Gene Ublf7 and its application in controlling western flower thrips
By identifying and utilizing the Ublf7 gene of western flower thrips to construct transgenic plants, the problems of environmental pollution and resistance in the prevention and control of western flower thrips were solved, and efficient green control effects were achieved.
Patent Information
- Application Number
- CN202310348359.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-03
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2043-04-03
AI Technical Summary
The existing technology for controlling western flower thrips relies on chemical pesticides, which leads to environmental pollution and increased resistance, and lacks effective green control technology.
By identifying and utilizing the Ublf7 gene of western flower thrips, transgenic plants were constructed to improve resistance to western flower thrips and reduce the use of chemical pesticides.
The resistance of transgenic plants to western flower thrips was significantly improved, the use of chemical pesticides was reduced, and the risk of environmental pollution and resistance was reduced.
Smart Images

Figure BDA0004160607840000051 
Figure BDA0004160607840000052 
Figure BDA0004160607840000061
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a gene Ublf7 and an application thereof in preventing and controlling western flower thrips. Background Art
[0002] The western flower thrips, Frankliniella occidentalis (Pergande), is a major invasive pest of agricultural and horticultural crops worldwide. The pest was first discovered in Beijing in my country in 2003 and has since rapidly spread to Xinjiang, Tibet, Yunnan, Zhejiang, Shandong, Guizhou, and Hunan. Western flower thrips not only directly harm plant stems, leaves, flowers, and fruits by feeding, reducing crop yield and quality, but can also spread tomato spotted wilt virus (TSWV), causing further losses to agricultural production. Currently, the control of western flower thrips still relies primarily on chemical pesticides. However, the inappropriate use of large quantities of these chemicals has not only exacerbated environmental pollution and pesticide residues in agricultural products, but has also led to the development of high levels of resistance to various pesticides in western flower thrips, further complicating control efforts. Therefore, under the guidance of integrated pest management (IPM) systems, the development of green control technologies for western flower thrips is particularly important.
[0003] The Ublf gene family has a ubiquitin-like fold domain, which is composed of one α-helix and five β-folds and is similar to ubiquitin and ubiquitin-like proteins in three-dimensional structure. [1-3] With the rapid development of proteomics, more and more biological macromolecule proteins have been found to have ubiquitin-like fold domains. [4] Both Parkin and SUMO-1 genes have ubiquitin-like fold domains. Pakin can act as an E3 ubiquitin ligase to catalyze the transfer of ubiquitin from the ubiquitin-conjugating enzyme E2 to the target protein. Knocking out the Parkin gene in Drosophila leads to loss of mitochondrial function and muscle cell apoptosis, and the inability to form sperm. [5] In addition, knocking out SUMO-1 in Caenorhabditis elegans also leads to abnormal development of the reproductive system. [6] Therefore, it is speculated that Ublf family genes with structures similar to ubiquitin and ubiquitin-like proteins may play an important role in regulating the reproductive capacity of organisms.
[0004] This study identified and analyzed the Ublf gene family in western flower thrips, revealing 10 genes with ubiquitin-like fold domains. Among these, Ublf7 is not annotated in the NCBI database, and no homologs have been found in other species. To clarify the function of Ublf7, we used RNAi (RNA interference) feeding and transgenic tomatoes to investigate its function. The results showed that Ublf7 plays an important role in regulating reproduction in western flower thrips, and that the mortality rate of western flower thrips fed transgenic tomatoes carrying the dsUblf7 gene reached nearly 60%. Therefore, Ublf7 may serve as a potential target gene for the control of western flower thrips.
[0005] References:
[0006] [1]Elkins JM,Gileadi C,Shrestha L,Phillips C,Wang J,Muniz JRC,DoyleDA.Unusual binding interactions in PDZ domain crystal structures help explainbinding mechanisms.Protein Science 2010;19(4):731-741.
[0007] [2]Yamaguchi M,Satoo K,Suzuki H,Fujioka Y,Ohsumi Y,Inagaki F,NodaNN.Atg7 Activates an Autophagy-Essential Ubiquitin-like Protein Atg8 throughMulti-step Recognition(vol 430,pg 249,2018).Journal of Molecular Biology2018;430(9):1402-1402.
[0008] [3]Yang Z, Chen H, Yang X, Wan
[0009] [4]Kiel C,Serrano L.The ubiquitin domain superfold:structure-basedsequence alignments and characterization of binding epitopes.J Mol Biol 2006;355(4):821-44.
[0010] [5]Greene JC, Whitworth A, Kuo I, PallanckLJJPotNAoSotUSoA. Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants. 2003.
[0011] [6] Broday, Genes LJ, Development. The small ubiquitin-like modifier (SUMO) is required for gonadal and uterine-vulval morphogenesis in Caenorhabditis elegans. 2004; 18(19): 2380. Summary of the Invention
[0012] The invention identifies the Ublf gene family of western flower thrips and mines the Ublf7 gene. The gene is introduced into plants to obtain transgenic plants, which can improve the resistance of the transgenic plants to western flower thrips.
[0013] The present invention provides a protein encoded by gene Ublf7, the amino acid sequence of which is shown as SEQ ID No: 1.
[0014] Furthermore, a gene encoding the protein is provided.
[0015] Specifically, it is a genomic gene, and its nucleotide sequence is shown in SEQ ID No: 1.
[0016] Alternatively, the cDNA gene encoding the protein has a nucleotide sequence as shown in SEQ ID NO: 2.
[0017] The present invention also provides an expression vector containing the gene, and a recombinant host cell containing the gene or its expression vector.
[0018] The present invention further provides use of the gene, the expression vector, or the recombinant host cell in preventing and controlling western flower thrips.
[0019] The present invention ultimately provides a method for improving resistance of transgenic plants to western flower thrips, comprising introducing a gene comprising the gene of claim 3 or 4 into a plant through genetic engineering to obtain a transgenic plant, thereby improving resistance to western flower thrips. Preferably, the genetic engineering method involves introducing an expression vector comprising the gene into the plant through transformation. Preferably, the plant is a tomato.
[0020] Therefore, the gene Ublf7 provided by the present invention can be used to cultivate transgenic plants with improved resistance to western flower thrips, has application value in preventing and controlling western flower thrips, and is beneficial for reducing the amount of pesticides used and playing a certain role in reducing environmental pollution. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Diagram of the Ublf7 gene structure in western flower thrips.
[0022] Figure 2 ORF and encoding amino acid sequence of the Ublf7 gene from western flower thrips.
[0023] Figure 3 Analysis of Ublf7 expression after western flower thrips fed on transgenic tomatoes.
[0024] Figure 4 Mortality of western flower thrips after feeding on transgenic tomatoes.
[0025] Figure 5 Egg production of western flower thrips. DETAILED DESCRIPTION
[0026] The present invention is further described below through specific embodiments, but does not constitute a limitation of the present invention. Example 1: Mining of Ublf7 gene
[0027] This study identified and analyzed the Ublf gene family in western flower thrips and found that a total of 10 genes have ubiquitin-like fold domains. Among them, the Ublf7 gene has no annotation information in the NCBI database, and no homologous genes have been found in other species. The sequence information of the Ublf7 gene obtained in the study is as follows:
[0028] The Ublf7 gene is 11994 bp in length (SEQ ID NO: 1), containing 5 exons and 4 introns ( Figure 1The ORF is 1152 bp long (SEQ ID NO: 2), encoding 383 amino acids (SEQ ID NO: 3). It has a ubiquitin-like fold domain composed of 73 amino acids at 180 amino acids from the N-terminus, and a typical diglycine motif (-GG) of ubiquitin and ubiquitin-like at the end of the conserved domain ( Figure 2 ).
[0029] Example 2: Construction of transgenic tomato plants
[0030] 1. Construction of transgenic vector
[0031] A 187 bp fragment in the Ublf7 gene ORF sequence was selected, and its forward and reverse sequences were respectively constructed into the two ends of the expression intron in the vector pEXT06 / g, and the restriction enzyme cutting sites used were KpnI / SacI to construct a recombinant vector.
[0032] 2. Agrobacterium Transformation
[0033] The recombinant plasmid was transformed using competent Agrobacterium tumefaciens EHA105 cells. A single clone was selected for shaking. The culture was first tested using universal primers for the vector. Plasmids were then extracted from the culture medium of the positive clone and then identified by double enzyme digestion. After successful identification, 50% glycerol was added to the culture medium and stored at -80°C until ready for use.
[0034] 3. Construction of transgenic tomato plants
[0035] Tomato seed treatment:
[0036] 1) Select 200 ripe tomato seeds (plump, not black, green, and not moldy), remove impurities, and prevent the seeds from clumping together;
[0037] 2) Add all the seeds to a 50 mL centrifuge tube, then add 75% alcohol and soak for 30 seconds. Discard the alcohol.
[0038] 3) Add sterile water and wash three times to remove residual alcohol on the seed surface.
[0039] 4) Add an appropriate amount of 10% NaClO, mix thoroughly, and shake on a shaker at 100-110 rpm for 15 minutes, carefully observing the seed coat color until the color fades.
[0040] 5) After taking out the seeds, rinse them with sterilized water 5 times and soak them for 4-8 hours.
[0041] Sowing tomato seeds:
[0042] After washing the soaked seeds with sterile water, inoculate them onto 1 / 2 MS culture medium, seeding 40-50 seeds per dish. After inoculation, seal the dish with a layer of parafilm and incubate at 24°C, approximately 50% humidity, and a photoperiod of 16 L / 8 D for 6-8 days. Label the variety and date.
[0043] Leaf pre-culture / Agrobacterium culture:
[0044] After the cotyledons of the sown tomatoes grow, pull out the seedlings and place them in sterile distilled water. Then, under sterile conditions, cut the cotyledons with scissors and place them in MSO. Then, use tweezers to spread the leaves with the front side facing up on the pre-prepared culture medium (the culture medium needs to be covered with a layer of sterile filter paper in advance), and culture them in a greenhouse at 25°C for 1-2 days, marking the date.
[0045] Streak the Agrobacterium EHA105 containing the target gene vector on a plate containing the corresponding antibiotics, culture it in a 28°C incubator for 2 days until a monoclonal colony grows, pick a monoclonal colony and shake it in large quantities. During this period, be sure to measure the absorbance of the bacterial solution at a wavelength of 600nm at regular intervals. Infect when the OD value is approximately 0.7.
[0046] Agrobacterium infection:
[0047] 1) Centrifuge the shaken bacterial suspension at 3000 rpm for 1 minute, remove the supernatant, and then add an appropriate amount of MSO to suspend the bacteria;
[0048] 2) Use tweezers to place the pre-cultured leaves into a 9 cm Petri dish and add an appropriate amount of Agrobacterium suspension;
[0049] 3) Place the leaves in a shaker at room temperature for 15 minutes;
[0050] 4) Discard the suspension and use sterile filter paper to remove as much residual bacterial liquid as possible from the leaf. Then, use tweezers to lay the leaf flat, back side up, on the pre-culture medium (pre-laid with a layer of sterile filter paper).
[0051] 5) Incubate in the dark at 25°C for 2 days and mark the date.
[0052] Screening and differentiation culture:
[0053] After co-culturing leaves with Agrobacterium for two days, transfer the leaves, facing upward, to selective culture medium, ensuring the leaf wound is in contact with the culture medium as much as possible. Seal the leaves with a double layer of parafilm and incubate in a greenhouse at 25°C under a 16L / 8D photoperiod for two weeks. Callus (wounds) are typically visible after two weeks of culture on selective culture medium, and selection cultures are performed every two weeks.
[0054] Rooting of seedlings:
[0055] After the differentiated seedlings grow to 2-3 cm, transfer them to a rooting box with rooting medium and let them grow. After sampling and identification, move the individual seedlings to a rooting bottle with rooting medium. The rooting culture conditions are 28-30℃ and sterile light culture. Identification is carried out after the seedlings grow up.
[0056] Example 3: Determination of feeding of western flower thrips on transgenic tomatoes
[0057] 1. Determination of the interference efficiency of transgenic tomatoes
[0058] One transgenic tomato plant and one wild-type tomato plant that tested positive were selected, each with well-developed leaves. A 10mL centrifuge tube was cut cleanly 1 cm from the bottom. The cut edge was then lightly heated with an alcohol burner until slightly melted. The tube was then quickly attached to a 200-mesh gauze screen (this step ensures good air permeability throughout the experiment). A triangular notch approximately 0.5-0.7 cm long was cut at the edge of the tube with scissors (the size of the notch was determined based on the development of the leaf blade and petiole). 20-50 adult male and female western flower thrips were placed into the device (the number of test insects was determined based on experimental needs). An appropriate tomato leaf was then slowly inserted into the device. The tube cap was then quickly replaced, with the petiole just fitting into the triangular notch. Finally, the tube was sealed with parafilm from the incision to the tomato leaf to prevent adult western flower thrips from escaping through the gap. Three biological replicates were set up. After 24 hours, the test insects were removed and quantitative PCR was performed using the FastFire Rapid Fluorescence Quantitative PCR Premix Kit (Tiangen, Beijing, China) according to the system mixed according to the manufacturer's instructions. Three technical replicates were set up for each biological replicate (Ublf7Q-F TCAAGACGCTGACGGGAAAA, Ublf7Q-RCGAGATGCAACTTGGACCCT; SDHA-FGCGAAGTATCTTAGCACCAT, SDHA-RATGCCCATCACCTCAGTTT; actin-F CTGTTCCACCCTTCATTCG, actin-RGGGCGGTGATCTCCTTCT) to determine the interference efficiency of transgenic tomatoes. The reaction system and procedure are as follows:
[0059] Reaction system:
[0060]
[0061] Reaction procedure:
[0062]
[0063] The male and female adults of western flower thrips were taken out after feeding on transgenic and wild-type tomatoes for 1, 2 and 3 days, and their mortality was counted. Four biological replicates were set.
[0064] The experimental results are as follows:
[0065] (1) Analysis of Ublf7 expression levels after western flower thrips fed on transgenic tomatoes
[0066] Fluorescence quantitative analysis showed that after 24 hours of feeding on transgenic tomatoes, the expression levels of the Ublf7 gene in male and female adults decreased significantly by 38% and 27.6%, respectively, compared with the control group ( Figure 3 ).
[0067] (2) Mortality of western flower thrips after feeding on transgenic tomatoes
[0068] The results showed that compared with the control group, the mortality rate of female western flower thrips increased significantly after feeding on transgenic tomatoes for one day. There was no significant difference in the mortality rate of males. After two days, the mortality rate of both males and females increased significantly. After three days of feeding on transgenic tomatoes, the mortality rate of male and female adults reached 46.7% and 59.3% ( Figure 4 ).
[0069] Example 4: RNA interference experiment with western flower thrips
[0070] (1) dsRNA synthesis:
[0071] The product of the amplification of the interference primers with T7 promoter (interference primer sequences dsUblf7-FTAATACGACTCACTATAGGGACCTGGACAGGATGTTTTGG, dsUblf7-RTAATACGACTCACTATAGGGGGCTTCTTTGAACACCTTGG; dsEGFP-FTAATACGACTCACTATAGGGCAGTGCTTCAGCCGCTAC, dsEGFP-RTAATACGACTCACTATAGGGGTTCACCTTGATGCCGTTC) was used as a template to synthesize dsRNA (SEQ ID NO: 4). The kit used was AmpliScribe TM T7-Flash TM Transcription Kit (Lucigen). The specific steps are as follows:
[0072] 1) Take a 1.5 mL centrifuge tube without RNAse and prepare the premix (20 μL system) according to the following system:
[0073]
[0074]
[0075] The above is a single reaction system, which can generally be synthesized into 10-20 reactions by increasing the amount of each component in proportion.
[0076] 2) Place the centrifuge tube in a 37°C metal bath and incubate for 30 minutes (incubation at 42°C for 30 minutes can increase the yield by 10%).
[0077] 3) Add 1 μL (1 MBU) of RNase-Free DNase I to the 20 μL reaction system and incubate at 37°C for 15 minutes;
[0078] 4) Add 1 volume of 5M ammonium acetate;
[0079] 5) Place the centrifuge tube back on ice and incubate for 10-15 minutes;
[0080] 6) Centrifuge at 13,000 rpm for 15 minutes at 4°C (you can also centrifuge at room temperature) while preparing the
[0081] 70% ethanol;
[0082] 7) Discard the supernatant and wash the tube 1-2 times with 70% ethanol, following the same washing steps as for RNA.
[0083] 8) Discard the supernatant and determine the volume of RNase-Free water to add based on the amount of precipitate. Typically, 150-200 μL of water is needed for 10 reactions.
[0084] 9) Pipette to mix thoroughly to dissolve the precipitate. Remove 1 μL of the aliquot to measure RNA concentration, label, and store in a -80°C freezer.
[0085] (2) Egg production after RNA interference in western flower thrips
[0086] RNA interference was performed on newly emerged male and female adults of the NIL-R population of western flower thrips, followed by mating 1 day later, and their egg production was measured. The specific steps are as follows:
[0087] 1) Take a small plastic bottle with a height of 6.5 cm and a diameter of 5.5 cm, make a hole with a diameter of 3 cm in the bottle cap, and stick 200 mesh gauze with hot melt glue.
[0088] 2) Pair male and female adults according to the above protocol and place them in a plastic bottle. Then, cut the green bean pods into approximately 5 cm segments and seal the cuts with Parafilm to prevent the insects from entering the pods.
[0089] 3) The survival days of each group of insects were observed and recorded every day. In addition, fresh green bean pods were replaced every day and stored in a plastic bottle (15 cm high, 5 cm in diameter) with a layer of filter paper (5 cm wide, 1 cm long) in the bottle.
[0090] 10cm).
[0091] 4) Count the number of F1 generation nymphs hatched every 3 days and use this as the number of eggs laid by female insects.
[0092] The experimental results are as follows: The results of the egg production after RNAi interference of the Ublf7 gene of western flower thrips showed that 24 hours after the Ublf7 gene was interfered with, the average total egg production of female insects was significantly reduced compared with the control group. The control group had 100.9 eggs, while the treatment group had only 24.19 eggs, a decrease of nearly 76% ( Figure 5 ).
[0093] Based on the above examples, it is clear that the Ublf7 gene plays an important role in the reproductive process of western flower thrips. In this study, silencing the Ublf7 gene significantly reduced the egg production of western flower thrips. Furthermore, the mortality rate of western flower thrips increased significantly after feeding on transgenic tomatoes. This gene, which has no homologs found in other species, is specific to western flower thrips. Therefore, the Ublf7 gene may serve as a potential control target and play a role in controlling the western flower thrips population, reducing the use of chemical pesticides, and alleviating environmental pollution.
Claims
1. A protein encoded by gene Ublf7, characterized in that: Its amino acid sequence is shown in SEQ ID No:
3.
2. A gene encoding the protein according to claim 1.
3. The gene according to claim 2, characterized in that The nucleotide sequence of the cDNA gene encoding the protein is shown in SEQ ID NO:
2.
4. An expression vector containing the gene according to claim 2 or 3.
5. A recombinant host cell comprising the gene according to claim 2 or 3 and the expression vector according to claim 4, wherein the recombinant host cell is not a plant cell.
6. Use of the gene according to claim 2 or 3, the expression vector according to claim 4, or the recombinant host cell according to claim 5 in controlling western flower thrips.
7. A method for improving the resistance of transgenic plants to western flower thrips, characterized in that: A transgenic plant is obtained by introducing the gene according to claim 2 or 3 into a plant through genetic engineering to improve its resistance to western flower thrips; the plant is a tomato.
8. The method according to claim 7, wherein The genetic engineering method is to introduce the expression vector containing the gene into the plant through a transformation method.
Citation Information
Patent Citations
Method and device performing RNA interference on frankliniella occidentalis
CN109077028A