-mediated CRISPR / Cas9 gene editing vectors containing PeCCR and PeVDE gene gRNAs in Example 1; where a: visible light image, b: NPQ imaging; triangles indicate areas with low NPQ values.
[0015] Figure 4 The analysis of total flavonoid content at the low NPQ values in Example 1 was conducted; the experimental groups were PeCCR1-PeCCR5. Detailed Implementation
[0016] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.
[0017] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.
[0018] This invention provides an application of the PeCCR gene in increasing the flavonoid content of bamboo. The PeCCR gene is selected from one or more sequences shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
[0019] It should be noted that the PeCCR genes shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10 in this invention are four gene segments from the PeCCR family. This invention has found that knocking out or knocking down these four gene segments in bamboo can significantly increase the flavonoid content in bamboo. Furthermore, not all gene knockouts or knockdowns in the PeCCR family increase the flavonoid content in bamboo; in fact, knocking out or knocking down some of these genes can actually decrease the flavonoid content.
[0020] Another aspect of the present invention provides a bamboo gene editing reagent for knocking down or knocking out the PeCCR gene in bamboo, wherein the PeCCR gene is selected from one or more sequences shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
[0021] It should be noted that the above-mentioned bamboo gene editing reagent can be any reagent known in the art that can knock out or knock down the PeCCR gene (this reagent is not only a chemical reagent, but also a biological reagent), such as reagents related to CRISPR / Cas technology, ZFNs (zinc-finger nucleases) technology, TALENs (transcription activator-like effector nucleases) technology, BE (base editing) technology, or PE (prime editing) technology, etc.
[0022] In some specific embodiments, the bamboo gene-editing reagents described above can preferably be CRISPR / Cas9 vectors, which include gRNA that recognizes the PeCCR gene. It should be noted that CRISPR / Cas9 vectors, a relatively fast and accurate gene-editing tool currently available, utilize CRISPR / Cas9 gene-editing technology.
[0023] In some specific embodiments, the gRNA in the CRISPR / Cas9 vector that recognizes the PeCCR gene in the above-mentioned bamboo gene editing reagent includes sequences as shown in SEQ ID NO:12 to SEQ ID NO:16.
[0024] In some specific embodiments, the bamboo gene editing reagents described above also include reagents for knocking down or eliminating endogenous tag genes in bamboo. It should be noted that the endogenous tag gene in bamboo refers to a gene whose knockdown or elimination can express a certain trait but does not affect the expression of the PeCCR gene, such as the PeVDE gene in bamboo. Knockdown or elimination of this gene can cause bamboo to produce fluorescence. In some specific embodiments, gRNA that can recognize the PeVDE gene can be applied to bamboo together with the aforementioned CRISPR / Cas9 vector to simultaneously edit the PeCCR and PeVDE genes. The change in bamboo fluorescence after knockdown or elimination of the PeVDE gene can be used to quickly determine whether the PeCCR gene has been successfully edited, thus improving editing efficiency.
[0025] In another aspect, this invention provides a biomaterial comprising the aforementioned bamboo gene-editing reagent. It should be noted that this biomaterial can be any biological vector capable of knocking out or downsetting the PeCCR gene, including but not limited to expression vectors and engineered bacteria, which are well-known in the art. Furthermore, Agrobacterium is generally chosen as the engineered bacteria.
[0026] Another aspect of the present invention provides a method for increasing the flavonoid content in bamboo, comprising infecting bamboo with the aforementioned bamboo gene editing reagent.
[0027] It should be understood that in the above methods for increasing the flavonoid content in bamboo, the bamboo gene editing reagent is generally used to infect bamboo with Agrobacterium, which is Agrobacterium known in the field.
[0028] It should be noted that due to the weak foundation of bamboo genetic breeding research, the imperfect and time-consuming genetic transformation system, genetic engineering is difficult to implement in bamboo, severely hindering the understanding and modification of bamboo. Furthermore, bamboo is mostly a perennial plant with a long and unstable flowering cycle. Traditional genetic transformation techniques integrate plasmid fragments into the plant's own chromosomes, which are difficult to remove in the short term through hybridization, posing a transgenic safety risk. Therefore, traditional genetic transformation techniques are not suitable for bamboo species used for shoot production. Therefore, Agrobacterium can be used to directly transform plant organs (such as seeds and leaves), achieving transient expression of exogenous genes in the absence of resistance selection pressure. In most cases, the transient gene expression level reaches its peak 3-4 days after infection and rapidly declines within 5-6 days. Existing research has shown that under conditions without resistance selection pressure, CRISPR / Cas9 genes can be transiently expressed in plants, and T-DNA can complete gene editing without integration into the plant genome. Although it is difficult to obtain homozygous gene-edited plants, gene editing can still be performed on some tissues, significantly shortening the cycle of gene editing in perennial plants. Therefore, in this invention, bamboo can be directly edited using an in situ gene editing method, which is fast and stable.
[0029] In some specific embodiments, the method for increasing the flavonoid content in bamboo described above involves infecting bamboo seedling leaves. Furthermore, the bamboo used in this invention can be any bamboo species known in the art, such as moso bamboo.
[0030] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.
[0031] Example 1: Gene structure of the PeCCR family in moso bamboo and design of gRNA targets for gene editing.
[0032] Cinnamyl-CoA reductase (CCR) is a key enzyme in phenylpropanoid metabolism. Flavonoids constitute the branch of the phenylpropanoid metabolic pathway with the most diverse metabolites, playing a crucial role in plant pigment accumulation, pollen development, auxin transport, and antioxidant activity. Therefore, gene editing of the plant CCR is highly likely to affect flavonoid biosynthesis. Furthermore, the KNWYCYGK domain is the catalytic site of the CCR protein and is a common amino acid structure for the protein encoded by the plant CCR gene. Therefore, editing the genomic DNA sequence encoding the KNWYCYGK domain will affect the catalytic function of the CCR protein. In this embodiment of the invention, known CCR gene sequences from other plants were compared and searched in the *Phyllostachys edulis* genome database. The *Phyllostachys edulis* CCR genome sequence was then determined using sequences containing the KNWYCYGK domain. Corresponding gene editing targets were designed and edited, and the relationship between flavonoid content and the *Phyllostachys edulis* CCR genome was investigated.
[0033] (1) Using rice, maize, and Arabidopsis CCR gene sequences as bait, a comparison search was performed in the bamboo genome database. Sequences containing the KNWYCYGK domain in their encoding amino acid sequences were retained, totaling 11. Based on sequence similarity, bamboo CCRs were divided into 5 categories (see...). Figure 1 The CCR gene sequence number of moso bamboo is as follows:
[0034] PeCCR1: PH02Gene02696.t1 and PH02Gene11141.t1;
[0035] PeCCR2: PH02Gene06795.t1, PH02Gene42850.t1, PH02Gene20528.t1 and PH02Gene28903.t1;
[0036] PeCCR3: PH02Gene42960.t1 and PH02Gene04803.t1;
[0037] PeCCR4: PH02Gene32193.t1 and PH02Gene45555.t1;
[0038] PeCCR5: PH02Gene42984.t1;
[0039] The specific information of the obtained sequences is shown in Table 1 below, which is used for target design.
[0040] Table 1. CCR gene sequence of moso bamboo
[0041]
[0042]
[0043] (2) Target sites were designed at the KNWYCYGK domain encoding the genome sequence of each type of CCR. The corresponding target sequence information is shown in Table 2 below. Rice OsU3 was used as an example. pro This is the promoter.
[0044] Table 2 Target Sequence Information
[0045] CCR gene sequence Target sequence (gRNA) PeCCR1 SEQ ID NO:12 PeCCR2 SEQ ID NO:13 PeCCR3 SEQ ID NO:14 PeCCR4 SEQ ID NO:15 PeCCR5 SEQ ID NO:16
[0046] (3) Construct each target sequence into pC1300-Ubi::Cas9-OsU3. pro::PeVDEgRNA vector (PeVDEgRNA sequence: CCGGTGCTGCGTGAGGGCTA (SEQ ID NO:17)), and a series of expression vectors pC1300-Ubi::Cas9-OsU3pro::PeVDEgRNA2-OsU3pro::PeCCR1-5gRNA (e.g.) were obtained. Figure 2 (As shown).
[0047] Example 2: Gene Editing of the PeCCR Gene in Moso Bamboo
[0048] (1) The series of expression vectors pC1300-Ubi::Cas9-OsU3pro::PeVDEgRNA2-OsU3pro::PeCCR1gRNA, pC1300-Ubi::Cas9-OsU3pro::PeVDEgRNA2-OsU3pro::PeCCR2gRNA, and pC1300-Ubi::Cas9-OsU3pro::PeVDEgRNA2-OsU3pro::PeCCR2gRNA were respectively expressed as follows: The R3gRNA vector, pC1300-Ubi::Cas9-OsU3pro::PeVDEgRNA2-OsU3pro::PeCCR4gRNA vector, and pC1300-Ubi::Cas9-OsU3pro::PeVDEgRNA2-OsU3pro::PeCCR5gRNA vector were transformed into Agrobacterium tumefaciens strain GV3101 and cultured in YEP medium until OD2000. 600 Reaching 0.6-0.8;
[0049] (2) Centrifuge and collect the bacterial cells, wash once with the infection solution, and resuspend in the infection solution until OD200 is reached. 600 Reaching 0.4-0.6, it is used to convert bamboo leaves;
[0050] (3) Remove the 1-month-old Phyllostachys edulis seedlings from the seedling trays and wrap the roots with aluminum foil; use a sharp needle (such as a syringe needle) to puncture the meristem near the top of the seedling.
[0051] (4) Quickly invert the above-ground parts of the bamboo seedlings and immerse them in the Agrobacterium infection solution, then place them in a vacuum chamber for negative pressure vacuuming, and treat them under negative pressure for 2 minutes at 25-27 inches Hg.
[0052] (5) Remove the infected bamboo seedlings from the vacuum chamber, remove the tin foil and transfer them to a seedling tray for cultivation. Cover them with a transparent film on the first day to maintain humidity (relative humidity of about 80%). Remove the film on the second day and continue cultivation.
[0053] (6) On day 10, the bamboo seedlings were subjected to strong light (1200 μmol·m⁻¹) using an IMAGING-PAM chlorophyll fluorometer (Walz, Effeltrich). -2 ·s -1 Treatment for 2 hours; activation light set to 800 μmol·m⁻¹ -2 ·s -1 The processing time is 315 seconds, and chlorophyll fluorescence images of the transformed leaves are acquired (e.g., Figure 3 (as shown);
[0054] (7) Take Figure 3 Genomic DNA was extracted from leaf regions with low and high NPQ values, respectively, for PeCCR coding region deep sequencing.
[0055] The above examples demonstrate that this method can rapidly and efficiently perform in situ gene editing of endogenous genes in bamboo leaves.
[0056] Example 3: Determination of flavonoid content in bamboo leaves after PeCCR gene editing
[0057] Samples were taken from the areas of the gene-edited leaves with low NPQ values in Example 2, dried to constant weight, pulverized, and passed through a 50-mesh sieve for flavonoid content determination (flavonoid content was determined using the Solarbio Flavonoid Assay Kit (BC1330), and the specific steps were referred to the reagent instructions).
[0058] The measurement results are as follows Figure 4 As shown, the results indicated that 30 days after infection, the flavonoid content in the leaves of PeCCR3 and PeCCR4 gene-edited plants increased, with the flavonoid content in the leaves of PeCCR3 and PeCCR4 gene-edited plants increasing by approximately 7.1% compared to the control group. The flavonoid content in the leaves of PeCCR1, PeCCR2, and PeCCR5 gene-edited plants decreased compared to the control group.
[0059] The above results indicate that knocking out or knocking down the PeCCR family genes PeCCR3 (PH02Gene42960.t1 and PH02Gene04803.t1) and PeCCR4 (PH02Gene32193.t1 and PH02Gene45555.t1) increases the flavonoid content in bamboo leaves.
[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. Application of knocking out PeCCR gene in improving flavonoid content of bamboo, the knocking out is simultaneously knocking out PeCCR gene with sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8; or the knocking out is simultaneously knocking out PeCCR gene with sequences as shown in SEQ ID NO: 9 and SEQ ID NO:
10.
2. A method for increasing flavonoid content in bamboo, characterized in that, Comprise: Infecting bamboo with a bamboo gene editing reagent; the bamboo gene editing reagent is used for knocking out PeCCR gene in bamboo, the knocking out is simultaneously knocking out PeCCR gene with sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8; or the knocking out is simultaneously knocking out PeCCR gene with sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10, the bamboo gene editing reagent comprises a CRISPR / Cas9 vector comprising a gRNA recognizing PeCCR gene, the gRNA recognizing PeCCR gene comprises a sequence as shown in SEQ ID NO: 14 or SEQ ID NO:
15.
3. The method of claim 2, wherein, Also comprise a reagent for knocking down or knocking out an endogenous tag gene in bamboo.
4. The method according to claim 2 or 3, characterized in that, The bamboo gene editing reagent comprises an engineered bacterium.
5. The method for increasing flavonoid content in bamboo according to claim 2 or 3, characterized in that, Selecting a leaf of a bamboo seedling for infection.
1. Application of knocking out PeCCR gene in improving flavonoid content of bamboo, the knocking out is simultaneously knocking out PeCCR gene with sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8; or the knocking out is simultaneously knocking out PeCCR gene with sequences as shown in SEQ ID NO: 9 and SEQ ID NO:
10. Comprise: Infecting bamboo with a bamboo gene editing reagent; the bamboo gene editing reagent is used for knocking out PeCCR gene in bamboo, the knocking out is simultaneously knocking out PeCCR gene with sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8; or the knocking out is simultaneously knocking out PeCCR gene with sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10, the bamboo gene editing reagent comprises a CRISPR / Cas9 vector comprising a gRNA recognizing PeCCR gene, the gRNA recognizing PeCCR gene comprises a sequence as shown in SEQ ID NO: 14 or SEQ ID NO:
15. Also comprise a reagent for knocking down or knocking out an endogenous tag gene in bamboo. The bamboo gene editing reagent comprises an engineered bacterium. Selecting a leaf of a bamboo seedling for infection.