Aptamer Biosensor Based on Covalent Organic Framework Materials and Its Preparation Method and Application
The biosensor is prepared by combining porous triazine-based covalent organic framework materials with DNA aptamers, which solves the problem of lack of ATP and thrombin detection in the prior art, and achieves high selectivity and sensitivity fluorescence detection.
Patent Information
- Application Number
- CN202211683805.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-27
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2042-12-27
AI Technical Summary
Biosensors based on organic framework materials for detecting adenosine 5'-triphosphate (ATP) and thrombin are lacking in the prior art.
Aptamer biosensor based on covalent organic frame materials is prepared by combining porous triazine-based covalent organic frame materials, and high selectivity and sensitivity detection are achieved through fluorescence switch detection function.
High sensitivity and selective detection of ATP and thrombin are achieved, with potential fluorescence switch detection functions.
Smart Images

Figure CN116284768B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of cosmetics, and in particular relates to an aptamer biosensor based on a covalent organic framework material, and a preparation method and application thereof. Background Art
[0002] Covalent organic frameworks (COFs) are crystalline porous organic polymers that have attracted significant attention due to their tunable pores, permanent and periodic porosity, low density, large surface area, and high thermal stability.
[0003] Depending on the symmetry of the monomers, two-dimensional COFs generated in various topological forms (quadrilaterals, hexagons, rhombuses, triangles, etc.) can display different pore sizes and shapes. In addition, two-dimensional COFs with predictable topology provide adjustable functions for various applications by selecting appropriate monomers and integrating functional parts. For example, the specific interaction between COFs and target biomolecules (such as DNA, mRNA, ATP, etc.) helps to restore the fluorescence response in this significantly regulated manner. However, there are relatively few reports on the use of these platform sensors for the detection of adenosine 5'-triphosphate (ATP) and thrombin.
[0004] Therefore, the prior art needs to be further improved and enhanced. Summary of the Invention
[0005] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide an aptamer biosensor based on a covalent organic framework material and its preparation method and application, aiming to solve the problem of the existing lack of biosensors based on organic framework materials for detecting adenosine 5'-triphosphate (ATP) and thrombin.
[0006] An aptamer biosensor based on a covalent organic framework material comprises a porous triazine-based covalent organic framework and a DNA aptamer; the DNA aptamer is adsorbed on the surface of the porous triazine-based covalent organic framework.
[0007] Optionally, in the aptamer biosensor based on a covalent organic framework material, the structural formula of the porous triazine-based covalent organic framework is as follows:
[0008]
[0009] A method for preparing the above-mentioned aptamer biosensor based on covalent organic framework material, comprising the steps of:
[0010] The porous triazine-based covalent organic framework material and the DNA aptamer are dispersed in a buffer solution and incubated to obtain the aptamer biosensor based on the covalent organic framework material.
[0011] Optionally, in the method for preparing the aptamer biosensor based on the covalent organic framework material, the molar ratio between the porous triazine-based covalent organic framework material and the DNA aptamer is 25 μg / mL:10 μM.
[0012] Optionally, the method for preparing the aptamer biosensor based on the covalent organic framework material, wherein the method for preparing the porous triazine-based covalent organic framework material comprises:
[0013] Mixing methylbenzotriazole, tris(4-formylphenyl)amine and 1,4-dioxane, and performing ultrasonic treatment to obtain a mixture solution;
[0014] Acetic acid is added to the mixture solution, which is frozen with liquid nitrogen, degassed using a freeze-pump-thaw cycle, sealed under vacuum, and reacted under certain reaction conditions to obtain a porous triazine-based covalent organic framework material.
[0015] Optionally, in the method for preparing the aptamer biosensor based on the covalent organic framework material, the step of reacting under certain reaction conditions comprises reacting at a temperature of 110-130° C. and reacting for 3-5 days.
[0016] Optionally, in the method for preparing the aptamer biosensor based on the covalent organic framework material, the molar ratio of the methylbenzotriazole to tris(4-formylphenyl)amine under the action of the solvent 1,4-dioxane is 1:1.
[0017] Optionally, in the method for preparing the aptamer biosensor based on covalent organic framework materials, the buffer solution is selected from tris(hydroxymethyl)aminomethane hydrochloride.
[0018] An application of the above-mentioned aptamer biosensor based on covalent organic framework materials, wherein the aptamer biosensor based on covalent organic framework materials is used to detect adenosine 5'-triphosphate.
[0019] An application of the above-mentioned aptamer biosensor based on covalent organic framework materials, wherein the aptamer biosensor based on covalent organic framework materials is used in detecting thrombin.
[0020] Beneficial effects: Compared with the existing technology, the COF-based biomolecule detection platform provided by the present invention has potential fluorescence switch detection function and can specifically bind to aptamers, making it have higher selectivity and sensitivity, and can be used to detect ATP and thrombin. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1Characterization of the TaTPA-COF material in the present invention, wherein: A) Scanning Electron Microscope --- SEM image; B) Fourier Transform / Infrared --- FTIR spectrum; C) Powder X-ray Diffraction --- PXRD pattern;
[0022] Figure 2 A) The fluorescence of aptamer 1 (10 μM) depends on the concentration of the covalent organic framework (1, 2.5, 5, 10, and 25 μg / mL, respectively); B) The fluorescence quenching efficiency of TaTPA-COF. The concentrations of AP1 and AP2 were 10 μM, and the TaTPA-COF concentrations in the final solution were 1, 2.5, 5, 10, and 25 μg / mL, respectively; C) The dependence of the fluorescent probe (10 μM) on the ATP concentration (0, 50, 100, 150, 200, and 300 μM) and the TaTPA-COF covalent organic framework at 2.5 μg / mL; D) The selectivity of the TaTPA-COF-based sensor in the presence of aptamer-AP2, single-base mismatch (SM), and random (R). In the presence of 300 μM ATP, the concentrations of AP1 and AP2, (SM), and random (R) were 10 μM, respectively, and the concentration of TaTPA-COF in the final solution was 2.5 μg / mL (excitation at 490 nm, emission at 519 nm). The downward arrow in the figure indicates that the fluorescence intensity decreases with increasing COF concentration.
[0023] Figure 3 A) Fluorescence quenching efficiency of TaTPA-COF and rGO-2; the concentration of fluorescently labeled G4-TBA was 1 μM, and the final TaTPA-COF concentrations in the solution were 1, 2.5, 5, 10, and 25 μg / mL, respectively, while the rGO-2 concentration was 30 μg / mL; B) The fluorescence intensity of G4-TBA (1 μM) depends on the thrombin concentration (100-500 units / mL) and the TaTPA-COF concentration of 10 μg / mL; C) Calibration curve for thrombin detection. Inset: Linear plot of fluorescence signal versus target thrombin concentration (excitation at 490 nm, emission at 519 nm). DETAILED DESCRIPTION
[0024] The present invention provides an aptamer biosensor based on a covalent organic framework material, as well as its preparation method and application. To clarify the objectives, technical solutions, and effects of the present invention, the present invention is described in further detail below. It should be understood that the specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention.
[0025] This invention provides a method for synthesizing a porous triazine-based covalent organic framework (TaTPA-COF). As a proof-of-concept application, the resulting TaTPA-COF, combined with a DNA aptamer, was used as a novel fluorescent biosensor for the highly sensitive and selective detection of ATP and thrombin. Therefore, the proposed COF-based biosensor can be expanded as a "fluorescent switch" for a variety of promising nanomedicine applications.
[0026] Specifically, the present invention utilizes a simple solvothermal and condensation method of 2,4,6-tris(4-aminophenyl)-1,3,5-triazine-TTA and tris(4-formylphenyl)amine-TFPA to efficiently synthesize TaTPA-COF in a single step. The resulting TaTPA-COF material is then combined with a DNA aptamer as a receptor (quencher) for the highly sensitive and selective detection of adenosine 5'-triphosphate (ATP) and thrombin.
[0027] In this embodiment, the structural formula of the TaTPA-COF material in the COF-DNA aptamer biosensor is:
[0028]
[0029] Based on the same inventive concept, the present invention also provides a method for preparing the COF-DNA aptamer biosensor, which specifically comprises:
[0030] Step S10, synthesis of TaTPA-COF material;
[0031] Step S20, COF-DNA combination for fluorescent ATP detection;
[0032] Step S30: COF-DNA combination for fluorescent thrombin assay.
[0033] In one embodiment, the synthesis of the TaTPA-COF material comprises:
[0034] Step S11, adding 2,4,6-tris(4-aminophenyl)-1,3,5-triazine, tris(4-formylphenyl)amine and 1,4-dioxane to a Pyrex centrifuge tube to obtain a preliminary mixture, and sonicating the mixture to obtain a clear solution;
[0035] Step S12, adding acetic acid to the solution, followed by rapid freezing with liquid nitrogen, degassing using a freeze-pump-thaw cycle, sealing under vacuum, and heating at 120° C. for 4 days;
[0036] Step S13: a yellow precipitate is formed, collected by centrifugation, washed 2-3 times with anhydrous methanol, and dried under vacuum at 120° C. for 12 h.
[0037] For example:
[0038] 2,4,6-Tris(4-aminophenyl)-1,3,5-triazine (40 mg, 0.113 mmol), tris(4-formylphenyl)amine (37 mg, 113 mmol) and 5 mL of 1,4-dioxane were added to a 10 mL Pyrex tube, and the mixture was sonicated for 5 min to obtain a clear solution.
[0039] To the clear solution was added 0.25 mL of acetic acid (3 M).Then, the Pyrex tube was flash frozen in a 77K liquid nitrogen tank, degassed using freeze-pump-thaw cycles, sealed under vacuum, and heated at 120°C for 4 days.
[0040] The yellow precipitate was collected by centrifugation, washed three times with anhydrous methanol, and dried under vacuum at 120°C for 12 hours (82 mg, isolated yield 88%).
[0041] In one embodiment, the COF-DNA combination step for ATP fluorescence detection includes:
[0042] Step S21: Incubate aptamer 1 with different concentrations of TaTPA-COF in reaction buffer for 2 hours and then measure fluorescence;
[0043] In step S22, the TaTPA-COF DNA aptamers AP1 and AP2 were incubated with different concentrations of TaTPA-COF in a reaction buffer for 2 hours, and then fluorescence was measured to determine the fluorescence quenching efficiency. It should be noted that the sequences of the aptamers used for detecting biological analytes in the present invention are shown in the following table:
[0044]
[0045] For example:
[0046] 5 μL of aptamer 1 (AP1, 10 μM) was incubated with 50 μL of TaTPA-COF (1-25 μg / mL) in 440 μL of reaction buffer (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, pH = 7.4) for 2 h, and then the fluorescence was measured.
[0047] The aptamers of TaTPA-COF were 2.5 μL of AP1 (10 μM) and 5 μL of AP2 (10 μM), which were incubated with 50 μL of TaTPA-COF (1-25 μg / mL) in 440 μL of reaction buffer (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, pH = 7.4) for 2 h before fluorescence measurement.
[0048] In one embodiment, the COF-DNA combination step for fluorescent thrombin assay comprises:
[0049] Step S31: The TaTPA-COF aptamer G4-TBA is co-incubated with TaTPA-COF of different concentrations in a buffer solution for 2 h.
[0050] Step S32: G4-TBA and rGO (partially reduced graphene oxide) are co-incubated in a buffer solution for 2 h.
[0051] For example:
[0052] 5 μL of G4-TBA (1 μM) and 50 μL of TaTPA-COF (1-25 μg / mL) were incubated for 2 h.
[0053] 30 μg / mL rGO-2 was incubated in 440 μL reaction buffer (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl2, pH 7.4) for 2 h and then the fluorescence was measured.
[0054] Test 1
[0055] The obtained TaTPA-COF was characterized.
[0056] Test 2
[0057] The fluorescence intensity of samples after different incubations was measured.
[0058] Test 3
[0059] ATP assays were performed in 440 μL of reaction buffer containing 50 μL of TaTPA-COF (2.5 μg / mL), 5 μL of AP1 (10 μM), 5 μL of AP2 (10 μM), and varying concentrations of ATP. The reaction solution was incubated for 1 hour before fluorescence measurement. Excitation wavelengths were 490 nm, and emission wavelengths were 519 nm.
[0060] Test 4
[0061] The thrombin assay used 50 μL of COF (50 μL of TaTPA-COF, 10 μg / mL), 5 μL of G4-TBA (1 μM), and varying concentrations of thrombin. The reaction solution was then incubated for 1 hour before fluorescence measurement. Excitation wavelengths were 495 nm and emission wavelengths were 542 nm.
[0062] The test results are as follows:
[0063] During the synthesis, a 1:1 stoichiometric ratio of 2,4,6-tris(4-aminophenyl)-1,3,5-triazine (TTA) and tris(4-formylanilide)amine (TFPA) was chosen as the building blocks because they can be further covalently linked via a [3+3] imine condensation reaction. Briefly, a suspension of TFPA and TTA was placed in a mixture of 1,4-dioxane and aqueous acetic acid and heated at 120°C for 3 days. Bulk TaTPA-COF material was isolated as a dark yellow powder in approximately 88% yield.
[0064] The obtained TaTPA-COF was characterized by FTIR, PXRD and BET. SEM images confirmed that the aggregated TaTPA-COF was in a flake-like morphology (e.g. Figure 1 A in Figure 1). FTIR confirmed the successful formation of the imine bond in TaTPA-COF, and the signals of the amino group and C=O unit of the monomer almost disappeared; -1 A significant signal appears at 1572 cm, indicating C=N stretching vibration. -1 A sharp peak appears at , indicating that COFs are formed by Schiff base polymerization ( Figure 1 The terminal amino group and C=O group on the surface of the composite are at 3366 cm -1 and 1692cm -1 In the PXRD spectrum, the characteristic diffraction peaks of TaTPA-COF are at 4.31, 7.60, 11.64 and 17.94, corresponding to the (100), (210), (200) and (310) planes, respectively. Figure 2 C in ). The broad peak at 22.91 is attributed to the (001) reflection plane ( Figure 1 C).
[0065] To detect the fluorescence quenching efficiency, we mixed different concentrations of TaTPA-COF (1-25 μg / mL) with AP1 ( Figure 2A in ). After adding 1 μg / mL of the covalent organic framework to the solution, the fluorescence intensity of the aptamer AP1 was quenched to less than 20%. When the concentration of the covalent organic framework increased to 2.5 μg / mL and above 5 μg / mL, the fluorescence intensity of the aptamer was quenched by 36% and 78%, respectively. As the concentration of TaTPA-COF gradually increased, the fluorescence intensity further decreased. When the concentration of the covalent organic framework was increased to above 10 μg / mL, the fluorescence intensity of AP1 was quenched by more than 87%. After adding 25 μg / mL of the covalent organic framework material to the solution, the fluorescence quenching efficiency reached 94%. In order to study whether the TaTPA-COF-based fluorescence sensor has the same characteristics for double-stranded DNA, we further introduced the complementary chain (AP2) of the aptamer probe (AP1). When the same concentrations of AP1 and AP2 were treated in buffer solution and different concentrations of covalent organic framework materials, the fluorescence quenching efficiency of the DNA double-strand was also the same as when only single-stranded AP1 was used ( Figure 2 B). This result indicates that TaTPA-COF can effectively adsorb and quench FAM-labeled single oligonucleotides or DNA double strands. Figure 2 As shown in Figure C, the fluorescence quenching of the FAM-labeled probe can be restored due to the binding to the target ATP. Under the optimal experimental conditions, the fluorescence intensity increased with the increase of ATP concentration (50-300 μM). Therefore, the proposed COF-based sensing platform has potential for fluorescence switch detection and can be specifically combined with aptamers. In addition, we also used single-stranded (SM) and random (R) with single base mismatches to evaluate the selectivity of the proposed ATP sensor. Figure 2 As shown in D, compared with SM and R, in the presence of target ATP, the fluorescence of the system increased greatly after the addition of complementary chain AP2, showing the high selectivity of the TaTPA-COF-based fluorescence sensor.
[0066] Next, by simply replacing the probe molecule, the constructed fluorescence sensing platform was also extended to detect other biomolecules, such as thrombin. We studied the universal thrombin detection of G4-TBA (GGTTGGTGTGGTTGG) to evaluate the performance of the TaTPA-COF-based fluorescence sensor. A series of different concentrations of TaTPA-COF (1-25μg / mL) were added to the solution. When 25μg / mL of TaTPA-COF was used, the quenching efficiency reached 89% ( Figure 3A in the figure). As a comparative experiment, the fluorescence quenching efficiency of the covalent organic framework material is superior to that of rGO-2, which we recently reported. As mentioned above, in the absence of thrombin, the fluorescence of the labeled G4-TBA is quenched due to the adsorption of the aptamer on the surface and pores of TaTPA-COF. After the addition of thrombin, its target can bind to the aptamer, resulting in a structural transformation of the aptamer, causing the covalent organic framework material to release the fluorescently labeled aptamer and restore fluorescence. Under the experimental conditions, as the thrombin concentration increases, the fluorescence intensity of the G4-TBA and covalent organic framework composite system gradually increases, as shown in Figure 2. Figure 3 The recovered fluorescence was linear in the range of 50-200 units / mL, with a detection limit of 100 units / mL ( Figure 3 C).
[0067] In summary, the present invention provides an aptamer biosensor based on a covalent organic framework (COF), as well as its preparation method and application. The biosensor comprises a porous triazine-based COF and a DNA aptamer adsorbed on the surface of the porous triazine-based COF. The COF-based biomolecule detection platform provided by the present invention has potential for fluorescence switch detection and can specifically bind to the aptamer, resulting in high selectivity and sensitivity, and can be used to detect ATP and thrombin.
[0068] It should be understood that the application of the present invention is not limited to the above examples. For those skilled in the art, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.
Claims
1. An aptamer biosensor based on a covalent organic framework material, characterized in that: include: A porous triazine-based covalent organic framework and a DNA aptamer; the DNA aptamer is adsorbed on the surface of the porous triazine-based covalent organic framework; The structural formula of the porous triazine-based covalent organic framework is as follows: ; The DNA aptamer includes: AP1, AP2 and G4-TBA; wherein the sequence of the AP1 is 5'-FAM-acctgggggagtattgcggaggaaggt, the sequence of AP2 is accttectccgcaatactccccacggt, and the sequence of the G4-TBA is ggttggtgtggttgg.
2. A method for preparing an aptamer biosensor based on a covalent organic framework material according to claim 1, characterized in that: Including steps: The porous triazine-based covalent organic framework material and the DNA aptamer are dispersed in a buffer solution and incubated to obtain the aptamer biosensor based on the covalent organic framework material.
3. The method for preparing an aptamer biosensor based on a covalent organic framework material according to claim 2, wherein: The molar ratio of the porous triazine-based covalent organic framework material to the DNA aptamer is 25 μg / mL: 10 μM.
4. The method for preparing an aptamer biosensor based on a covalent organic framework material according to claim 2, wherein: The preparation method of the porous triazine-based covalent organic framework material comprises: 2,4,6-tris(4-aminophenyl)-1,3,5-triazine, tris(4-formylphenyl)amine and 1,4-dioxane were mixed and subjected to ultrasonic treatment to obtain a mixture solution; Acetic acid is added to the mixture solution, which is frozen with liquid nitrogen, degassed using a freeze-pump-thaw cycle, sealed under vacuum, and reacted under certain reaction conditions to obtain a porous triazine-based covalent organic framework material.
5. The method for preparing an aptamer biosensor based on a covalent organic framework material according to claim 4, wherein: The reaction is carried out under certain reaction conditions, wherein the reaction temperature is 110-130° C. and the reaction time is 3-5 days.
6. The method for preparing an aptamer biosensor based on a covalent organic framework material according to claim 4, characterized in that: The molar ratio of the 2,4,6-tris(4-aminophenyl)-1,3,5-triazine to tris(4-formylphenyl)amine under the action of the solvent 1,4-dioxane is 1:
1.
7. The method for preparing an aptamer biosensor based on a covalent organic framework material according to claim 2, characterized in that: The buffer solution is tris(hydroxymethyl)aminomethane hydrochloride.
8. An application of the aptamer biosensor based on the covalent organic framework material according to claim 1, characterized in that: The aptamer biosensor based on the covalent organic framework material is used to detect adenosine 5'-triphosphate.
9. An application of the aptamer biosensor based on the covalent organic framework material according to claim 1, characterized in that: Application of the covalent organic framework material-based aptamer biosensor in detecting thrombin.
Citation Information
Patent Citations
Aptamer modified triazine covalent organic framework composite material and preparation method and application thereof
CN109174009A