Cyclopentapeptide compounds and their use in alpha-glucosidase inhibitor hypoglycemic drugs or preventive health products
By extracting cyclic pentapeptide compounds from marine Aspergillus fungus TW58-5, the adverse reactions and preparation complexity of existing α-glucosidase inhibitors have been solved, achieving a highly efficient and safe α-glucosidase inhibition effect, which is suitable for the preparation of hypoglycemic drugs and health products.
Patent Information
- Application Number
- CN202111575086.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-12-21
- Publication Date
- 2026-01-09
- Estimated Expiration
- 2041-12-21
AI Technical Summary
Existing α-glucosidase inhibitors, such as acarbose, have problems with adverse reactions and complex preparation processes when used to treat type II diabetes, leading to reduced treatment adherence and low production volume.
Novel cyclic pentapeptide compounds were extracted from marine Aspergillus fungus TW58-5. High-purity cyclic pentapeptide compounds were obtained through fermentation, extraction and chromatography separation methods, which can be used to prepare α-glucosidase inhibitor hypoglycemic drugs or preventive health products.
Cyclic pentapeptides exhibited 74%–100% inhibition of α-glucosidase at a concentration of 400 μM, with IC50 values of 94.4 μM and 44.1 μM, respectively, demonstrating superior inhibitory activity compared to existing drugs and making them suitable for large-scale production.
Smart Images

Figure CN116286380B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of marine fungal metabolites as new α-glucosidase inhibitors, in particular to a class of cyclic pentapeptide compounds and their application in α-glucosidase inhibitor hypoglycemic drugs or preventive health products. BACKGROUND
[0002] At present, diabetes mellitus (DM) is a common metabolic disease next to tumor and cardiovascular and cerebrovascular diseases, which seriously endangers human life and health. Among them, the incidence of type II diabetes (T2DM) is the highest, accounting for 90% of the total cases of diabetes. In addition to exogenous insulin supplementation for diabetic patients, oral administration of different types of hypoglycemic drugs is the main strategy for treating type II diabetes. α-Glucosidase inhibitors are anti-diabetic drugs with strong specific action and significant efficacy, and have always been an ideal drug for treating type II diabetes. There are currently three α-glucosidase inhibitors used in clinical practice: acarbose, voglibose and migltol. Although this class of drugs has higher safety compared to other hypoglycemic drugs, they can also cause some adverse reactions in patients, mainly manifested as abdominal discomfort, nausea, vomiting and other gastrointestinal reactions, and studies have shown that gastrointestinal side effects are the main reason for the decrease in patient compliance with diabetes treatment. In addition, due to the complex preparation process of the monosaccharide or pseudo-sugar backbone structure of the existing three marketed drugs, it is easily affected by various factors, resulting in low yield. Therefore, it is of great significance to seek safer, more efficient and easily prepared α-glucosidase inhibitors for the research and development of type II diabetes treatment drugs.
[0003] Aspergillus fungi are a class of filamentous fungi that exist in different habitats in nature and are widely distributed. Aspergillus has a rich variety of enzymes and can produce various types of physiologically active metabolites, including alkaloids, polypeptides, polyketides, anthraquinones, phenazines, etc. These metabolites are closely related to human life and have wide applications and great market potential, and can be widely used in agriculture, medicine, cosmetics, biological energy development, food and other industries.
[0004] Peptides are an important class of secondary metabolites of Aspergillus fungi, which play an important role in antibacterial (bacitracin, echinocandins, daptomycin), anticancer (bleomycin) and immunosuppressive (cyclosporine) aspects. Literature reports that peptide compounds also show great research potential in reducing blood sugar. Some protein hydrolysis peptide mixtures or peptide compounds show certain alpha-glucosidase inhibitory activity, but the reports of cyclopentapeptide compounds are mainly focused on the antitumor activity [invention patent application, CN113185582A, 20210730; invention patent, CN101659694A, 20100303; invention patent, CN101270154, 20080924], and there is no report on the alpha-glucosidase inhibitor hypoglycemic activity. SUMMARY
[0005] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present application is to provide a new class of cyclopentapeptide compounds and their application in the preparation of alpha-glucosidase inhibitor hypoglycemic drugs or preventive health products.
[0006] The cyclopentapeptide compounds in the present application are novel natural active substances with medicinal value extracted from marine Aspergillus TW58-5 (Aspergillus sp. TW58-5). It is found that they can effectively inhibit the activity of alpha-glucosidase and can be applied to the development of hypoglycemic drugs or preventive health products.
[0007] The purpose of the present application is achieved by the following technical solutions:
[0008] The present application provides a class of cyclopentapeptide compounds or their pharmaceutically acceptable salts and their application in the preparation of alpha-glucosidase inhibitor hypoglycemic drugs or preventive health products, and the structural formula of the cyclopentapeptide compounds is shown as formula 1-4:
[0009]
[0010] The present application provides a marine fungus named Aspergillus TW58-5 (Aspergillus sp. TW58-5), which is isolated and purified from the hydrothermal vent sediments of Guishan Island in northeastern Taiwan, China. The preservation information is as follows: preservation unit: Guangdong Microbial Culture Collection Center (GDMCC), preservation time: December 3, 2021, preservation address: 5th floor, No. 59 Building, Guangdong Microbial Institute, 100 Middle Martyrs Road, Guangzhou, Guangdong Province, preservation number: GDMCC No: 62093.
[0011] The Aspergillus TW58-5 (Aspergillus sp. TW58-5) strain has the following microbiological characteristics:
[0012] The colony diameter is 35-40mm after 5 days of culture at 28 DEG C on PDA medium and 65-70mm after 10 days of culture; the colony has furrows and is radial or concentric; spore formation is moderate; the colony texture is soft and cotton-like; the spores are yellow-green in the center of the colony and dark green at the edge; there are no spores and the edge is 2mm; the mycelium is white to yellow and the exudate is yellow droplets.
[0013] The Aspergillus sp.TW58-5 has the following molecular biological characteristics: the ITS sequence is shown as SEQ ID No.1.
[0014] The application of the marine fungus in preparing alpha-glucosidase inhibitor hypoglycemic drugs.
[0015] The application further provides a preparation method of the cyclic pentapeptide compound, and the cyclic pentapeptide compound is obtained by separation from a fermentation product of the Aspergillus sp.TW58-5.
[0016] Specifically, the method comprises the following steps:
[0017] (1) inoculating the activated Aspergillus sp.TW58-5 into a fermentation medium and performing fermentation culture;
[0018] (2) after the fermentation culture is completed, adding an organic solvent to perform extraction, separating to obtain an extraction liquid, concentrating the extraction liquid to obtain an extract, and performing separation and purification on the extract to obtain the cyclic pentapeptide compound;
[0019] In order to better simulate the marine environment and provide sufficient nutrient components for microbial growth, preferably, the formula of the fermentation medium in step (1) is as follows:
[0020] In terms of 50g of rice, the formula is: 50g of rice, 75mL of ddH2O, and natural PH;
[0021] Alternatively, in terms of 50g of corn kernels, the formula is: 50g of corn kernels, 0.86g of yeast extract powder, 2.37g of ammonium tartrate, 0.17g of MgSO4, 0.25g of KH2PO4, 0.4g of sea salt (2%), 20mL of ddH2O, and natural PH; the corn kernels need to be crushed into granules;
[0022] Alternatively, in terms of 1L of volume, the formula is: 1-5g of starch, 10-20g of bran, 3-15g of yeast paste, 1-8g of KH2PO4, 0.1-0.8g of MgSO4·7H2O, and the rest is sea water;
[0023] Alternatively, the formula is as follows: 200-600 g of potato, 2-10 g of proteose peptone, 1-5 g of yeast extract, 5-20 g of glucose, and the rest of sea water, with a volume of 1 L; the initial pH value is 6.0-7.0.
[0024] Preferably, the fermentation culture condition in step (1) is static culture at 20-30 ℃ for 10-40 days. The static culture means no shake flask culture.
[0025] Further, the fermentation culture condition is static culture at 26-30 ℃ for 10-40 days. More preferably, the static culture is at 28 ℃ for 20 days, under which the yield of the cyclic pentapeptide compound is the highest.
[0026] Preferably, the organic solvent in step (2) is one or two of methanol, ethanol, ethyl acetate and acetone.
[0027] Preferably, after the extract of the fermentation product in step (2) is separated by normal-phase silica gel column chromatography, it is further separated by reverse-phase silica gel column chromatography / high performance liquid chromatography (HPLC). The separation and purification are performed by methods such as open column chromatography of silica gel, ODS column chromatography and preparative HPLC.
[0028] When the normal-phase silica gel column chromatography is used for separation, the eluent can be a mixture of one or more of petroleum ether, n-hexane, ethyl acetate, alcohol and water, which is used for gradient elution of the extract.
[0029] As a preferred, the separation and purification include: the extract is separated by normal-phase silica gel column chromatography, and gradient elution is performed with petroleum ether / ethyl acetate mixture and ethyl acetate in the order of volume ratio 100:0, 98:2, 95:5, 90:10, 80:20, 70:30, 40:60 and 0:100, and each eluted fraction is collected.
[0030] The research of the present application shows that the cyclic pentapeptide compound separated from the fermentation culture of marine fungi by the above method has good α-glucosidase inhibitory activity, and therefore, the present application further provides an application of the cyclic pentapeptide compound in preparation of α-glucosidase inhibitor hypoglycemic drugs or preventive health products.
[0031] Further, the α-glucosidase inhibitor hypoglycemic drug is used for preventing and treating type II diabetes.
[0032] The medicine is prepared by adding pharmaceutically acceptable adjuvants to the cyclopentapeptide compound or its pharmaceutically acceptable salt as the main active ingredient, and can be prepared into a preparation according to the preparation method recorded in pharmacy. The preparation can be injection, infusion, powder injection, granules, tablets, powder, oral liquid, sugar-coated tablets, film-coated tablets, enteric-coated tablets, buccal tablets, granules, pills, ointments, Dan, spray, dripping pills, disintegrating agent, oral disintegrating tablets, pellets and the like.
[0033] The health product is prepared by adding acceptable health food adjuvants to the cyclopentapeptide compound or its pharmaceutically acceptable salt as the main active ingredient.
[0034] The present application has the following advantages and effects relative to the prior art:
[0035] (1) The present application uses the polarity difference of the peptide compound to extract and separate a cyclopentapeptide compound from the fermentation culture of marine fungi. The method is simple in operation, high in extraction yield and high in product purity, and is suitable for large-scale production.
[0036] (2) Through in vitro α-glucosidase inhibitory activity evaluation, it is shown that the cyclopentapeptide compound provided by the present application has good α-glucosidase inhibitory activity, and the inhibition rate of the compound to α-glucosidase is 74% to 100% at a concentration of 400 μM, which is stronger than the positive drug acarbose. The IC 50 values of the compounds represented by formula 1 and formula 4 are 94.4 μM and 44.1 μM, respectively, and the compounds can be used for preparing α-glucosidase inhibitor hypoglycemic drugs and health care food, and have good development prospects. BRIEF DESCRIPTION OF DRAWINGS
[0037] Figure 1 is the structural formula of the cyclopentapeptide compound of the present application.
[0038] Figure 2 is a result graph for determining the absolute configuration of the Leu and 5-Me-Nle fragments in compound 1 by using Marfey method combined with high performance liquid chromatography (HPLC).
[0039] Figure 3 is a clustering analysis graph of the ITS gene sequence of strain TW58-5.
[0040] Figure 4 is an HR-ESI-Q-TOF-MS graph of compound 1 prepared in Example 4 of the present application.
[0041] Figure 5 is an H-NMR graph of compound 1 prepared in Example 4 of the present application. 1
[0042] Figure 6 is a DEPT 135-NMR plot of compound 1 prepared in Example 4 of the present invention. 13 H-NMR plot.
[0043] Figure 7 is a DEPT 135-NMR plot of compound 2 prepared in Example 4 of the present invention.
[0044] Figure 8 is a HR-ESI-Q-TOF-MS plot of compound 2 prepared in Example 4 of the present invention.
[0045] Figure 9 is a H-NMR plot of compound 2 prepared in Example 4 of the present invention. 1 H-NMR plot.
[0046] Figure 10 is a C-NMR plot of compound 2 prepared in Example 4 of the present invention. 13 H-NMR plot.
[0047] Figure 11 is a DEPT 135-NMR plot of compound 2 prepared in Example 4 of the present invention.
[0048] Figure 12 is a HR-ESI-Q-TOF-MS plot of compound 3 prepared in Example 4 of the present invention.
[0049] Figure 13 is a H-NMR plot of compound 3 prepared in Example 4 of the present invention. 1 H-NMR plot.
[0050] Figure 14 is a C-NMR plot of compound 3 prepared in Example 4 of the present invention. 13 H-NMR plot.
[0051] Figure 15 is a DEPT 135-NMR plot of compound 3 prepared in Example 4 of the present invention.
[0052] Figure 16 is a HR-ESI-Q-TOF-MS plot of compound 4 prepared in Example 4 of the present invention.
[0053] Figure 17 is a H-NMR plot of compound 4 prepared in Example 4 of the present invention. 1 H-NMR plot.
[0054] Figure 18 is a C-NMR plot of compound 4 prepared in Example 4 of the present invention. 13 H-NMR plot.
[0055] Figure 19 is a DEPT 135-NMR plot of compound 4 prepared in Example 4 of the present invention.
[0056] Figure 20 is the dose-dependent relationship of the α-glucosidase inhibitory activity of compound 1-4; wherein A is the dose-dependent relationship of the α-glucosidase inhibitory activity of compound 1-4; B is the α-glucosidase inhibitory activity result graph of compound 1; and C is the α-glucosidase inhibitory activity result graph of compound 4. DETAILED DESCRIPTION
[0057] The present application will be further described in details with reference to the following examples and drawings, but the embodiments of the present application are not limited thereto.
[0058] The test methods in the following examples, unless otherwise specified, were generally conducted in accordance with conventional experimental conditions or in accordance with the experimental conditions suggested by the manufacturers. The materials, reagents, etc. used, unless otherwise specified, were reagents and materials obtained from commercial sources.
[0059] Example 1 Isolation of Fungus TW58-5
[0060] Strain TW58-5 was isolated from the sediment of a hydrothermal vent on Guishan Island, northeastern Taiwan, China. The sediment sample was first placed in a sterile petri dish and air-dried in the natural environment, and then 1 g of the air-dried sediment sample was weighed and dissolved in 10 mL of 50% seawater solution to obtain a 10 -1 solution. The solution was further diluted to 10 -2 , 10 -3 to obtain three gradient sample solutions. 100 μL of each sample solution was spread on isolation media GPY medium, Martin medium, CA medium, PDA medium, SDA medium, and Fungus No. 2 medium, respectively, and each isolation medium was incubated at 28°C for 1-8 weeks. The single colonies were observed and picked, and then inoculated on Fungus No. 2 medium to obtain a pure culture strain.
[0061] Example 2 Molecular identification of fungus TW58-5
[0062] Extraction of genomic DNA: The DNA of the fungus TW58-5 was extracted by using Ezup Column Fungal Genomic DNA Extraction Kit of Sheng Wu. The specific method was as follows: 20 mg mycelium was ground into powder with liquid nitrogen and added into a 1.5 mL centrifuge tube. 200 μL Buffer Digestion and 2 μL β-mercaptoethanol were added, followed by 20 μL Proteinase K solution, and then shaken and mixed. The sample was placed in a 56 °C water bath for 1 h until the cells were completely lysed. 100 μL Buffer PF was added, mixed well by inversion, and then placed in a -20 °C refrigerator for 5 min. The sample was centrifuged at 10,000 rpm at room temperature for 5 min, and the supernatant was transferred to a new 1.5 mL centrifuge tube. 200 μL Buffer BD was added, mixed well by inversion. 200 μL of anhydrous ethanol was added, mixed well by inversion. The adsorption column was placed in the collection tube, and the solution and translucent fibrous suspension were added into the adsorption column with a pipette, and then the sample was left to stand for 2 min, followed by centrifugation at 10,000 rpm at room temperature for 1 min, and the waste liquid in the collection tube was discarded. The adsorption column was placed back into the collection tube, 500 μL of PW Solution was added, and then the sample was centrifuged at 10,000 rpm for 30 s, and the waste liquid in the collection tube was discarded. The adsorption column was placed back into the collection tube, 500 μL of Wash Solution was added, and then the sample was centrifuged at 10,000 rpm for 30 s, and the waste liquid in the collection tube was discarded. The adsorption column was placed back into the collection tube, and then centrifuged at 12,000 rpm at room temperature for 2 min to remove the residual Wash Solution. The adsorption column was taken out and placed into a new 1.5 mL centrifuge tube, 50 μL of TE Buffer was added, and then the sample was left to stand for 3 min, followed by centrifugation at 12,000 rpm at room temperature for 2 min, and the DNA solution was collected.
[0063] Amplification of gene sequence: 2 times of PCR mastermix 12.5 μL, primers ITS1 (5'-TCC GTAGGT GAA CCT GCG G-3') and ITS4 (5'-TCC TCC GCT TAT TGA TAT GC-3') 1 μL each, template DNA 1 μL, and double-distilled water 9.5 μL were added respectively. The amplification conditions were as follows: pre-denaturation at 95 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, extension at 72 °C for 90 s, for a total of 30 cycles; and post-extension at 72 °C for 10 min. The PCR product was detected by 2% agarose gel electrophoresis.
[0064] The target band (about 600 bp) was cut off and purified by using a SanPre column type DNA gel recovery kit. Specifically, 3-6 times the weight of the gel block of Buffer B2 was added, and the mixture was incubated at 50°C for 5-10 min. The gel solution was transferred to the adsorption column. Centrifugation was performed at 8000 x g for 30 s, and the liquid in the collection tube was discarded. 500 μL of Wash Solution was added, and centrifugation was performed at 9000 x g for 30 s, and the liquid in the collection tube was discarded. The adsorption column was centrifuged at 9000 x g for 1 min. The adsorption column was placed in a clean 1.5 mL centrifuge tube, 15-40 μL of Elution Buffer was added to the center of the adsorption membrane, and the mixture was incubated at room temperature for 1 min. Then, the mixture was centrifuged for 1 min to obtain the DNA solution, which was sent for bio-sequencing.
[0065] The ITS sequence was submitted to NCBI for alignment, and sequences with higher similarity were selected, and then MEGA 6.0 was used to construct a phylogenetic tree. According to the phylogenetic tree, it is inferred that the strain belongs to Aspergillus sp. Figure 3
[0066] The fungus TW58-5 is named Aspergillus sp. TW58-5, and the preservation information is as follows: the preservation unit is Guangdong Microbial Culture Collection Center (GDMCC), the preservation time is December 3, 2021, the preservation address is 5th Floor, Building 59, Guangdong Microbial Research Institute, 100 Middle Martyrs Road, Guangzhou, Guangdong Province, and the preservation number is GDMCC No: 62093.
[0067] The ITS sequence of the Aspergillus sp. TW58-5 is shown in SEQ ID No. 1 (578 bp).
[0068] Example 3: Large-scale fermentation culture of fungus TW58-5
[0069] The fungus TW58-5 was activated in PDA solid medium (potato 200 g, glucose 20 g, agar 20 g, ddH2O 1 L, PH natural), and large-scale fermentation was carried out in rice solid medium (rice 50 g, ddH2O 75 mL, PH natural) at 5.0 Kg. After standing at room temperature for 21 days, the mycelium was soaked with EtOAc overnight for extraction.
[0070] Example 4: Preparation of cyclopentapeptide compounds
[0071] The fermentation broth of marine fungus TW58-5 fermented by solid rice medium was extracted with ethyl acetate (EtOAc) for 3-5 times. The extract was concentrated under reduced pressure to obtain 70 g of extract. The extract was subjected to open column chromatography on silica gel (φ50x640 mm, 200-300 mesh, 500-700 g) and eluted with petroleum ether-ethyl acetate (100:0, 98:2, 95:5, 90:10, 80:20, 70:30, 40:60, 0:100) and ethyl acetate-methanol (95:5, 90:10) in gradient to obtain 20 fractions (Fr.1-Fr.20). Fr.12 [4.12 g, petroleum ether / ethyl acetate (70:30)] was subjected to open column chromatography on ODS and eluted with methanol-water (30%-100%) in gradient to obtain 12 sub-fractions (Fr.12-1-Fr.12-12). Sub-fraction Fr.12-9 [453.9 mg, 80% MeOH-H2O] was subjected to preparative HPLC (YMC-Pack ODS-A, 63% acetonitrile-water, 3 ml / min) to obtain compound 1 (14.4 mg) and compound 2 (3.0 mg). Fr.14 [4.28 g, petroleum ether / ethyl acetate (40:60)] was subjected to open column chromatography on ODS and eluted with methanol-water (30%-100%) in gradient to obtain 8 sub-fractions (Fr.14-1-Fr.14-8). Sub-fraction Fr.14-5 (0.34 g, 60% methanol-water) was subjected to open column chromatography on silica gel and eluted with petroleum ether / ethyl acetate (80:20, 70:30, 50:50, 0:100) and ethyl acetate / methanol (0:100) in gradient to obtain 6 sub-fractions (Fr.14-5-1-Fr.14-5-6). Sub-fraction Fr.14-5-4 [168.6 mg, petroleum ether / ethyl acetate (50:50)] was subjected to preparative HPLC (YMC-Pack ODS-A, 68% methanol-water, 3 ml / min) to obtain compound 3 (10.0 mg) and compound 4 (5.0 mg).
[0072] Example 5 Structural identification of cyclopentapeptide compounds
[0073] Compounds 1-4 obtained in Example 4 were all white solids. The prepared compounds were identified for purity by TLC and HPLC, and samples with purity greater than 98% were used. Mass spectrometry, nuclear magnetic resonance and Marfey method were used for structural identification. Nuclear magnetic resonance was determined by Bruker AV-600 NMR Spectrometer with TMS as internal standard; high resolution mass spectrometry was determined by Waters Synapt G2 mass spectrometer.
[0074] HR-ESI-Q-TOF-MS charts of compounds 1-4 are shown in order as follows: Figure 4 ,Figure 8 , Figure 12 , Figure 16 As shown.
[0075] Compound 1 1 H-NMR (600MHz, in CH3OH-d4) spectrum ( Figure 5 In the low-field region, seven aromatic hydrogen signals are observed, including one group of hydrogen signals on the 1,4-disubstituted benzene ring [δ]. H 7.17 (2H,d,J=8.6Hz) and δ H 6.86 (2H,d,J=8.7Hz)] and three adjacent aromatic hydrogen signals [δ H 7.09 (1H,d,J=7.9Hz), δ H 7.22 (1H,t,J=7.9Hz), δ H [7.09 (1H,d,J=7.9Hz)], indicating the presence of one 1,2,3-trisubstituted benzene ring. The high-field region shows the α-hydrogen signals [δ] of five peptide compounds. H 4.88 (1H, d, J = 4.4Hz), δ H 4.13 (1H,t,J=7.5Hz), δ H 4.29 (1H, d, J = 17.4 Hz), δ H 3.76 (1H, d, J = 16.5Hz), δ H 4.49 (1H,dd,J=11.3,3.6Hz)], 1 methoxy hydrogen signal [δ H 3.77 (3H, s)] and 5 methyl hydrogen signals [δ H 1.27 (3H, s), δ H 0.97 (3H,d,J=6.6Hz), δ H 0.96 (3H,d,J=6.6Hz), δ H 0.92 (3H,d,J=6.6Hz), δ H 0.88 (3H,d,J=6.5Hz)]. 13 C-NMR (150MHz, in CH3OH-d4) spectrum Figure 6 The CCP spectrum shows 33 carbon signals, combined with the DEPT 135 spectrum ( Figure 7 The results indicate a total of 10 quaternary carbon signals, 4 methylene carbon signals, 13 methine carbon signals, 1 methoxy carbon signal, and 5 methyl carbon signals, among which δ C 176.3, 174.2, 173.0, 172.2, and 171.7 represent the signals of five amide carbonyl carbons, δ C59.8, 57.8, 52.5, 44.1 are the signals of α-carbon of 4 amino acids, further suggesting that the compound is likely to be a cyclic pentapeptide. Then the structure of the 5 amino acid fragments was determined by COSY combined with HMBC experiments as follows. 1 H- 1 H COSY combined with HMBC experiments determined the structure of the 5 amino acid fragments as O, β-dimethyl-Tyr, 5-Me-Nle, Gly, Leu and 2-amino-3-hydroxy-benzoic acid (Ben) fragments, as shown below.
[0076]
[0077] Further through HMBC correlation, Ben, 5-Me-Nle, Gly, Leu and O, β-dimethyl-Tyr were sequentially connected to obtain the following planar structure.
[0078]
[0079] Finally, the absolute configuration of Leu and 5-Me-Nle fragments in compound 1 was determined by Marfey method, which were D-Leu and 5-Me-L-Nle, respectively. Figure 2 ). Thus, the structure of the compound 1 is as shown in formula 1. Figure 1
[0080] The 1 H-NMR chart of compounds 2-4 is shown in Figure 9 , Figure 13 , Figure 17 , respectively; the C-NMR chart of compounds 2-4 is shown in 13 , Figure 10 , Figure 14 , Figure 18 , respectively; the DEPT 135-NMR chart of compounds 2-4 is shown in Figure 11 , Figure 15 , Figure 19 , respectively.
[0081] The 1 H and 13 The comparison of C NMR data found that compounds 2-4 have similar structure with compound 1, which are all cyclic pentapeptides, the difference is the type of amino acid. Compound 2 has O, β-dimethyl-Tyr, 5-Me-Nle, Gly, Ben and Ile (isoleucine) five amino acid fragments; compound 3 has O, β-dimethyl-Tyr, 5-Me-Nle, Gly, Ben and Val (valine) five amino acid fragments; compound 4 has O, β-dimethyl-Tyr, Ile, Gly, Ben and Phe (phenylalanine) five amino acid fragments. Then the individual amino acids were connected by HMBC correlation and the absolute configuration of the amino acids was determined by Marfey method, and finally the structure of compounds 2-4 was obtained as Figure 1 Formula 2-Formula 4.
[0082] Among them, the cyclic pentapeptide compounds 1-4 are 13 C NMR data and 1 The H NMR data is shown in Table 1, 2.
[0083] Table 1 Cyclic pentapeptide compounds 1-4 13 C NMR data
[0084]
[0085]
[0086] Among them, a in CH3OH-d4, b in CDCl3.
[0087] Table 2 Cyclic pentapeptide compounds 1-4 1 H NMR data
[0088]
[0089]
[0090] Among them, a in CH3OH-d4, b in CDCl3.
[0091] Example 6 Analysis of the α-glucosidase inhibitory activity of cyclic pentapeptide compounds
[0092] 6.1 Main reagents, consumables and instruments: a-glucosidase (Sigma), p-nitrophenyl-a-D-glucopyranoside (p-PNG, Shanghai Macklin Biochemical Technology Co., Ltd.), NaH2PO4 (Shengao Bioengineering Co., Ltd.), Na2HPO4 (Shengao Bioengineering Co., Ltd.), Na2CO3 (Shengao Bioengineering Co., Ltd.), acarbose (Bayer), polyethylene 96-well plate (Ekoase Biological), incubator (Thermo), enzyme label instrument (BioTek), etc.
[0093] 6.2 Preparation of reagents: PBS buffer: 0.2622 g NaH2PO4 and 2.1747 g Na2HPO4 were added to 100 mL water; 5 mM p-PNG substrate: 75.3 mg p-PNG was added to 10 mL PBS; 0.1 M Na2CO3: 0.53 g Na2CO3 was added to 50 mL water; 0.2 U / mL enzyme: 100 U a-glucosidase was added to 1 mL PBS, stored at -70°C, and diluted 500 times before use; positive drug and test compound solution: dissolved in DMSO to prepare a stock solution with a concentration of 20 mM, and diluted to the required concentration with PBS before administration.
[0094] 6.3 Experimental process: 25 μL of test compound solution was added to 50 μL of 0.2 U / mL a-glucosidase, incubated at 37°C for 10 min, then mixed with 25 μL of 5 mM p-NPG, reacted for another 5 min, and then added with 100 μL of Na2CO3 to terminate the reaction. The OD value was measured on the enzyme label instrument within 5 min and the inhibition rate was calculated. Acarbose was used as a positive control in the experiment. 405nm
[0095] 6.4 Results analysis: First, at a concentration of 400 μM, the inhibition rates of compounds 1-4 (corresponding to compounds 1-4, respectively) on a-glucosidase were determined, with each drug repeated 3 times. If the inhibition rate is stronger than that of the positive drug acarbose, it is considered to have activity. The results showed that compounds 1-4 all had stronger inhibition activity on a-glucosidase than acarbose, and the inhibition rates were all greater than 50% at this concentration (Table 3). Further, different concentrations were set to investigate the dose-dependent relationship of the a-glucosidase inhibition activity of compounds 1-4, and the results showed that they all could dose-dependently inhibit the activity of a-glucosidase (A), among which compounds 1 and 4 showed stronger inhibition activity (B and C), with IC values of 94.4 and 44.1 μM, respectively. Figure 20 Figure 20 Figure 20 50
[0096] Table 3 a-glucosidase inhibition activity of compounds 1-4 at a concentration of 400 μM
[0097] Compound Inhibition rate (%, Mean ± SEM) 1 100.5±1.3 2 74.2±0.6 3 74.4±4.5 4 93.7±2.8 Acarbose 28.8±0.1
[0098] Example 7 Preparation of drop pill preparation containing cyclopentapeptide compound
[0099] Take 0.5 g of cyclopentapeptide compound and 10.5 g of polyethylene glycol-6000, mix evenly, heat and melt, and then move to the drop pill drip irrigation. The liquid is dropped into 6-8℃ liquid paraffin, and the oil is removed to prepare 300 drop pills.
[0100] Example 8 Preparation of freeze-dried powder injection containing cyclopentapeptide compound
[0101] Take cyclopentapeptide compound 0.5 g, glucose 4.5 g, sodium thiosulfate 0.9 g and distilled water 1000 mL, mix the above components evenly, freeze-dry and pack 400, and get it.
[0102] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples. Any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement methods, and shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Jinan University Zhejiang University <120> Cyclopentapeptide compound and its application in α-glucosidase inhibitor hypoglycemic drugs or preventive health products <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 578 <212> DNA <213> Artificial Sequence <220> <223> ITS sequence of Aspergillus sp. TW58-5 <400> 1 gacctgcgga aggatcatta ccgagtgagg gccctctggg tccaacctcc cacccgtgtc 60 tattgtacct tgttgcttcg gcgggcccgc cgtttcgacg gccgccgggg aggcctcgcg 120 GAGGTGCAGCTGGTTGCAAGTGGTTGCTGTTGTTGCTGCTGCTGCTGCTGCTGCTG 60 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 120 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 180 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 240 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 300 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 360 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 420 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 480 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 540 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ITS1 <400> 2 TGGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITS4 <400> 3 TCTCCGCTTA TTGATATGC 20
Claims
1. Marine fungi in preparation α - Application in glucosidase inhibitors, characterized by: The marine fungus is named Aspergillus fungus TW58-5 ( Aspergillus sp. TW58-5 was deposited on December 3, 2021, at the Guangdong Provincial Microbial Culture Collection Center, Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, accession number: GDMCC No: 62093; The α - glucosidase inhibitors are cyclopentapeptides having the structural formulae 1 to 4: 。 2. A class of cyclopentapeptides of marine fungal origin as claimed in claim 1, characterized by: The structural formula is shown as formula 1-4: 。 3. The method for preparing the cyclic pentapeptide compound according to claim 2, characterized in that: The pentapeptide compound is isolated from the fermentation of the marine fungus in claim 1; Comprising the following steps: (1) the aspergillus TW58-5 described in claim 1 is inoculated in the fermentation medium after activation, and fermentation culture is carried out; (2) after the fermentation culture is finished, organic solvent is added for extraction, the extraction liquid is separated and obtained, the extraction liquid is concentrated to obtain the extract, and the cyclic pentapeptide compound is prepared after the extract is separated and purified; The formula of the fermentation medium in step (1) is: 50g of rice, ddH2O 75mL, and the natural PH; The fermentation culture condition in step (1) is static culture at 20-30 ℃ for 10-40 days; The organic solvent in step (2) is ethyl acetate.
4. The preparation method according to claim 3, characterized in that: The fermentation culture condition in step (1) is static culture at 26-30 ℃ for 10-40 days.
5. The preparation method according to claim 4, characterized in that: The fermentation culture condition in step (1) is static culture at 28 ℃ for 20 days.
Citation Information
Patent Citations
Anti-tumor cyclic pentapeptide compound and preparation method thereof
CN101659694A
Cyclic pentapeptide Galaxamide, preparation method thereof and application of cyclic pentapeptide Galaxamide in preparation of antitumor drugs
CN113185582A
A method for preparing indole-dione-piperazine alkaloids
CN114934084A
Cyclochrome-propyl-valine-isoleucine-leucine with hepatoma carcinoma cytotoxicity and alpha-glucosidase inhibitory activity and preparation method of cyclo-propyl-valine-isoleucine-leucine
CN115651067A
Application of meroterpenoid compound in preparation of anti-inflammatory drugs or prevention and health care products
CN116350665A