Dihydropyrimidine derivatives containing boronic acid and pinacol boronate groups, and methods of making and using the same

Abstract

The present application provides a kind of boronic acid and boronic acid pinacol ester dihydropyrimidine derivative and its preparation method and application.The compound has the structure shown in formula I.The present application also relates to the preparation method of the compound containing formula I structure, pharmaceutical composition and the application of the above-mentioned compound in the preparation of anti-HBV drugs.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of medicine, and particularly relates to a dihydropyrimidine derivative containing a boronic acid and a boronic pinacol ester group, and the present application also relates to a preparation method and an anti-HBV pharmaceutical application of the derivative. BACKGROUND

[0002] After hepatitis B virus (HBV) infects hepatocytes, it causes immune responses in the host to result in liver cell damage and inflammatory necrosis, i.e., acute or chronic hepatitis B. Chronic hepatitis B (CHB) can further develop into life-threatening diseases, such as liver cirrhosis or hepatocellular carcinoma (HCC). Currently, drugs for treating hepatitis B have the disadvantages of severe adverse reactions, rebound after drug withdrawal, drug resistance, and the like, and cannot meet the clinical needs. Therefore, there is an urgent need to develop highly efficient and low-toxicity anti-HBV drugs acting on new targets.

[0003] The HBV capsid is an important component of the virus, which encapsulates and protects the internal genome, interacts with host proteins to regulate the viral replication cycle, and is relatively conserved in the process of viral evolution. The stability of the HBV capsid and normal assembly are crucial for the production of infectious virus particles. HBV capsid assembly modulators inhibit HBV replication by accelerating the assembly of core proteins into abnormal or normal capsids, and the structural types thereof mainly include acrylamides, benzenesulfonamides, dihydropyrimidines, and the like. However, no drug for this target has been marketed. In view of the shortcomings of the currently clinically candidate drugs, such as strong hepatotoxicity, poor water solubility, and poor metabolic stability, and according to the structure of the HBV capsid-ligand complex, a target-based rational drug design is performed, and a dihydropyrimidine derivative containing a boronic acid and a boronic pinacol ester group is designed and synthesized. This kind of compound has not been reported in the prior art. SUMMARY

[0004] The present application provides a dihydropyrimidine derivative containing a boronic acid and a boronic pinacol ester group and a preparation method thereof, and further provides an activity screening result of the compound as an HBV inhibitor and a pharmaceutical application thereof.

[0005] The technical scheme of the present application is as follows:

[0006] I. A dihydropyrimidine derivative containing a boronic acid and a boronic pinacol ester group

[0007] The present application relates to a dihydropyrimidine derivative containing a boronic acid and a boronic pinacol ester group, or an enantiomer, a diastereomer thereof, or a pharmaceutically acceptable salt thereof, which has the structure shown in the following general formula I:

[0008]

[0009] wherein,

[0010] A is: a three to six-membered aliphatic or aromatic ring;

[0011] R1 is: a boronic acid or pinacol boronic ester;

[0012] R2 is: methylene, amide, sulfonamide, phosphonamide, oxamide;

[0013] R3, R4, R5 are each independently selected from: H, methyl, halogen atom, cyano;

[0014] R6 is: methyl or ethyl.

[0015] According to the present application, preferably, A is piperazine or tetrahydropyrrole, and R1 is as follows:

[0016]

[0017] According to the present application, further preferably, the dihydropyrimidine derivative containing a boronic acid and a pinacol boronic ester group is one of the compounds having the following structures:

[0018] Table 1. Structures of dihydropyrimidine derivatives containing a boronic acid and a pinacol boronic ester group of the target compounds

[0019]

[0020]

[0021]

[0022]

[0023] II. Preparation method of dihydropyrimidine derivative containing a boronic acid or pinacol boronic ester group

[0024] The preparation method of dihydropyrimidine derivative containing a boronic acid or pinacol boronic ester group is one of the following:

[0025] 1. Synthesis of compounds CAB1-5: 2-thiazolecarboxamidine hydrochloride (1) as starting material, Biginelli reaction with 2-bromo-4-fluorobenzaldehyde, ethyl acetoacetate in anhydrous ethanol to cyclize to obtain intermediate 2; then, substitution reaction of 2 with N-bromosuccinimide in dichloromethane to obtain key intermediate 3; then, nucleophilic substitution reaction of 3 with 1-Boc-piperazine in acetonitrile to obtain intermediate 4; removal of Boc protecting group of 4 under the action of trifluoroacetic acid to obtain intermediate 5; nucleophilic substitution reaction of 5 with boronic acid or pinacol boronate fragment in N,N-dimethylformamide to obtain target compounds CAB1-5;

[0026] The synthetic route is as follows:

[0027]

[0028] Reagents and conditions: (i) 2-bromo-4-fluorobenzaldehyde, ethyl acetoacetate, sodium acetate, ethanol, 80°C; (ii) N-bromosuccinimide, dichloromethane, 40°C; (iii) 1-Boc-piperazine, potassium carbonate, potassium iodide, acetonitrile, 75°C; (iv) trifluoroacetic acid, dichloromethane, room temperature; (v) boronic acid or pinacol boronate fragment, N,N-diisopropylethylamine, N,N-dimethylformamide, room temperature.

[0029] wherein,

[0030] R1 is boronic acid or pinacol boronate.

[0031] The room temperature described in the present application is 20-30°C.

[0032] According to the present application, the preparation method of dihydropyrimidine derivatives containing boronic acid and pinacol boronate groups is preferably as follows:

[0033] (1) 2-thiazolecarboxamidine hydrochloride (1), 2-bromo-4-fluorobenzaldehyde and sodium acetate are dissolved in anhydrous ethanol, and ethyl acetoacetate is added under stirring at room temperature, and ethanol is refluxed at 80°C for 8h; after the reaction is completed, extraction is performed, and fast column chromatography is used for separation, and recrystallization to obtain compound 2;

[0034] (2) Compound 2 is dissolved in dichloromethane, and N-bromosuccinimide is added in small amounts for several times under stirring at room temperature, and refluxed for 1.5h; after the reaction is completed, extraction is performed, and fast column chromatography is used for separation, and recrystallization to obtain compound 3;

[0035] (3) Compound 3, 1-Boc-piperazine, potassium carbonate and potassium iodide are weighed and dissolved in acetonitrile, and refluxed at 75°C for one hour. After the reaction is completed, extraction is performed, and fast column chromatography is used for separation, and recrystallization to obtain compound 4;

[0036] (4) Compound 4 was dissolved in dichloromethane, trifluoroacetic acid was added dropwise, stirred at room temperature for 10 h. After the reaction was completed, extraction was performed, and the solvent was evaporated to obtain the target compound 5;

[0037] (5) Compound 5 was dissolved in N,N-dimethylformamide, different boronic acid or pinacol boronate fragments were added, and N,N-diisopropylethylamine was added under stirring; after the reaction was completed, extraction was performed, and fast column chromatography separation and recrystallization were performed to obtain the target compound CAB1-CAB5.

[0038] 2. Synthesis of compounds CAB7-CAB18: nucleophilic substitution reaction of intermediate 3 with proline or 3-pyrrolidine carboxylic acid in anhydrous ethanol to generate intermediate 6a or 6b; then, amide condensation reaction of 6a or 6b with a boronic acid or pinacol boronate fragment using 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate as a condensing agent under the action of N,N-diisopropylethylamine to obtain the target compound CAB7-CAB18;

[0039] The synthesis route is as follows:

[0040]

[0041] Reagents and conditions: (i) proline or 3-pyrrolidine carboxylic acid, potassium carbonate, anhydrous ethanol, room temperature; (ii) boronic acid or pinacol boronate fragment, 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate, N,N-diisopropylethylamine, dichloromethane, 0°C, room temperature.

[0042] wherein,

[0043] R1 is a boronic acid or pinacol boronate.

[0044] The room temperature described in the present application is 20-30°C.

[0045] According to the present application, the preparation method of the dihydropyrimidine derivative containing a boronic acid and a pinacol boronate group is preferably as follows:

[0046] (1) Intermediate 3 was dissolved in anhydrous ethanol, proline or 3-pyrrolidine carboxylic acid and potassium carbonate were sequentially added, and stirred at room temperature overnight. After the reaction was completed, filtration was performed, fast column chromatography separation and recrystallization were performed to obtain intermediate 6a or 6b;

[0047] (2) Intermediate 6a or 6b and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate were weighed, dissolved in dichloromethane, and stirred in an ice bath for 30 min; N,N-diisopropylethylamine and boronic acid or pinacol boronate fragment were sequentially added, and stirred at room temperature for 2-4 h; after the reaction was completed, extraction was performed, fast column chromatography separation and recrystallization were performed to obtain the target compound CAB7-CAB18.

[0048] 3. Synthesis of compounds CAB7-1~8-4: intermediates 3 were separated by chiral high performance liquid chromatography to obtain 3a and 3b, then nucleophilic substitution reaction of 3a or 3b with D-proline or L-proline in anhydrous ethanol to obtain intermediates 6(c-f); amide condensation reaction of 6(c-f) with boronic acid fragments with 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate as condensing agent in the presence of N,N-diisopropyl ethylamine to obtain target compounds CAB7-1~8-4;

[0049] The synthesis route is as follows:

[0050]

[0051] Reagents and conditions: (i) chiral high performance liquid chromatography separation; (ii) D-proline or L-proline, potassium carbonate, anhydrous ethanol, room temperature; (iii) boronic acid fragments, 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate, N,N-diisopropyl ethylamine, dichloromethane, 0°C, room temperature.

[0052] Wherein, R1 is boronic acid.

[0053] The room temperature described in the application is 20-30°C.

[0054] According to the application, the preparation method of the dihydropyrimidine derivative containing boronic acid and boronic acid pinacol ester groups is preferably as follows:

[0055] (1) chiral high performance liquid chromatography separation of chiral isomers using a large cellulose chiral chromatographic column CHIRALPAK AD-H, collecting fractions, and evaporating the solvent to obtain 3a or 3b;

[0056] (2) Intermediate 3a or 3b is dissolved in anhydrous ethanol, and D-proline or L-proline and potassium carbonate are sequentially added, and stirred at room temperature overnight. After the reaction is completed, filtration, flash column chromatography separation, and recrystallization to obtain intermediate 6(c-f);

[0057] (3) Intermediate 6(c-f) and 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate are weighed and dissolved in dichloromethane, and stirred in an ice bath for 30 min; then N,N-diisopropyl ethylamine and boronic acid or boronic acid pinacol ester fragments are sequentially added, and stirred at room temperature for 2-4 h; after the reaction is completed, extraction, flash column chromatography separation, and recrystallization to obtain target compounds CAB7-1~8-4.

[0058] III. Application of dihydropyrimidine derivatives containing boronic acid and boronic acid pinacol ester groups

[0059] The application discloses screening results of dihydropyrimidine derivatives containing boronic acid and boronic acid pinacol ester groups and application thereof.

[0060] 22 target compounds (compound structural formula is shown in Table 1) are synthesized according to the above method, and the inhibition of HBV DNA replication activity under the action of the drugs is determined by a PCR method, and the cytotoxicity of the compounds is determined by an MTS method; meanwhile, a lead compound GLS4 and a marketed drug lamivudine are selected as positive controls. Five concentration gradients are set for each compound, and CC 50 , EC 50 and a selectivity coefficient SI are calculated.

[0061] The dihydropyrimidine derivatives containing boronic acid and boronic acid pinacol ester groups are novel non-nucleoside HBV inhibitors, and can be used as lead compounds of anti-HBV drugs.

[0062] The dihydropyrimidine derivatives containing boronic acid and boronic acid pinacol ester groups can be used as non-nucleoside HBV inhibitors. Specifically, the dihydropyrimidine derivatives containing boronic acid and boronic acid pinacol ester groups are used as HBV inhibitors to prepare anti-hepatitis B drugs.

[0063] An anti-HBV drug composition comprises the dihydropyrimidine derivatives containing boronic acid and boronic acid pinacol ester groups and one or more pharmaceutically acceptable carriers or excipients.

[0064] The application discloses dihydropyrimidine derivatives containing boronic acid and boronic acid pinacol ester groups, a preparation method thereof, screening results of anti-HBV activity and first application thereof as anti-HBV inhibitors. Experiments prove that the dihydropyrimidine derivatives containing boronic acid and boronic acid pinacol ester groups can be used as HBV inhibitors to prepare anti-hepatitis B drugs. DETAILED DESCRIPTION

[0065] The following examples are helpful for understanding the application, but cannot limit the content of the application, and in the following examples, the numbers of all target compounds are the same as those in Table 1.

[0066] A synthesis route of the compounds CAB1 to CAB5 is as follows:

[0067]

[0068] Reagents and conditions: (i) 2-bromo-4-fluorobenzaldehyde, ethyl acetoacetate, sodium acetate, ethanol, 80°C; (ii) N-bromosuccinimide, dichloromethane, 40°C; (iii) 1-Boc-piperazine, potassium carbonate, potassium iodide, acetonitrile, 75°C; (iv) trifluoroacetic acid, dichloromethane, room temperature; (v) boric acid or pinacol ester fragment of borate, N,N-diisopropylethylamine, N,N-dimethylformamide, room temperature.

[0069] Example 1. Preparation of Compound 2

[0070] Weigh 3.72 g (18.32 mmol) of 2-bromo-4-fluorobenzaldehyde, 2.0 g (12.22 mmol) of 2-thiazolylformamidin hydrochloride, and 2.0 g (24.38 mmol) of sodium acetate, dissolve them in 100 mL of anhydrous ethanol, and add 2.34 mL (18.29 mmol) of ethyl acetoacetate while stirring. Reflux at 80 °C for 12 h and monitor the reaction by TLC. After the reaction is complete, filter while hot, and let the filtrate stand overnight. Yellow crystals (2) precipitate out. Filter and wash the filter cake with mother liquor. Collect the filtrate, separate by column chromatography, recrystallize from the ethyl acetate-petroleum ether system, and combine the filter cakes to obtain 4.22 g of yellow powder, with a yield of 81.6%.

[0071] 1 H NMR(400MHz,DMSO-d6)δ9.92(s,1H NH),7.96(dd,J=3.2,1.1Hz,1H),7.89(dd,J=3.2,1.1Hz,1H),7.54(ddd,J=8.5,2.7,1.1Hz,1H),7.38–7.31(m,1H ),7.23(td,J=8.7,2.5Hz,1H,5.95(s,1H),3.92(q,J=7.0Hz,2H),2.46(s,3H),1.02(t,J=7.1Hz,3H); ESI-MS:m / z 424.4[M+H] + 426.2[M+2+H] + C 17 H 15 BrFN3O2S[423.01].

[0072] Example 2. Preparation of Compound 3

[0073] Intermediate 2 (2.0 g, 4.71 mmol) was dissolved in 30 mL of dichloromethane, N-bromosuccinimide (0.92 g, 5.19 mmol) was added in small portions at room temperature, after the addition was completed, it was refluxed at 40 °C for 2 h, TLC monitoring. Most of the solvent was removed under reduced pressure, 20 mL of water was added, extracted with ethyl acetate (20 mL) for 3 times, the organic phase was collected, washed with saturated NaCl solution, dried over anhydrous magnesium sulfate, filtered, separated by column chromatography, and recrystallized from petroleum ether-ethyl acetate system to obtain 1.53 g of yellow powder with a yield of 64.51%.

[0074] 1 H NMR (400 MHz, CDC13) δ 7.84 (d, J = 3.1 Hz, 1H), 7.52 (s, 2H), 7.44 - 7.35 (m, 1H), 7.32 (dd, J = 8.1, 2.6 Hz, 1H), 7.02 (t, J = 8.0 Hz, 1H), 6.09 (s, 1H), 4.94 (d, J = 8.9 Hz, 1H), 4.61 (s, 1H), 4.09 (d, J = 7.0 Hz, 2H), 1.16 (t, J = 7.1 Hz, 3H); ESI-MS: m / z 501.97 [M+2-H] - , 525.80 [M+2+Na] - ; C 17 H 14 Br2FN3O2S [500.92].

[0075] Example 3. Preparation of compound 4

[0076] Intermediate 3 (1.50 g, 2.98 mmol), 1-Boc-piperazine (555 mg, 2.98 mmol), potassium carbonate (618 mg, 4.47 mmol) and potassium iodide (742 mg, 4.47 mmol) were weighed and dissolved in 20 mL of acetonitrile, refluxed at 75 °C for 1 h, TLC monitoring. After the reaction was completed, most of the solvent was removed under reduced pressure, 20 mL of water was added, extracted with dichloromethane (20 mL) for 3 times, the organic phase was washed with saturated NaCl solution, dried over anhydrous magnesium sulfate, filtered, and separated by column chromatography. Recrystallized from dichloromethane-n-hexane system to obtain 1.58 g of yellow powder with a yield of 87.10%.

[0077] 1H NMR (400 MHz, DMSO-d6) δ 9.69 (s, 1H, NH, dihydropyrimidine-H), 8.00 (s, 1H, thiazole-H), 7.93 (s, 1H, thiazole-H), 7.56 (d, J = 8.1 Hz, 1H, Ph-H), 7.37 (m, 1H, Ph-H), 7.22 (s, 1H, Ph-H), 6.02 (s, 1H, dihydropyrimidine-H), 4.08 - 3.79 (m, 4H, dihydropyrimidine-CH2, CH 2 CH3), 3.31 (s, 4H, CH2NCH2), 2.50 (s, 4H, 2xBocNCH2), 1.39 (s, 9H, Boc), 1.05 (t, J = 6.9 Hz, 3H, CH2CH 3 ) ESI-MS: m / z 610.3 [M+2+H] + ; C 26 H 31 BrFN5O4S [607.13].

[0078] Example 4. Preparation of compound 5

[0079] Intermediate 4 (800 mg, 1.31 mmol) was dissolved in 4 mL of dichloromethane, trifluoroacetic acid 0.5 mL was added dropwise under ice bath, the solution color became dark. After dropwise, it was stirred at room temperature overnight, TLC was used to monitor the reaction. After the reaction was completed, 20 mL of saturated NaHCO3was added, and a large amount of bubbles was generated. Dichloromethane (20 mL) was extracted for 3 times, the organic phase was collected, dried over anhydrous magnesium sulfate, and the solvent was removed by reduced pressure distillation to obtain 626.6 mg of crude product, which was directly used in the next step, with a yield of 93.75%. ESI-MS: m / z 508.28 [M+H] + ; C 21 H 23 BrFN5O2S [507.07].

[0080] Example 5. Preparation of target products CAB1-5

[0081] Intermediate 5 (100 mg, 0.197 mmol) was dissolved in N,N-dimethylformamide (5 mL), and DIPEA (46 μL, 0.275 mmol), boronic acid or pinacol borate fragment (0.256 mmol) was added in turn under stirring, and the reaction was carried out at room temperature for 4-6 h, TLC was used to monitor the reaction. After the reaction was completed, 30 mL of water was added, and ethyl acetate (10 mL) was extracted for 3 times, and washed with saturated sodium chloride solution, and dried over anhydrous magnesium sulfate. Filtration, the filtrate was concentrated under reduced pressure, and fast column chromatography was used for separation, and the target compounds CAB1-5 were obtained by recrystallization in dichloromethane-n-hexane system.

[0082] The boronic acid or pinacol boronate fragment used was 4-bromomethylphenylboronic acid. Product CAB1 was a yellow solid, yield 65%, m.p.: 164-167 °C. 1 H NMR (400 MHz, DMSO-d6) δ 9.64 (s, 1 H, NH, dihydropyrimidine-H), 8.01 (d, J = 3.2 Hz, 1 H, thiazole-H), 7.95 (s, 2H, BOH x 2), 7.94 (d, J = 3.2 Hz, 1 H, thiazole-H), 7.75 (d, J = 7.6 Hz, 2H, Ph-H), 7.55 (dd, J = 8.6, 2.6 Hz, 1 H, Ph-H), 7.37 (dd, J = 8.7, 6.1 Hz, 1 H, Ph-H), 7.28 (d, J = 7.6 Hz, 2H, Ph-H), 7.21 (td, J = 8.5, 2.7 Hz, 1 H, Ph-H), 6.02 (s, 1 H, dihydropyrimidine-H), 3.95 (q, J = 7.1 Hz, 2H, COOCH2), 3.92 - 3.83 (m, 2H, dihydropyrimidine-CH2), 3.52 (s, 2H, Bz-H), 2.56 (s, 6H, piperazine), 2.47 (s, 2H, piperazine), 1.05 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (100 MHz, DMSO-d6) δ 165.64 (C=0), 162.51, 161.24 (d, 1 J CF = 248.3 Hz), 147.10, 144.37, 144.07, 140.67 (d, 4 J CF = 3.3 Hz), 140.46, 134.53, 131.36 (d, 3 J CF = 8.9 Hz), 128.42, 125.17, 123.03 (d, 3 J CF = 9.6 Hz), 120.05 (d, 2 J CF = 24.6 Hz), 115.96 (d, 2 J CF = 20.7 Hz), 97.42, 62.52, 59.84, 58.64, 56.06, 53.36, 53.25, 14.45, 14.43. ESI-MS: m / z 644.76 [M+2+H] + .C28 H 30 BBrFN5O4S[641.13].

[0083] The boronic acid or pinacol boronate fragment used was 3-bromomethylphenylboronic acid. Product CAB2 was a yellow solid, yield 62%, m.p. 146-149 °C. 1 H NMR (400 MHz, DMSO-d6) δ 9.66 (s, 1H, dihydropyrimidine-H), 8.02 (d, J = 3.2 Hz, 1H, thiazole-H), 8.00 (s, 2H, BOH x 2), 7.94 (d, J = 3.2 Hz, 1H, thiazole-H), 7.73 (s, 1H, Ph-H), 7.69 (d, J = 7.2 Hz, 1H, Ph-H), 7.56 (dd, J = 8.6, 2.7 Hz, 1H, Ph-H), 7.40 - 7.34 (m, 2H, Ph-H), 7.30 (t, J = 7.4 Hz, 1H, Ph-H), 7.21 (td, J = 8.5, 2.7 Hz, 1H, Ph-H), 6.02 (s, 1H, dihydropyrimidine-H), 3.95 (q, J = 7.1 Hz, 2H, COOCH2), 3.92 - 3.84 (m, 2H, dihydropyrimidine-CH2), 3.51 (s, 2H, Bz-H), 2.56 (s, 5H, piperazine), 2.48 (s, 3H, piperazine), 1.05 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (100 MHz, DMSO-d6) δ 165.64 (C=0), 162.51, 161.24 (d, 1 J CF = 248.1 Hz), 147.12, 144.37, 144.07, 140.67 (d, 4 J CF = 3.2 Hz), 137.25, 135.43, 133.30, 131.36 (d, 3 J CF = 9.4 Hz), 131.27, 127.68, 125.17, 123.02 (d, 3 J CF = 9.8 Hz), 120.05 (d, 2 J CF = 24.5 Hz), 115.97 (d, 2 J CF= 21.0 Hz), 97.39, 62.81, 59.83, 58.64, 56.07, 53.33, 53.25, 14.45. ESI-MS: m / z 644.72 [M+2+H] + .C 28 H 30 BBrFN5O4S[641.13].

[0084] The boronic acid or pinacol boronate fragment used was 2-bromomethylphenylboronic acid. Product CAB3 was a yellow solid, yield 31%, melting point: 173-176 °C. 1 H NMR (400 MHz, DMSO-d6) δ 9.59 (s, 1H, dihydropyrimidine-H), 9.13 (s, 2H, BOH x 2), 8.05 (d, J = 3.2 Hz, 1H, thiazole-H), 7.96 (d, J = 3.1 Hz, 1H, thiazole-H), 7.69 (dd, J = 7.1, 1.7 Hz, 1H, Ph-H), 7.56 (dd, J = 8.5, 2.7 Hz, 1H, Ph-H), 7.38 (dd, J = 8.8, 6.2 Hz, 1H, Ph-H), 7.33 - 7.28 (m, 1H, Ph-H), 7.28 - 7.25 (m, 1H, Ph-H), 7.24 (q, J = 2.7, 2.0 Hz, 1H, Ph-H), 7.20 (dd, J = 8.5, 2.6 Hz, 1H, Ph-H), 6.02 (s, 1H, dihydropyrimidine-H), 3.96 (t, J = 7.1 Hz, 2H, COOCH2), 3.94 - 3.86 (m, 2H, dihydropyrimidine-CH2), 3.63 (s, 2H, Bz-H), 2.88 - 2.53 (m, 8H, piperazine), 1.05 (t, J = 7.0 Hz, 3H, CH3). 13 C NMR (100 MHz, DMSO-d6) δ 165.64 (C=0), 162.53, 161.22 (d, 1 J CF = 242.6 Hz), 146.79, 144.36, 144.09, 141.60, 140.62 (d, 4 J CF = 3.6 Hz), 135.67, 131.37 (d, 3 J CF = 8.5 Hz), 130.51, 129.66, 127.29, 125.21, 123.04 (d, 3 J CF= 9.9 Hz), 120.06 (d, J = 21.5 Hz), 97.69, 63.25, 59.88, 58.63, 55.83, 52.73, 52.19, 14.45, 14.41. ESI-MS: m / z 642.4 [M+H] 2 J CF = 24.6 Hz), 115.96 (d, J = 21.5 Hz), 97.69, 63.25, 59.88, 58.63, 55.83, 52.73, 52.19, 14.45, 14.41. ESI-MS: m / z 642.4 [M+H] 2 J CF = 21.5 Hz), 97.69, 63.25, 59.88, 58.63, 55.83, 52.73, 52.19, 14.45, 14.41. ESI-MS: m / z 642.4 [M+H] + .C 28 H 30 BBrFN5O4S[641.13].

[0085] The boronic acid or pinacol boronate fragment used was 4-bromomethylphenylboronic acid pinacol ester. Product CAB4 was a yellow solid in 44% yield, m.p. 160-162 °C. 1 H NMR (400 MHz, DMSO-d6) δ 9.64 (s, 1H, dihydropyrimidine-H), 8.01 (d, J = 3.1 Hz, 1H, thiazole-H), 7.94 (d, J = 3.1 Hz, 1H, thiazole-H), 7.66 - 7.63 (m, 2H, Ph-H), 7.56 (dd, J = 8.6, 2.7 Hz, 1H, Ph-H), 7.39 - 7.36 (m, 1H, Ph-H), 7.36 - 7.33 (m, 2H, Ph-H), 7.21 (td, J = 8.4, 2.7 Hz, 1H, Ph-H), 6.01 (s, 1H, dihydropyrimidine-H), 3.95 (q, J = 7.0 Hz, 2H, COOCH2), 3.91 - 3.83 (m, 2H, dihydropyrimidine-CH2), 3.54 (s, 2H, Bz-H), 2.56 (s, 4H, piperazine), 2.47 (s, 4H, piperazine), 1.29 (s, 12H, CH3x4), 1.04 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 165.60 (C=0), 162.49, 161.21 (d, J = 248.3 Hz), 147.05, 144.33, 143.99, 140.65 (d, J = 3.1 Hz), 134.83, 134.72, 131.33 (d, J = 21.5 Hz), 97.69, 63.25, 59.88, 58.63, 55.83, 52.73, 52.19, 14.45, 14.41. 1 J CF = 248.3 Hz), 147.05, 144.33, 143.99, 140.65 (d, J = 3.1 Hz), 134.83, 134.72, 131.33 (d, J = 21.5 Hz), 97.69, 63.25, 59.88, 58.63, 55.83, 52.73, 52.19, 14.45, 14.41. 4 J CF = 3.1 Hz), 134.83, 134.72, 131.33 (d, J = 21.5 Hz), 97.69, 63.25, 59.88, 58.63, 55.83, 52.73, 52.19, 14.45, 14.41. 3 J CF=8.4Hz),128.81,126.11,125.13,123.00(d, 3 J CF =9.9Hz), 120.01(d, 2 J CF =24.3Hz), 115.91(d, 2 J CF =21.0Hz),97.38,83.99,63.19,62.38,59.80,58.62,56.02,53.30,53.18,25.11,14.42.ESI-MS:m / z 724.27[M+H] + .C 34 H 40 BBrFN5O4S[723.21].

[0086] The boric acid or pinacol ester fragment used was 3-bromomethylphenylboronic acid pinacol ester. The product CAB5 was a yellow solid with a yield of 41% and a melting point of 171-173℃. 1 H NMR(400MHz,DMSO-d6)δ9.65(s,1H,dihydropyrimidine-H),8.01(d,J=3.2Hz,1H,thiazole-H),7.94(d,J=3.2Hz,1H,thiazole -H),7.63(s,1H,Ph-H),7.60–7.53(m,2H,Ph-H),7.45(d,J=7.6Hz,1H,Ph-H),7.37(dd,J=8.7,6.3Hz,2H,Ph-H),7.21(td,J=8.5, 2.7Hz,1H,Ph-H),6.01(s,1H,dihydropyrimidine-H),3.95(q,J=6.0,5.1Hz,2H,COOCH2),3.92–3.83(m,2H,dihydropyrimidine e-CH2),3.51(s,2H,Bz-H),2.55(s,4H,piperazine),2.47(s,4H,piperazine),1.30(s,12H,CH3×4),1.05(t,J=7.1Hz,3H,CH3). 13 C NMR(150MHz,DMSO-d6)δ165.60(C=O),162.50,161.21(d, 1 J CF =248.6Hz),147.03,144.34,143.99,140.66(d, 4 J CF= 9.0 Hz), 130.06, 128.83, 128.18, 125.12, 123.00 (d, 3 J CF = 9.0 Hz), 130.06, 128.83, 128.18, 125.12, 123.00 (d, 3 J CF = 9.8 Hz), 120.01 (d, 2 J CF = 24.4 Hz), 115.91 (d, 2 J CF = 21.0 Hz), 97.41, 84.07, 62.39, 59.80, 58.62, 56.02, 53.20, 25.14, 14.42. ESI-MS: m / z 725.92 [M+2+H] + .C 34 H 40 BBrFN5O4S [723.21].

[0087] Synthetic route of compounds CAB7-18:

[0088]

[0089] Reagents and conditions: (i) proline or 3-pyrrolidinecarboxylic acid, potassium carbonate, anhydrous ethanol, room temperature; (ii) boronic acid or pinacol boronic ester fragment, 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, N,N-diisopropylethylamine, dichloromethane, 0 °C, room temperature.

[0090] Example 6. Preparation of compounds 6(a-b)

[0091] Intermediate 3 (500 mg, 0.994 mmol) was dissolved in 10 mL of anhydrous ethanol, proline or 3-pyrrolidinecarboxylic acid (114 mg, 0.994 mmol), potassium carbonate (275 mg, 1.99 mmol) were added successively, stirred at room temperature overnight, monitored by TLC. After the reaction was completed, filtered, separated by column chromatography. Recrystallized in dichloromethane-n-hexane system to obtain intermediate 6a or 6b.

[0092] The raw material used was intermediate 3 and proline. The product 6a was a yellow solid with a yield of 82%. 1H NMR (400 MHz, DMSO) δ 9.86 (d, J = 21.6 Hz, 1H, NH, dihydropyrimidine-H), 7.99 (dd, J = 5.7, 3.2 Hz, 1H, thiazole-H), 7.95 - 7.85 (m, 1H, thiazole-H), 7.57 (dd, J = 8.6, 2.6 Hz, 1H, Ph-H), 7.38 (q, J = 6.6 Hz, 1H, Ph-H), 7.29 - 7.16 (m, 1H, Ph-H), 6.01 (d, J = 9.1 Hz, 1H, dihydropyrimidine-H), 4.28 (d, J = 16.8 Hz, 1H, dihydropyrimidine-CH2), 4.12 - 4.00 (m, 1H, dihydropyrimidine-CH2), 3.96 (q, J = 6.8 Hz, 2H, COOCH2), 3.49 (s, 1H, CH), 3.07 (s, 1H, CH2), 2.66 - 2.54 (m, 1H, CH2), 2.20 (dtt, J = 16.5, 12.2, 6.8 Hz, 1H, CH2), 1.97 - 1.74 (m, 3H, CH2), 1.05 (t, J = 6.2 Hz, 3H, CH3). ESI-MS: m / z 535.17 [M-H] - ,539.13 [M+2+H] + .C 22 H 22 BrFN4O4S [536.05].

[0093] The starting materials used were intermediate 3 and 3-pyrrolidinecarboxylic acid. The product 6b was a yellow solid in 87% yield. 1H NMR (600 MHz, DMSO) δ 9.53 (d, J = 15.5 Hz, 1H, NH, dihydropyrimidine-H), 7.99 (d, J = 3.1 Hz, 1H, 1H, thiazole-H), 7.94 (s, 1H, thiazole-H), 7.57 (dt, J = 8.5, 2.4 Hz, 1H, Ph-H), 7.45 - 7.35 (m, 1H, Ph-H), 7.24 (td, J = 8.5, 2.7 Hz, 1H, Ph-H), 6.02 (s, 1H, dihydropyrimidine-H), 4.03 (s, 2H, dihydropyrimidine-CH2), 4.00 - 3.92 (m, 2H, COOCH2), 3.45 (q, J = 7.0 Hz, 1H, CH), 3.14 - 2.95 (m, 2H, CH2), 2.77 - 2.62 (m, 2H, CH2), 2.15 - 2.00 (m, 2H, CH2), 1.06 (td, J = 7.1, 2.6 Hz, 3H, CH3). ESI-MS: m / z 539.02 [M+2+H] + .C 22 H 22 BrFN4O4S [536.05].

[0094] Example 7. Preparation of target product CAB7-18

[0095] Intermediate 6a or 6b (100 mg, 0.186 mmol), 2-(7-azabenzotriazole)-N,N,N',N'- tetramethyluronium hexafluorophosphate (106 mg, 0.279 mmol) were weighed into 5 mL of dichloromethane and stirred in an ice bath for 30 min. N,N-diisopropylethylamine (DIPEA, 92 μL, 0.558 mmol) and boronic acid or pinacol boronate fragment (0.223 mmol) were added successively and stirred at room temperature for 2-4 h, monitored by TLC. After the reaction was completed, 20 mL of water was added to the reaction solution, extracted with dichloromethane (20 mL) for 3 times, collected the organic phase and washed with saturated NaCl solution once, dried over anhydrous magnesium sulfate. Filtered, the filtrate was concentrated under reduced pressure, separated by flash column chromatography, and recrystallized in dichloromethane-n-hexane system to obtain the target compound CAB7-18.

[0096] The raw materials used were intermediate 6a and 4-aminobenzeneboronic acid. The product CAB7 was a yellow solid with a yield of 64%, melting point: 167-169 °C. 1H NMR (400 MHz, DMSO-d6) δ 10.00 (d, J = 37.2 Hz, 1H, CONH), 9.85 (d, J = 32.6 Hz, 1H, dihydropyrimidine-H), 8.00 (dd, J = 22.9, 3.3 Hz, 1H, thiazole-H), 7.92 (dd, J = 11.0, 3.2 Hz, 1H, thiazole-H), 7.87 (s, 2H, BOH x 2), 7.67 (d, J = 8.1 Hz, 2H, Ph-H), 7.59 - 7.54 (m, 1H, Ph-H), 7.54 - 7.49 (m, 2H, Ph-H), 7.37 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 7.24 - 7.18 (m, 1H, Ph-H), 5.98 (d, J = 15.3 Hz, 1H, dihydropyrimidine-H), 4.21 - 4.03 (m, 2H, COOCH2), 3.92 (p, J = 7.0 Hz, 2H, dihydropyrimidine-CH2), 3.56 (td, J = 9.2, 5.2 Hz, 1H, CH), 3.24 (q, J = 5.6 Hz, 1H, CH2), 2.66 (dt, J = 15.2, 7.3 Hz, 1H, CH2), 2.29 - 2.15 (m, 1H, CH2), 2.01 - 1.81 (m, 3H, CH2), 1.02 (td, J = 7.1, 3.2 Hz, 3H, CH3). 13 C NMR (100 MHz, DMSO-d6) δ 172.35 (C=0), 165.71 (C=0), 162.67, 161.12 (d, 1 J CF = 259.7 Hz), 147.87, 147.66, 144.61, 144.56, 144.04, 143.90, 140.85 (d, 2 J CF = 17.1 Hz), 135.23, 135.16, 131.22 (d, 3 J CF = 8.1 Hz), 124.99 (d, 3 J CF = 5.7 Hz), 118.58, 118.54, 115.93 (d, 2 J CF = 20.8 Hz), 97.71, 67.27, 59.88, 58.50, 52.69, 30.29, 24.12, 14.39. ESI-MS: m / z 656.4 [M+H] + .C 28H 28 BBrFN5O5S[655.11].

[0097] The starting material used was intermediate 6a and 3-aminobenzeneboronic acid. The product CAB8 was a yellow solid with a yield of 58% and a melting point of 175-178 °C. 1 H NMR (400 MHz, DMSO-d6) δ 9.95 (d, J = 4.3 Hz, 1H, CONH), 9.83 (d, J = 3.7 Hz, 1H, dihydropyrimidine-H), 8.03 - 7.98 (m, 1H, thiazole-H), 7.97 (d, J = 4.0 Hz, 2H, BOH x 2), 7.94 - 7.87 (m, 2H, thiazole-H, Ph-H), 7.75 - 7.67 (m, 1H, Ph-H), 7.53 (ddd, J = 11.4, 8.5, 2.7 Hz, 1H, Ph-H), 7.47 (t, J = 6.3 Hz, 1H, Ph-H), 7.40 - 7.24 (m, 1H, Ph-H), 7.21 (t, J = 7.5 Hz, 2H, Ph-H), 5.99 (d, J = 11.5 Hz, 1H, dihydropyrimidine-H), 4.23 - 4.02 (m, 2H, COOCH2), 3.94 (p, J = 7.1 Hz, 2H, dihydropyrimidine-CH2), 3.55 (dd, J = 8.9, 5.2 Hz, 1H, CH), 3.19 (dd, J = 9.1, 4.9 Hz, 1H, CH2), 2.65 (p, J = 8.1 Hz, 1H, CH2), 2.29 - 2.18 (m, 1H, CH2), 1.97 - 1.82 (m, 3H, CH2), 1.02 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.21 (C=0), 172.07 (C=0), 165.73 (C=0), 165.68 (C=0), 162.68, 162.58, 161.15 (d, 1 J CF = 248.4 Hz), 161.07 (d, 1 J CF = 248.1 Hz), 147.88, 147.79, 144.59, 144.56, 144.06, 143.95, 140.92 (d, 4 J CF = 2.8 Hz), 140.87 (d, 4 J CF = 3.7 Hz), 138.40, 138.32, 131.22 (d,3 J CF = 8.6 Hz), 131.16 (d, 3 J CF = 8.9 Hz), 129.63, 129.57, 127.97, 127.91, 125.82, 124.89, 124.82, 122.92 (d, 3 J CF = 9.9 Hz), 122.85 (d, 3 J CF = 10.1 Hz), 121.79, 121.76, 120.00 (d, 2 J CF = 16.0 Hz), 119.84 (d, 2 J CF = 15.7 Hz), 115.91 (d, 2 J CF = 22.1 Hz), 115.75 (d, 2 J CF = 16.6 Hz), 97.64, 97.55, 67.21, 67.12, 59.86, 59.84, 58.48, 58.44, 54.63, 54.29, 52.64, 30.46, 30.21, 24.15, 24.06, 14.37. ESI-MS: m / z 658.4 [M+2+H] + .C 28 H 28 BBrFN5O5S [655.11].

[0098] The starting materials used were intermediate 6a and 4-aminophenylboronic acid pinacol ester. The product CAB 10 was a yellow solid with a yield of 36% and a melting point of 96-99°C. 1H NMR (600 MHz, DMSO-d6) δ 10.08 (d, J = 94.2 Hz, 1H, CONH), 9.88 (d, J = 91.8 Hz, 1H, dihydropyrimidine-H), 8.00 (dd, J = 30.7, 3.2 Hz, 1H, thiazole-H), 7.90 (dd, J = 16.9, 3.4 Hz, 1H, thiazole-H), 7.64 (t, J = 7.6 Hz, 1H, Ph-H), 7.57 (d, J = 8.5 Hz, 1H, Ph-H), 7.53 (d, J = 8.6 Hz, 2H, Ph-H), 7.51 - 7.47 (m, 1H, Ph-H), 7.34 (dd, J = 8.6, 6.2 Hz, 1H, Ph-H), 7.16 (dd, J = 8.8, 6.4 Hz, 1H, Ph-H), 5.94 (d, J = 29.9 Hz, 1H, dihydropyrimidine-H), 4.17 - 4.03 (m, 2H, COOCH2), 3.90 (dtd, J = 9.7, 7.1, 4.7 Hz, 2H, dihydropyrimidine-CH2), 3.54 (ddd, J = 19.9, 9.0, 5.7 Hz, 1H, CH), 3.24 - 3.16 (m, 1H, CH2), 2.63 (p, J = 7.9 Hz, 1H, CH2), 2.19 (pd, J = 8.6, 5.3 Hz, 1H, CH2), 1.91 (dt, J = 12.7, 6.1 Hz, 1H, CH2), 1.84 (tt, J = 16.2, 7.8 Hz, 2H, CH2), 1.25 (d, J = 7.9 Hz, 12H, CH3x4), 0.99 (dt, J = 9.2, 5.9 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.80 (C=0), 172.52 (C=0), 165.74 (C=0), 165.68 (C=0), 162.75, 162.66, 161.15 (d, 1 J CF = 249.1 Hz), 161.05 (d, 1 J CF = 249.1 Hz), 147.78, 144.54, 144.02, 143.92, 141.91 (d, 4 J CF = 3.7 Hz), 140.92 (d, 4 J CF=7.5Hz),135.59,135.52,135.18,135.11,131.16,124.95,124.90,122.92(d, 4 J CF =5.7Hz), 122.86(d, 4 J CF =4.7Hz), 120.02(d, 3 J CF =11.1Hz), 119.85(d, 3 J CF =10.0Hz),118.86,118.79,118.55,118.51,115.89(d, 2 J CF =19.8Hz), 115.63(d, 2 J CF =22.8Hz),97.78,97.74,83.90,83.88,67.26,67.11,59.84,58.47,54.81,54.44,52.65,25.11,25.09,14.36.ESI-MS:m / z 738.17[M+H] + .C 34 H 38 BBrFN5O5S[737.19].

[0099] The raw materials used were intermediate 6a and pinacol ester of 3-aminophenylboronic acid. The product CAB11 was a yellow solid with a yield of 33% and a melting point of 97-100℃. 1H NMR (600 MHz, DMSO-d6) δ 10.03 (s, 1H, CONH), 9.91 (s, 1H, dihydropyrimidine-H), 8.00 (d, J = 7.5 Hz, 1H, Ph-H), 7.91 (d, J = 3.2 Hz, 1H, thiazole-H), 7.87 (s, 1H, thiazole-H), 7.72 (d, J = 8.0 Hz, 1H, Ph-H), 7.50 (dd, J = 8.6, 2.8 Hz, 1H, Ph-H), 7.30 (d, J = 7.3 Hz, 1H, Ph-H), 7.21 (d, J = 6.6 Hz, 2H, Ph-H), 6.90 - 6.84 (m, 1H, Ph-H), 5.97 (s, 1H, dihydropyrimidine-H), 4.10 (s, 2H, dihydropyrimidine-CH2), 3.92 - 3.84 (m, 2H, COOCH2), 3.53 (dd, J = 9.1, 5.3 Hz, 1H, CH), 2.67 - 2.58 (m, 1H, CH2), 2.18 (dt, J = 12.1, 8.4 Hz, 1H, CH2), 1.98 (dt, J = 13.1, 6.8 Hz, 1H, CH2), 1.90 (dt, J = 12.2, 6.2 Hz, 1H, CH2), 1.84 (t, J = 6.2 Hz, 2H, CH2), 1.25 (s, 12H, CH3x4), 0.99 (t, J = 7.3 Hz, 3H, CH3). ESI-MS: m / z 738.08 [M+H] + .C 34 H 38 BBrFN5O5S[737.19].

[0100] The starting materials used were intermediate 6b and 4-aminophenylboronic acid. The product CAB13 was a yellow solid with a yield of 46% and a melting point of 177-180 °C. 1H NMR (400 MHz, DMSO-d6) δ 9.96 (d, J = 4.1 Hz, 1H, CONH), 9.58 (d, J = 8.0 Hz, 1H, dihydropyrimidine-H), 7.98 (dd, J = 11.3, 3.2 Hz, 1H, thiazole-H), 7.94 (t, J = 3.5 Hz, 1H, thiazole-H), 7.88 (d, J = 1.9 Hz, 2H, BOH x 2), 7.71 (dd, J = 8.4, 3.1 Hz, 2H, Ph-H), 7.57 (dd, J = 8.2, 2.9 Hz, 3H, Ph-H), 7.39 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 7.27 - 7.20 (m, 1H, Ph-H), 6.02 (s, 1H, dihydropyrimidine-H), 4.06 (s, 2H, dihydropyrimidine-CH2), 3.96 (q, J = 7.1 Hz, 2H, COOCH2), 3.16 (p, J = 7.9 Hz, 2H, CH2), 2.88 (t, J = 6.9 Hz, 1H, CH), 2.81 - 2.72 (m, 1H, CH2), 2.69 (s, 2H, CH2), 2.14 - 2.05 (m, 2H, CH2), 1.06 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.85 (C=0), 172.77 (C=0), 165.62 (C=0), 162.51 (C=0), 162.47, 161.22 (d, 1 J CF = 248.3 Hz), 147.56, 144.37 (d, 4 J CF = 3.6 Hz), 143.98, 143.95, 141.33 (d, 4 J CF = 1.9 Hz), 140.68, 140.66, 135.26, 131.27, 131.21, 125.16, 125.13, 123.03 (d, 3 J CF = 9.7 Hz), 123.02 (d, 3 J CF = 9.7 Hz), 120.07 (d, 2 J CF = 24.0 Hz), 118.39, 115.94 (d, 2 J CF= 20.9 Hz), 97.15, 97.09, 59.85, 58.57, 58.53, 57.85, 57.66, 54.47, 54.38, 53.69, 53.64, 44.37, 44.29, 28.85, 28.65, 14.43. ESI-MS: m / z 658.3 [M+2+H] + .C 28 H 28 BBrFN5O5S[655.11].

[0101] The starting material used was intermediate 6b and 3-aminobenzoic acid. The product CAB14 was a yellow solid in 39% yield, melting point: 182-184 °C. 1 H NMR (600 MHz, DMSO-d6) δ 9.86 (d, J = 6.0 Hz, 1H, CONH), 9.55 (d, J = 7.2 Hz, 1H, dihydropyrimidine-H), 8.00 (d, J = 2.5 Hz, 2H, BOH x 2), 7.97 (dd, J = 17.3, 3.1 Hz, 1H, thiazole-H), 7.91 (dd, J = 6.4, 3.1 Hz, 1H, thiazole-H), 7.85 - 7.82 (m, 1H, Ph-H), 7.72 - 7.68 (m, 1H, Ph-H), 7.54 (dd, J = 8.5, 2.7 Hz, 1H, Ph-H), 7.45 (ddt, J = 7.4, 2.7, 1.2 Hz, 1H, Ph-H), 7.37 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 7.26 - 7.19 (m, 2H, Ph-H), 6.01 (s, 1H, dihydropyrimidine-H), 4.04 (d, J = 4.1 Hz, 2H, dihydropyrimidine-CH2), 3.94 (q, J = 7.0 Hz, 2H, COOCH2), 3.20 - 3.15 (m, 1H, CH), 3.05 (t, J = 8.7 Hz, 1H, CH2), 2.91 - 2.82 (m, 1H, CH2), 2.74 (td, J = 9.1, 8.7, 7.1 Hz, 1H, CH2), 2.70 - 2.61 (m, 1H, CH2), 2.11 - 2.03 (m, 2H, CH2), 1.04 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.60 (C=0), 165.63 (C=0), 162.51, 161.23 (d, 1 J CF = 248.4 Hz), 147.57, 144.38 (d,4 J CF = 3.2 Hz), 144.01, 143.98, 140.67 (d, 4 J CF = 2.9 Hz), 138.85, 138.84, 131.27, 131.21, 129.40, 128.04, 125.76, 125.75, 125.12, 125.10, 123.04 (d, 3 J CF = 9.5 Hz), 123.02 (d, 3 J CF = 9.6 Hz), 121.73, 121.70, 120.06 (d, 2 J CF = 24.0 Hz), 115.94 (d, 2 J CF = 21.1 Hz), 97.14, 97.08, 59.84, 58.59, 58.55, 57.89, 57.71, 54.55, 54.44, 53.75, 44.23, 44.15, 28.91, 28.70, 14.43. ESI-MS: 656.4 m / z [M+2+H] + .C 28 H 28 BBrFN5O5S [655.11].

[0102] The starting material used was intermediate 6b and 4-aminophenylboronic acid pinacol ester. The product CAB16 was a yellow solid, yield 34%, m.p. 177-179 °C. 1H NMR (600 MHz, DMSO-d6) δ 10.13 (d, J = 9.7 Hz, 1H, CONH), 9.56 (d, J = 12.9 Hz, 1H, dihydropyrimidine-H), 7.97 (dd, J = 16.2, 3.1 Hz, 1H, thiazole-H), 7.92 (ddd, J = 5.7, 3.1, 1.1 Hz, 1H, thiazole-H), 7.69 (dd, J = 8.4, 4.8 Hz, 1H, Ph-H), 7.62 (dd, J = 8.6, 2.3 Hz, 1H, Ph-H), 7.59 - 7.57 (m, 1H, Ph-H), 7.57 - 7.55 (m, 1H, Ph-H), 7.54 (dd, J = 5.9, 2.6 Hz, 1H, Ph-H), 7.37 (ddt, J = 8.4, 6.1, 1.7 Hz, 1H, Ph-H), 7.21 (tdd, J = 8.4, 4.4, 2.5 Hz, 1H, Ph-H), 6.00 (s, 1H, dihydropyrimidine-H), 4.03 (s, 2H, dihydropyrimidine-CH2), 3.94 (q, J = 7.1 Hz, 2H, COOCH2), 3.22 - 3.15 (m, 1H, CH), 3.08 (dt, J = 57.1, 8.4 Hz, 1H, CH2), 2.85 (ddt, J = 16.5, 8.1, 6.0 Hz, 1H, CH2), 2.74 (ddd, J = 15.8, 9.2, 7.3 Hz, 1H, CH2), 2.65 (dq, J = 21.8, 8.1 Hz, 1H, CH2), 2.07 (q, J = 6.6, 6.2 Hz, 2H, CH2), 1.26 (d, J = 2.2 Hz, 12H, CH3x4), 1.03 (t, J = 7.2 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 173.06 (C=0), 172.99 (C=0), 165.62 (C=0), 162.50, 162.46, 161.22 (d, 1 J CF = 248.2 Hz), 147.56, 144.37 (d, 4 J CF = 3.4 Hz), 143.97 (d, 4 J CF = 5.2 Hz), 142.55, 141.35, 141.33, 140.69, 140.66, 135.67, 135.25, 131.28, 131.23, 125.15, 125.13, 123.03 (d, 3 JCF =9.9Hz), 123.01(d, 3 J CF =9.7Hz), 120.06(d, 2 J CF =24.3Hz),118.68,118.39,115.95(d, 2 J CF =20.8Hz),97.14,97.10,83.88,59.84,58.57,58.53,57.82,57.63,54. 48,54.39,53.69,44.36,44.30,28.84,28.66,25.14,14.43.ESI-MS:m / z 738.23[M+H] + .C 34 H 38 BBrFN5O5S[737.19].

[0103] The raw materials used were intermediate 6b and pinacol ester of 3-aminophenylboronic acid. The product CAB17 was a yellow solid with a yield of 28% and a melting point of 92–95°C. 1H NMR (600 MHz, DMSO-d6) δ 9.94 (d, J = 5.2 Hz, 1H, CONH), 9.56 (d, J = 9.5 Hz, 1H, dihydropyrimidine-H), 7.98 - 7.93 (m, 2H, thiazole-H, Ph-H), 7.91 (dd, J = 8.3, 3.1 Hz, 1H, thiazole-H), 7.71 (ddt, J = 8.0, 6.2, 1.7 Hz, 1H, Ph-H), 7.54 (dd, J = 8.6, 2.6 Hz, 1H, Ph-H), 7.37 (ddd, J = 8.1, 6.1, 1.6 Hz, 1H, Ph-H), 7.31 (dtd, J = 6.7, 3.2, 1.7 Hz, 1H, Ph-H), 7.30 - 7.26 (m, 1H, Ph-H), 7.21 (tt, J = 8.5, 2.6 Hz, 1H, Ph-H), 6.01 (s, 1H, dihydropyrimidine-H), 4.04 (d, J = 2.2 Hz, 2H, dihydropyrimidine-CH2), 3.94 (q, J = 7.1 Hz, 2H, COOCH2), 3.18 - 3.12 (m, 1H, CH), 3.12 - 3.01 (m, 1H, CH2), 2.89 - 2.81 (m, 1H, CH2), 2.75 (ddd, J = 12.3, 8.7, 6.7 Hz, 1H, CH2), 2.66 (dq, J = 16.4, 8.0 Hz, 1H, CH2), 2.12 - 2.03 (m, J = 5.9 Hz, 2H, CH2), 1.27 (d, J = 2.5 Hz, 12H, CH3x4), 1.03 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.77 (C=0), 172.70 (C=0), 165.62 (C=0), 162.50, 162.46, 161.22 (d, 1 J CF = 248.4 Hz), 147.56, 144.36 (d, 4 J CF = 3.5 Hz), 143.96 (d, 4 J CF = 5.6 Hz), 140.69, 140.67, 139.30, 131.27, 131.21, 129.50, 128.71, 125.69, 125.11, 125.08, 123.04 (d, 3 J CF = 9.8 Hz), 123.02 (d, 3 JCF = 9.8 Hz), 122.60, 122.58, 120.06 (d, 2 J CF = 24.3 Hz), 115.93 (d, 2 J CF = 20.7 Hz), 97.13, 97.08, 84.10, 59.84, 58.57, 58.54, 57.83, 57.63, 54.52, 54.42, 53.72, 53.69, 44.29, 44.21, 28.82, 28.59, 25.13, 14.42. ESI-MS: m / z 738.23 [M+2+H] + .C 34 H 38 BBrFN5O5S[737.19].

[0104] The starting materials used were intermediate 6b and 2-aminobenzeneboronic acid pinacol ester. The product CAB18 was a yellow solid with a yield of 16% and a melting point of 100-102 °C. 1 H NMR (600 MHz, DMSO-d6) δ 11.66 (s, 1H, CONH), 9.54 (s, 1H, dihydropyrimidine-H), 7.94 (q, J = 3.1 Hz, 2H, thiazole-H, Ph-H), 7.59 (dd, J = 8.6, 2.7 Hz, 1H, thiazole-H), 7.47 - 7.43 (m, 1H, Ph-H), 7.41 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 7.27 (dtd, J = 22.2, 8.5, 8.1, 2.2 Hz, 2H, Ph-H), 7.19 - 7.11 (m, 2H, Ph-H), 6.05 (s, 1H, dihydropyrimidine-H), 4.11 (s, 2H, dihydropyrimidine-CH2), 3.98 (q, J = 7.1 Hz, 2H, COOCH2), 3.26 (t, J = 8.8 Hz, 1H, CH), 3.00 - 2.94 (m, 1H, CH2), 2.82 (dd, J = 9.4, 7.7 Hz, 1H, CH2), 2.72 (q, J = 8.2 Hz, 1H, CH2), 2.29 - 2.09 (m, 3H, CH2), 1.20 (d, J = 1.6 Hz, 12H, CH3x4), 1.07 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 173.41 (C=0), 165.61 (C=0), 162.43, 161.23 (d, 1 JCF = 247.8 Hz), 147.21, 144.33, 143.91, 140.64 (d, 4 J CF = 3.1 Hz), 133.27, 131.22 (d, 3 J CF = 8.3 Hz), 128.46, 125.58, 125.10, 120.08 (d, 2 J CF = 24.8 Hz), 116.86, 115.95 (d, 2 J CF = 20.0 Hz), 97.36, 80.55, 59.87, 58.56, 57.23, 54.31, 53.42, 42.94, 26.38, 26.35, 14.41. ESI-MS: m / z 739.92 [M+2+H] + .C 34 H 38 BBrFN5O5S [737.19].

[0105] The synthesis route of compounds CAB7-1~8-4 is as follows:

[0106]

[0107] Reagents and conditions: (i) chiral preparative HPLC separation; (ii) D-proline or L-proline, potassium carbonate, anhydrous ethanol, room temperature; (iii) boronic acid fragment, 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate, N,N-diisopropylethylamine, dichloromethane, 0 °C, room temperature.

[0108] Example 8. Preparation of compounds 3(a-b)

[0109] Compound 3 (5.02 g) was subjected to chiral preparative separation, the corresponding fractions were collected and the solvent was removed by rotary evaporation to obtain enantiomers 3a (2.42 g, Rt = 5.157 min) and 3b (2.31 g, Rt = 6.353 min).

[0110] Chiral preparative conditions:

[0111] Column: CHIRALPAK AD-H

[0112] Column size: 0.46 cm I.D. x 15 cm L

[0113] Injection: 1 uL

[0114] Mobile phase: EtOH = 100%

[0115] Flow rate: 1.0 ml / min

[0116] Wave length: UV 214 nm

[0117] Temperature: 35 °C

[0118] HPLC equipment: Shimadzu LC-20AT CP-HPLC-09

[0119] Compound 3a, yellow solid, yield: 48.2%, purity: 98.3%, ee value: 96.6%. ESI-MS: m / z 503.70 [M+2+H] + ; C 17 H 14 Br2FN3O2S [500.92].

[0120] Compound 3b, yellow solid, yield: 46.0%, purity: 99.5%, ee value: 99.0%. ESI-MS: m / z 503.70 [M+2+H] - ; C 17 H 14 Br2FN3O2S [500.92].

[0121] Example 9. Preparation of compound 6 (c-f)

[0122] Intermediate 3a or 3b (500 mg, 0.994 mmol) was dissolved in 10 mL of anhydrous ethanol, and D-proline or L-proline (114 mg, 0.994 mmol), potassium carbonate (275 mg, 1.99 mmol) was added successively, stirred at room temperature overnight, and monitored by TLC. After the reaction was completed, it was filtered and separated by column chromatography. Recrystallized in dichloromethane-n-hexane system to obtain intermediate 6 (c-f).

[0123] The raw material used was intermediate 3a and D-proline. The product 6c was a yellow solid with a yield of 78%. ESI-MS: m / z 537.32 [M+H] + .C 22 H 22 BrFN4O4S [536.05].

[0124] The raw material used was intermediate 3a and L-proline. The product 6d was a yellow solid with a yield of 84%. ESI-MS: m / z 537.11 [M+H] + .C 22 H 22BrFN4O4S [536.05].

[0125] The starting material used was intermediate 3b and D-proline. The product 6e was a yellow solid in 80% yield. ESI-MS: m / z 537.39 [M+H] + .C 22 H 22 BrFN4O4S [536.05].

[0126] The starting material used was intermediate 3b and L-proline. The product 6f was a yellow solid in 81% yield. ESI-MS: m / z 537.15 [M+H] + .C 22 H 22 BrFN4O4S [536.05].

[0127] Example 10. Preparation of target product CAB7-1~8-4

[0128] Intermediate 6 (c-f) (100 mg, 0.186 mmol), 2-(7-azabenzotriazol)-N,N,N',N'- tetramethyluronium hexafluorophosphate (106 mg, 0.279 mmol) were dissolved in 5 mL of dichloromethane and stirred in an ice bath for 30 min. N,N-diisopropylethylamine (DIPEA, 92 μL, 0.558 mmol) and boronic acid fragment (0.223 mmol) were added successively and stirred at room temperature for 2-4 h, monitored by TLC. After the reaction was completed, 20 mL of water was added to the reaction solution, extracted with dichloromethane (20 mL) for 3 times, collected the organic phase and washed with saturated NaCl solution once, dried over anhydrous magnesium sulfate. Filtered, the filtrate was concentrated under reduced pressure, separated by flash column chromatography, and recrystallized in dichloromethane-n-hexane system to obtain the target compound CAB7-1~8-4.

[0129] The starting material used was intermediate 6c and 4-aminobenzeneboronic acid. The product CAB7-1 was a yellow solid in 51% yield, melting point: 150-153 °C. 1H NMR (600 MHz, DMSO-d6) δ 9.90 (s, 1 H, CONH), 9.81 (s, 1 H, dihydropyrimidine-H), 7.96 (d, J = 3.1 Hz, 1 H, thiazole-H), 7.89 (d, J = 3.4 Hz, 3H, thiazole-H, BOH x 2), 7.65 (d, J = 8.4 Hz, 2H, Ph-H), 7.52 (dd, J = 8.5, 2.7 Hz, 1 H, Ph-H), 7.50 (d, J = 8.5 Hz, 2H, Ph-H), 7.35 (dd, J = 8.7, 6.1 Hz, 1 H, Ph-H), 7.17 (td, J = 8.4, 2.7 Hz, 1 H, Ph-H), 5.94 (s, 1 H, dihydropyrimidine-H), 4.18 - 4.03 (m, 2H, dihydropyrimidine-CH2), 3.91 (q, J = 7.1, 6.6 Hz, 2H, COOCH2), 3.52 (dd, J = 8.8, 5.4 Hz, 1 H, CH), 3.22 (dt, J = 8.6, 5.5 Hz, 1 H, CH2), 2.64 (q, J = 7.9 Hz, 1 H, CH2), 2.20 (dq, J = 11.2, 8.0, 7.6 Hz, 1 H, CH2), 1.90 (dt, J = 12.1, 6.3 Hz, 1 H, CH2), 1.86 (dd, J = 13.2, 7.3 Hz, 2H, CH2), 1.00 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.32 (C=0), 165.69 (C=0), 162.65, 161.15 (d, 1 J CF = 248.2 Hz), 147.83, 144.59, 143.87, 140.93 (d, 4 J CF = 3.3 Hz), 140.72, 135.14, 131.17 (d, 3 J CF = 8.8 Hz), 124.92, 122.92 (d, 3 J CF = 9.5 Hz), 119.99 (d, 2 J CF = 24.3 Hz), 118.52, 115.90 (d, 2 J CF= 20.6 Hz), 97.70, 67.26, 59.84, 58.49, 54.43, 52.68, 30.26, 24.09, 14.37. ESI-MS: m / z 656.01 [M+H] + , 657.92 [M+2+H] + .C 28 H 28 BBrFN5O5S [655.10].

[0130] The starting materials used were intermediate 6d and 4-aminobenzeneboronic acid. The product CAB7-2 was a yellow solid with a yield of 43% and a melting point of 164-167 °C. 1 H NMR (600 MHz, DMSO-d6) δ 10.05 (s, 1H, CONH), 9.95 (s, 1H, dihydropyrimidine-H), 8.02 (d, J = 3.2 Hz, 1H, thiazole-H), 7.92 (d, J = 3.2 Hz, 1H, thiazole-H), 7.88 (s, 2H, BOH x 2), 7.65 (d, J = 8.3 Hz, 2H, Ph-H), 7.55 (d, J = 8.4 Hz, 2H, Ph-H), 7.49 (dd, J = 8.6, 2.7 Hz, 1H, Ph-H), 7.19 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 6.81 (td, J = 8.5, 2.7 Hz, 1H, Ph-H), 5.97 (s, 1H, dihydropyrimidine-H), 4.11 (d, J = 3.4 Hz, 2H, dihydropyrimidine-CH2), 3.89 (q, J = 6.8 Hz, 2H, COOCH2), 3.55 (dd, J = 8.9, 5.3 Hz, 1H, CH), 3.19 (ddd, J = 8.7, 6.6, 4.0 Hz, 1H, CH2), 2.63 (q, J = 8.3 Hz, 1H, CH2), 2.19 (dq, J = 12.4, 8.5 Hz, 1H, CH2), 1.95 - 1.88 (m, 1H, CH2), 1.86 - 1.80 (m, 2H, CH2), 0.99 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.57 (C=0), 165.74 (C=0), 162.75, 161.05 (d, 1 J CF = 248.5 Hz), 147.63, 144.54, 144.00, 140.91, 140.74, 135.20, 131.20 (d, 3 JCF = 8.9 Hz), 124.98, 122.87 (d, 3 J CF = 9.5 Hz), 119.90 (d, 2 J CF = 24.5 Hz), 118.56, 115.66 (d, 2 J CF = 20.5 Hz), 97.79, 67.12, 59.85, 58.47, 54.78, 52.62, 30.56, 24.22, 14.36. ESI-MS: m / z 658.04 [M+2+H] + .C 28 H 28 BBrFN5O5S [655.10].

[0131] The starting materials used were intermediate 6e and 4-aminobenzeneboronic acid. The product CAB7-3 was a yellow solid with a yield of 49% and a melting point of 170-173 °C. 1 H NMR (600 MHz, DMSO-d6) δ 10.08 (s, 1H, CONH), 9.98 (s, 1H, dihydropyrimidine-H), 8.04 (d, J = 3.2 Hz, 1H, thiazole-H), 7.94 (d, J = 3.2 Hz, 1H, thiazole-H), 7.91 (s, 2H, BOH x 2), 7.68 (d, J = 8.5 Hz, 2H, Ph-H), 7.58 (d, J = 8.4 Hz, 2H, Ph-H), 7.52 (dd, J = 8.5, 2.7 Hz, 1H, Ph-H), 7.21 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 6.83 (td, J = 8.4, 2.7 Hz, 1H, Ph-H), 6.00 (s, 1H, dihydropyrimidine-H), 4.13 (d, J = 3.8 Hz, 2H, dihydropyrimidine-CH2), 3.91 (qd, J = 7.1, 1.4 Hz, 2H, COOCH2), 3.57 (dd, J = 8.9, 5.3 Hz, 1H, CH), 3.21 (ddd, J = 8.8, 6.6, 4.1 Hz, 1H, CH2), 2.65 (q, J = 8.2 Hz, 1H, CH2), 2.21 (dq, J = 12.3, 8.5 Hz, 1H, CH2), 1.94 (tt, J = 12.7, 5.1 Hz, 1H, CH2), 1.86 (q, J = 8.1 Hz, 2H, CH2), 1.01 (t, J = 7.1 Hz, 3H, CH3). 13C NMR (150 MHz, DMSO-d6) δ 172.56 (C=0), 165.74 (C=0), 162.74, 161.04 (d, 1 J CF = 248.3 Hz), 147.63, 144.54, 144.00, 140.90 (d, 4 J CF = 3.2 Hz), 140.74, 135.20, 131.20 (d, 3 J CF = 8.9 Hz), 124.98, 122.87 (d, 3 J CF = 9.7 Hz), 119.89 (d, 2 J CF = 24.7 Hz), 118.56, 118.19, 115.66 (d, 2 J CF = 20.9 Hz), 97.78, 67.11, 59.84, 58.47, 54.77, 52.62, 30.56, 24.22, 14.36. ESI-MS: m / z 657.83 [M+2+H] + .C 28 H 28 BBrFN5O5S [655.10].

[0132] The starting materials used were intermediate 6f and 4-aminophenylboronic acid. The product CAB7-4 was a yellow solid with a yield of 46% and a melting point of 170-173 °C. 1H NMR (600 MHz, DMSO-d6) δ 9.92 (s, 1H, CONH), 9.83 (s, 1H, dihydropyrimidine-H), 7.98 (d, J = 3.1 Hz, 1H, thiazole-H), 7.92 (d, J = 3.1 Hz, 1H, thiazole-H), 7.90 (s, 2H, BOH x 2), 7.68 (d, J = 8.3 Hz, 2H, Ph-H), 7.55 (dd, J = 8.6, 2.7 Hz, 1H, Ph-H), 7.52 (d, J = 8.4 Hz, 2H, Ph-H), 7.37 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 7.20 (td, J = 8.4, 2.7 Hz, 1H, Ph-H), 5.96 (s, 1H, dihydropyrimidine-H), 4.20 - 4.05 (m, 2H, dihydropyrimidine-CH2), 3.93 (td, J = 7.2, 6.3 Hz, 2H, COOCH2), 3.55 (dd, J = 8.8, 5.4 Hz, 1H, CH), 3.24 (dt, J = 8.8, 5.5 Hz, 1H, CH2), 2.69 - 2.64 (m, 1H, CH2), 2.22 (dq, J = 11.3, 8.0 Hz, 1H, CH2), 1.93 (dt, J = 7.5, 6.0 Hz, 1H, CH2), 1.89 - 1.86 (m, 2H, CH2), 1.02 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 Hz, DMSO-d6) δ 172.32 (C=0), 165.69 (C=0), 162.65, 161.16 (d, 1 J CF = 248.2 Hz), 147.83, 144.59, 143.87, 140.94, 140.72, 135.14, 131.17 (d, 3 J CF = 8.5 Hz), 124.93, 122.92 (d, 3 J CF = 10.0 Hz), 119.99 (d, 2 J CF = 24.3 Hz), 118.53, 115.91 (d, 2 J CF = 21.0 Hz), 97.70, 67.26, 59.84, 58.49, 54.43, 52.68, 30.26, 24.09, 14.37. ESI-MS: m / z 655.91 [M+H] +,657.86 [M+2+H] + .C 28 H 28 BBrFN5O5S[655.10].

[0133] The starting materials used were intermediate 6c and 3-aminobenzoic acid. The product CAB8-1 was a yellow solid with a yield of 42% and a melting point of 176-179 °C. 1 H NMR (600 MHz, DMSO-d6) δ 9.85 (s, 1H, CONH), 9.85 (s, 1H, dihydropyrimidine-H), 8.00 (s, 2H, BOH x 2), 7.97 (d, J = 3.1 Hz, 1H, thiazole-H), 7.89 (d, J = 3.1 Hz, 1H, thiazole-H), 7.86-7.85 (m, 1H, Ph-H), 7.69 (ddd, J = 8.1, 2.3, 1.1 Hz, 1H, Ph-H), 7.55 (dd, J = 8.6, 2.7 Hz, 1H, Ph-H), 7.46 (dd, J = 7.3, 1.1 Hz, 1H, Ph-H), 7.37 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 7.21 (t, J = 7.5 Hz, 2H, Ph-H), 5.97 (s, 1H, dihydropyrimidine-H), 4.12 (dd, J = 87.3, 15.8 Hz, 2H, dihydropyrimidine-CH2), 3.94 (q, J = 7.1 Hz, 2H, COOCH2), 3.55 (dd, J = 8.7, 5.5 Hz, 1H, CH), 3.23 (dt, J = 8.7, 5.5 Hz, 1H, CH2), 2.66 (q, J = 7.9 Hz, 1H, CH2), 2.22 (dq, J = 11.1, 7.9 Hz, 1H, CH2), 1.96-1.91 (m, 1H, CH2), 1.90-1.86 (m, 2H, CH2), 1.02 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 Hz, DMSO-d6) δ 172.06 (C=0), 165.67 (C=0), 162.58, 161.15 (d, 1 J CF = 248.2 Hz), 147.87, 144.58, 143.94, 140.92 (d, 4 J CF = 3.1 Hz), 138.31, 131.16 (d, 3 J CF=8.6Hz),129.56,127.91,125.83,124.82,122.92(d, 3 J CF =9.9Hz), 121.76, 119.98 (d, 2 J CF =24.4Hz), 115.91(d, 2 J CF =21.0Hz),97.64,67.14,59.85,58.49,54.29,52.64,30.21,24.06,14.37.ESI-MS:m / z 655.91[M+H] + 657.84[M+2+H] + .C 28 H 28 BBrFN5O5S[655.10].

[0134] The raw materials used were intermediate 6d and 3-aminophenylboronic acid. The product CAB8-2 was a yellow solid with a yield of 36% and a melting point of 177–180 °C. 1H NMR (600 MHz, DMSO-d6) δ 9.97 (s, 1 H, CONH), 9.96 (s, 1 H, dihydropyrimidine-H), 8.03 (d, J = 3.1 Hz, 1 H, thiazole-H), 8.01 (s, 2 H, BOH x 2), 7.93 (d, J = 2.4 Hz, 1 H, thiazole-H), 7.92 (d, J = 3.1 Hz, 1 H, Ph-H), 7.72 (ddd, J = 8.1, 2.3, 1.2 Hz, 1 H, Ph-H), 7.52 (dd, J = 8.6, 2.7 Hz, 1 H, Ph-H), 7.48 (d, J = 7.5 Hz, 1 H, Ph-H), 7.25 (dd, J = 8.7, 6.1 Hz, 1 H, Ph-H), 7.21 (t, J = 7.7 Hz, 1 H, Ph-H), 6.89 (td, J = 8.5, 2.7 Hz, 1 H, Ph-H), 6.00 (s, 1 H, dihydropyrimidine-H), 4.13 (q, J = 16.2 Hz, 2 H, dihydropyrimidine-CH2), 3.92 (qd, J = 7.1, 1.8 Hz, 2 H, COOCH2), 3.55 (dd, J = 8.8, 5.6 Hz, 1 H, CH), 3.19 (dt, J = 8.8, 5.4 Hz, 1 H, CH2), 2.64 (q, J = 8.1 Hz, 1 H, CH2), 2.21 (dq, J = 12.0, 8.2 Hz, 1 H, CH2), 1.97 - 1.90 (m, 1 H, CH2), 1.86 (dtd, J = 10.2, 7.8, 4.2 Hz, 2 H, CH2), 1.02 (t, J = 7.1 Hz, 3 H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.20 (C=0), 165.73 (C=0), 162.68, 161.08 (d, 1 J CF = 248.2 Hz), 147.79, 144.56, 144.06, 140.87 (d, 4 J CF = 3.2 Hz), 138.39, 137.90, 131.22 (d, 3 J CF = 8.6 Hz), 129.63, 127.97, 125.82, 124.90, 122.85 (d, 3 J CF = 9.9 Hz), 121.79, 119.88 (d, 2 J CF = 24.3 Hz), 115.76 (d,2 J CF = 20.7 Hz), 97.56, 67.22, 59.84, 58.45, 54.63, 52.64, 30.46, 24.15, 14.38. ESI-MS: m / z 658.17 [M+2+H] + .C 28 H 28 BBrFN5O5S[655.10].

[0135] The starting material used was intermediate 6e and 3-aminobenzoic acid. The product CAB8-3 was a yellow solid with a yield of 45% and a melting point of 175-178 °C. 1 H NMR (600 MHz, DMSO-d6) δ 9.95 (s, 1H, CONH), 9.93 (s, 1H, dihydropyrimidine-H), 8.00 (d, J = 3.1 Hz, 1H, thiazole-H), 7.98 (s, 2H, BOH x 2), 7.91 (d, J = 1.9 Hz, 1H, Ph-H), 7.90 (d, J = 3.1 Hz, 1H, thiazole-H), 7.70 (ddd, J = 8.1, 2.4, 1.2 Hz, 1H, Ph-H), 7.49 (dd, J = 8.5, 2.7 Hz, 1H, Ph-H), 7.45 (dt, J = 7.3, 1.2 Hz, 1H, Ph-H), 7.23 (dd, J = 8.7, 6.1 Hz, 1H, Ph-H), 7.18 (t, J = 7.7 Hz, 1H, Ph-H), 6.87 (td, J = 8.5, 2.7 Hz, 1H, Ph-H), 5.98 (s, 1H, dihydropyrimidine-H), 4.11 (q, J = 16.2 Hz, 2H, dihydropyrimidine-CH2), 3.90 (qd, J = 7.1, 1.8 Hz, 2H, COOCH2), 3.53 (dd, J = 8.8, 5.6 Hz, 1H, CH), 3.17 (dt, J = 8.9, 5.6 Hz, 1H, CH2), 2.62 (q, J = 8.2 Hz, 1H, CH2), 2.19 (dq, J = 12.0, 8.2 Hz, 1H, CH2), 1.94 - 1.88 (m, 1H, CH2), 1.87 - 1.82 (m, 2H, CH2), 0.99 (t, J = 7.1 Hz, 3H, CH3). 13 C NMR (150 MHz, DMSO-d6) δ 172.20 (C=0), 165.73 (C=0), 162.68, 161.08 (d, 1 J CF=248.6Hz),147.78,144.56,144.06,140.87(d, 4 J CF =3.3Hz),138.39,136.31,131.22(d, 3 J CF =8.6Hz),129.63,127.97,125.83,124.89,122.85(d, 3 J CF =9.4Hz), 121.79, 119.88 (d, 2 J CF =24.2Hz), 115.76(d, 2 J CF =20.7Hz),97.56,67.22,59.83,58.45,54.63,52.65,30.46,24.15,14.38.ESI-MS:m / z 655.51[M+H] + .C 28 H 28 BBrFN5O5S[655.10].

[0136] The raw materials used were intermediate 6f and 3-aminophenylboronic acid. The product CAB8-4 was a yellow solid with a yield of 37% and a melting point of 170–173 °C. 1H NMR(600MHz,DMSO-d6)δ9.82(s,1H,CONH),9.82(s,1H,dihydropyrimidine-H),7.97(s,2H,BOH×2),7.94(d,J=3.1Hz,1H,thiazole-H),7.86(d,J=3.1Hz,1H,thiazole-H),7.83(t,J=1.5Hz,1H,Ph-H),7.67(ddd,J=8.1,2.4,1.2Hz,1H,Ph-H),7.52(dd,J=8.6,2.7Hz,1H,Ph-H),7.44(dt,J=7.3,1.1Hz,1H,Ph-H),7.35(dd,J=8.7,6.1Hz,1H,Ph-H),7.21–7.16(m,2H,Ph-H),5.95(s,1H,dihydropyrimidine-H),4.10(dd,J=86.9,15.8Hz,2H,dihydropyrimidine-CH2),3.92(q,J=7.1Hz,2H,COOCH2),3.53(dd,J=8.7,5.5Hz,1H,CH),3.21(dt,J=8.7,5.5Hz,1H,CH2),2.64(q,J=7.9Hz,1H,CH2),2.20(dq,J=11.1,7.9Hz,1H,CH2),1.93–1.88(m,1H,CH2),1.88–1.84(m,2H,CH2),1.00(t,J=7.1Hz,3H,CH3). 13 C NMR(150MHz,DMSO-d6)δ172.06(C=O),165.68(C=O),162.58,161.15(d, 1 J CF =248.3Hz),147.87,144.59,143.94,140.92(d, 4 J CF =3.2Hz),138.31,131.16(d, 3 J CF =9.1Hz),129.57,127.91,125.84,124.81,122.92(d, 3 J CF =9.4Hz),121.77,119.98(d, 2 J CF =24.7Hz),115.91(d, 2 J CF= 21.0 Hz), 97.65, 67.15, 59.85, 58.49, 54.29, 52.65, 30.21, 24.06, 14.37. ESI-MS: m / z 657.80 [M+2+H] + .C 28 H 28 BBrFN5O5S[655.10].

[0137] Example 11. In vitro anti-HBV activity experiment of target compounds (HepDES19 cells)

[0138] Test principle: HepDES19 cells are a derivative of HepG2 (human hepatoblastoma) cell line stably transfected with HBV genotype D genome under the control of tetracycline (which can inhibit the promoter). In the absence of tetracycline, HepDES19 cells induce HBV replication, add compounds, and incubate cells for 3 days, and the content of HBV DNA expressed by cells and the survival status of cells will change. By analyzing the content of HBV DNA by quantitative polymerase chain reaction (qPCR), the effectiveness of the compound in inhibiting HBV replication is obtained, that is, the concentration of the compound required to reduce HBV DNA to half, that is, the half effective concentration (EC 50 ), indicating the anti-HBV activity of the compound. The size of the toxicity of the compound to the cells is tested by MTS method, and the concentration required to kill half of the cells is obtained, that is, the half lethal concentration (CC 50 ), indicating the cytotoxicity of the compound. (Guo H, Jiang D, Zhou T, et al. Journal of virology 2007; 81(22): 12472-12484; Edwards TC, Lomonosova E, Patel JA, et al. Antiviral research 2017; (143): 205-217).

[0139] Experimental method:

[0140] (1) Cell culture. The cells were stored in Dulbecco's modified Eagle's medium (DMEM) / F12 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S) and 1 μg / mL tetracycline. The synchronous expression of HBV pgRNA was induced by removing tetracycline from the culture medium.

[0141] (2) Drug-containing cell culture. In the absence of tetracycline, HepDES19 cells were seeded at 4x10 4Cells were seeded in 96-well plates at a density of one cell. After 48 hours of induction of HBV replication, compound solutions were added at a final DMSO concentration of 1% and incubated with the cells for 3 days.

[0142] (3) Cell viability (EC 50 ) test method. Cells were washed in 200 μΐ^of phosphate buffered saline (PBS) and lysed in 150 μΐ^of core lysis buffer (10 mM Tris pH 7.4, 1% Tween20, 150 mM NaCl). Cells were incubated at 350 rpm on a orbital shaker at 20-23 °C for 40 minutes. Cell lysate was transferred to a 96-well PCR plate and centrifuged at 3300 x g for 5 minutes. 50 μΐ^of supernatant was transferred to another 96-well PCR plate and mixed with 20 units of Micrococcal Nuclease and 100 μΜ CaCl2. The lysate was incubated at 37 °C for 1 hour, then the nuclease was inactivated at 70 °C for 10 minutes. Qiagen Protease (0.005 Anson units) was added to the lysate and the mixture was incubated overnight, then the protease was inactivated at 95 °C for 10 minutes.

[0143] The lysate was used as template for strand prioritization quantitative polymerase chain reaction (qPCR) analysis. Quantitative PCR was performed with 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Kappa Probe Force universal PCR master mix was used. Primers and probe for the positive polarity DNA strand were 5' CATGAACAAGAGATGTGTAGTAGGCAGAG 3', 5' GGAGGCTGTAGGCATAAATTGG 3' and 5' / 56-FAM / CTGCGCACC / ZEN / AGCACCATGCA / 3IABkFQ. Primers and probe for the negative polarity DNA strand were 5' GCAGATGAGAAGGCACAGA 3', 5' CTTCTCCGTCTGCCGTT 3' and 5' / 56-FAM / AGTCCGCGT / ZEN / AAAGAGAGGTGCG / 3IABkFQ. EC 50 values for the positive strand DNA were calculated using GraphPad Prism and a three parameter variable-response log(inhibitor)-versus-response algorithm with the minimum set to zero.

[0144] (4) Cell cytotoxicity (CC 50 ) test method. CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega) was used according to the manufacturer's instructions. Briefly, 20 μΐ^of CellTiter 96® AQueous One Solution Reagent was added to each well and incubated for 4 hours at 37 °C. The absorbance was measured at 490 nm using a SpectraMax® M5 plate reader (Molecular Devices). The CC TMAn aqueous non-radioactive cell proliferation assay (MTS) was used to measure cell viability in the presence of compounds in HepDES19 cells. Cells were seeded at a density of 1 x 10 4 cells per well in 96-well plates in the absence of tetracycline, two days later the compounds were used and cells were incubated for 3 days. The 50% cytotoxic concentration (CC 50 ) values were calculated using GraphPad Prism and a three parameter variable response log(inhibitor)-response algorithm (with a bottom value set to zero).

[0145] A series of 22 synthesized dihydropyrimidine compounds containing boronic acid and pinacol boronate groups were evaluated for their in vitro anti-HBV DNA replication activity at the cellular level. The EC 50 , CC 50 and selective index (SI) values were calculated and are shown in Table 2.

[0146] Table 2. Activity of target compounds in inhibiting HBV DNA replication and cytotoxicity

[0147]

[0148]

[0149] Analysis of experimental results: The newly synthesized dihydropyrimidine derivatives containing boronic acid and pinacol boronate groups exhibited significant anti-HBV activity. Through activity screening, 20 compounds had good anti-HBV activity with EC 50 values in the range of 0.08-4.15 μM. Compound CAB7-3 had the best activity (EC 50 = 0.08 μM), which was better than the positive control drug lamivudine and comparable to GLS4, and was worthy of further study.

Claims

1. A dihydropyrimidine derivative containing a boronic acid and a pinacol boronate group, or a pharmaceutically acceptable salt thereof, characterized in that, has the following general formula I: wherein, A is: piperazine or tetrahydropyrrole; R1 is: R2 is: methylene, amide, sulfonamide, phosphonamide, oxalamide; R3, R4, R5 are each independently selected from: H, methyl, halogen atom, cyano; R6 is: methyl or ethyl.

2. The dihydro- pyrimidine derivative containing boronic acid and pinacol boronate groups according to claim 1, wherein, is one of the compounds having the following structure:

3. The method for preparing dihydropyrimidine derivatives containing boric acid and borate pinacol ester groups as described in claim 2, characterized in that, is one of the following methods: (1) synthesis of compounds CAB1-5: The synthetic route is as follows: Reagents and conditions: (i) 2-bromo-4-fluorobenzaldehyde, ethyl acetoacetate, sodium acetate, anhydrous ethanol, 80°C; (ii) N-bromosuccinimide, dichloromethane, 40°C; (iii) 1-Boc-piperazine, potassium carbonate, potassium iodide, acetonitrile, 75°C; (iv) trifluoroacetic acid, dichloromethane, room temperature; (v) boronic acid or pinacol boronic acid fragment, N,N-diisopropylethylamine, N,N-dimethylformamide, room temperature; wherein, R1 is (2) synthesis of compounds CAB7-18: The synthetic route is as follows: Reagents and conditions: (i) proline or 3-pyrrolidinecarboxylic acid, potassium carbonate, anhydrous ethanol, room temperature; (ii) boronic acid or pinacol boronic acid fragment, 2-(7-azabenzotriazolyl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, N,N-diisopropylethylamine, dichloromethane, 0°C, room temperature; wherein, R1 is (3) synthesis of compounds CAB7-1-8-4: The synthetic route is as follows: Reagents and conditions: (i) chiral high-performance liquid chromatography separation; (ii) D-proline or L-proline, potassium carbonate, anhydrous ethanol, room temperature; (iii) boronic acid fragment, 2-(7-azabenzotriazolyl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, N,N-diisopropylethylamine, dichloromethane, 0°C, room temperature; wherein, R1 is 4. The process for preparing dihydro- pyrimidine derivatives containing boronic acid and pinacol boronate groups according to claim 3, characterized in that, is one of the following preparation steps: (1) synthesis of compounds CAB1-5: weigh 2-thiazoleformamidine hydrochloride (1), 2-bromo-4-fluorobenzaldehyde and sodium acetate in anhydrous ethanol, add ethyl acetoacetate under stirring at room temperature, reflux in ethanol at 80°C for 8h; after the reaction is completed, extract, separate by flash column chromatography, and recrystallize to obtain compound 2; dissolve compound 2 in dichloromethane, add N-bromosuccinimide under stirring at room temperature in small portions for several times, reflux for 1.5h; after the reaction is completed, extract, separate by flash column chromatography, and recrystallize to obtain compound 3; weigh compound 3, 1-Boc-piperazine, potassium carbonate and potassium iodide, dissolve in acetonitrile, reflux at 75°C for one hour; after the reaction is completed, extract, separate by flash column chromatography, and recrystallize to obtain compound 4; dissolve compound 4 in dichloromethane, add trifluoroacetic acid dropwise, stir at room temperature for 10h; after the reaction is completed, extract, evaporate the solvent to obtain the target compound 5; dissolve compound 5 in N,N-dimethylformamide, add different boronic acid or pinacol boronic acid fragments, and add N,N-diisopropylethylamine under stirring; after the reaction is completed, extract, separate by flash column chromatography, and recrystallize to obtain the target compounds CAB1-5; (2) Synthesis of compounds CAB7-18: Intermediate 3 was dissolved in anhydrous ethanol, proline or 3-pyrrolidinecarboxylic acid and potassium carbonate were added successively, and stirred at room temperature overnight. After the reaction was completed, filtration, flash column chromatography and recrystallization were performed to obtain intermediate 6a or 6b. Intermediate 6a or 6b and 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate were weighed and dissolved in dichloromethane, and stirred in an ice bath for 30 min. N,N-diisopropylethylamine and boronic acid or pinacol boronic acid fragment were added successively, and stirred at room temperature for 2-4 h. After the reaction was completed, extraction, flash column chromatography and recrystallization were performed to obtain the target compound CAB7-18. (3) Synthesis of compounds CAB7-1-8-4: high performance liquid chromatography was used to separate chiral isomers using a large celite chiral chromatographic column CHIRALPAK AD-H, and the fractions were collected and the solvent was removed by evaporation to obtain 3a or 3b. Intermediate 3a or 3b was dissolved in anhydrous ethanol, D-proline or L-proline and potassium carbonate were added successively, and stirred at room temperature overnight. After the reaction was completed, filtration, flash column chromatography and recrystallization were performed to obtain intermediate 6(c-f). Intermediate 6(c-f) and 2-(7-azabenzotriazol)-N,N,N',N'-tetramethyluronium hexafluorophosphate were weighed and dissolved in dichloromethane, and stirred in an ice bath for 30 min. N,N-diisopropylethylamine and boronic acid or pinacol boronic acid fragment were added successively, and stirred at room temperature for 2-4 h. After the reaction was completed, extraction, flash column chromatography and recrystallization were performed to obtain the target compound CAB7-1-8-4.

5. Use of the dihydropyrimidine derivative containing boric acid and pinacol boronic ester according to any one of claims 1-2 in the preparation of an anti-HBV drug.

6. An anti-HBV pharmaceutical composition comprising the dihydropyrimidine derivative containing boric acid and pinacol boronic ester according to any one of claims 1-2 and one or more pharmaceutically acceptable carriers.

7. An anti-HBV pharmaceutical composition comprising the dihydropyrimidine derivative containing boric acid and pinacol boronic ester according to any one of claims 1-2 and one or more pharmaceutically acceptable excipients.

Images