A strain of Pseudomonas proteus PHBA133 and its application

Abstract

This invention relates to a strain of *Pseudomonas proteus* PHBA133 and its applications, belonging to the field of bioengineering. The strain, classified as *Pseudomonas proteus* coglossicida PHBA133, was deposited at the China General Microbiological Culture Collection Center on December 26, 2022, with accession number CGMCC No. 26275. The *Pseudomonas proteus* PHBA133 provided by this invention exhibits strong genetic stability and a broad substrate spectrum. It can ferment and convert p-hydroxycinnamic acid and its derivatives into corresponding aldehydes, with a conversion concentration of p-hydroxybenzaldehyde as high as 3.4 g / L, demonstrating potential for industrial application. The production process is simple, mild, green, and safe, avoiding the problems of long reaction times, high energy consumption, and environmental pollution faced by traditional chemical methods. Furthermore, it produces fewer byproducts, facilitating extraction and separation operations.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a strain of Pseudomonas proteans PHBA133 and its applications. Background Technology

[0002] p-Hydroxybenzaldehyde is an important fine chemical product and a key intermediate in many pharmaceuticals, fragrances, and pesticides. In fragrance chemistry, p-hydroxybenzaldehyde can be used to synthesize fragrances such as anisaldehyde, vanillin, hesperidin, eugenol, and raspberry ketone. In recent years, the market demand for these pharmaceuticals, fragrances, and pesticides has been increasing, and the synthesis of p-hydroxybenzaldehyde has attracted considerable attention.

[0003] Traditional p-hydroxybenzaldehyde production processes mostly employ chemical synthesis methods, using p-nitrotoluene, p-chlorophenol, p-cresol, and phenol as starting materials. These methods suffer from high costs, severe environmental pollution, poor selectivity, and low yields. Microbial synthesis of p-hydroxybenzaldehyde holds great promise for development and application, aligning with the principles of green chemistry. Some researchers have used p-cresol as a raw material, obtaining p-HBA under the action of specific microbial strains. This method is environmentally friendly, yields high amounts, has simple operation, and mild reaction conditions, but the production cycle is relatively long. In 2006, Sachan et al. used *Paecilomyces* fungi to degrade coumaric acid to synthesize p-hydroxybenzaldehyde, p-hydroxybenzoic acid, and protocatechuic acid. Their results showed that p-hydroxybenzaldehyde accumulation was dominant during the *Paecilomyces*-induced coumaric acid degradation process. Jiangnan University patent 202010640818.5 describes the construction of engineered *Escherichia coli* strains that converted 1 g / L anisaldehyde to 250 mg / L p-hydroxybenzaldehyde within 12 hours. Patent 201710046221.6 describes a fermentation method using Bacillus megatherium OMK-11 to convert tyrosine into 3 g / L of p-hydroxybenzaldehyde. However, the product concentration in this study is too low, and it is still some distance from industrial application. Screening for highly active and stable strains is key to solving these problems. Summary of the Invention

[0004] The purpose of this invention is to provide a strain of bacteria that produces p-hydroxybenzaldehyde, isolated from soil, and a method for producing p-hydroxybenzaldehyde and its derivatives by fermentation using this strain.

[0005] The objective of this invention is achieved through the following means.

[0006] A strain of *Pseudomonas proteoglycans* PHBA133, classified as *Pseudomonas proteoglycans* PHBA133, was deposited on December 26, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 26275. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The present invention also provides the application of the strain in the fermentation production of p-hydroxybenzaldehyde.

[0008] Furthermore, the fermentation substrate is p-hydroxycinnamic acid and its derivatives.

[0009] Furthermore, the application method is as follows: *Pseudomonas proteus* PHBA133 is inoculated into a liquid fermentation medium. The components and final concentrations of the fermentation medium are: glucose 1-4 g / L, p-hydroxycinnamic acid 1-2 g / L, KH₂PO₄ 3 g / L, ammonium sulfate 2 g / L, magnesium sulfate 0.2 g / L, vitamin B1 1 mg / L, biotin 0.1 mg / L, FeSO₄ 2 mg / L, ZnSO₄ 0.1 mg / L, CuSO₄ 0.1 mg / L, yeast extract 1 g / L, peptone 1 g / L, pH 7.0. The medium is cultured with shaking at 25-40°C and 150-220 rpm. A product promoter or organic solvent is added to the fermentation broth after 18-30 hours of fermentation. The entire culture cycle is 36-96 hours.

[0010] Furthermore, the product promoter is one or a combination of several of Tween-80, Triton-x100, EDTA and phytic acid, and the addition amount is 1-3 g / L.

[0011] Furthermore, the organic solvent is butyl acetate, n-butanol, isoamyl alcohol, or toluene, and the volume ratio of the organic solvent to the fermentation broth is 20% (V / V).

[0012] The beneficial effects of this invention compared to the prior art are as follows:

[0013] The *Pseudomonas mutagenesis* PHBA133 provided by this invention exhibits strong genetic stability and a broad substrate spectrum. It can ferment and convert p-hydroxycinnamic acid and its derivatives into corresponding aldehydes, with a conversion concentration of p-hydroxybenzaldehyde as high as 3.4 g / L, demonstrating potential for industrial application. The production process is simple, mild, green, and safe, avoiding the problems of long reaction times, high energy consumption, and environmental pollution faced by traditional chemical methods. Furthermore, it produces fewer byproducts, which is beneficial for extraction and separation operations. Attached Figure Description

[0014] Figure 1 Phylogenetic evolutionary tree based on 16S rDNA sequence. Detailed Implementation

[0015] To clarify the understanding of the features of this invention, the invention will be further described below with reference to some non-limiting embodiments.

[0016] Example 1: Identification and verification of strain characteristics of Pseudomonasplecoglossicida PHBA133

[0017] 1) Isolation and identification of bacterial strains

[0018] The samples were collected from seabed sediment near the coast of Yantai, Shandong. Weigh 1g of sample and add it to a shake flask containing 100mL of sterile water. Shake well, serially dilute, and spread on screening plates (screening medium: glucose 4g / L, p-hydroxycinnamic acid 2g / L, KH2PO4 3g / L, ammonium sulfate 2g / L, magnesium sulfate 0.2g / L, VB1 1mg / L, biotin 0.1mg / L, FeSO4 2mg / L, ZnSO4 0.1mg / L, CuSO4 0.1mg / L, yeast extract 1g / L, peptone 1g / L, agar 20g / L, pH 7.0). Incubate at 30℃ for 48h. Spray with 2,4-dinitrophenylhydrazine solution, select colonies with a large ratio of orange discoloration zone to colony diameter, and streak to isolate and purify them. Inoculate the single colonies that grow after streaking into shake flask fermentation medium and determine the p-hydroxybenzaldehyde content. A strain that synthesizes p-hydroxybenzaldehyde efficiently was screened.

[0019] Example 2: Identification of Pseudomonas plecoglossicida PHBA133

[0020] Strain PHBA133 formed milky-white colonies on LB medium with smooth surfaces, irregular edges, and Gram-negative staining. Microscopic examination revealed rod-shaped, dispersed cells that were Gram-positive and non-spore-forming. Physiological and biochemical indicators are shown in Table 1. The 16S rRNA gene sequence obtained through DNA extraction, PCR amplification, and sequencing was 1443 bp in length. BLAST alignment was performed in GenBank, and a phylogenetic tree was constructed. Similarity analysis using BLAST from the NCBI database showed that the 16S rRNA sequence of this strain shared over 99% similarity with the sequence of *Pseudomonas plecoglossicida* in GenBank, confirming that this strain belongs to *Pseudomonas plecoglossicida* and was named *Pseudomonas plecoglossicida* PHBA133. It was deposited at the China General Microbiological Culture Collection Center on December 26, 2022, with accession number CGMCC NO.26275. Address of the depository: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0021] Table 1. Physiological and biochemical characteristics of strain PHBA133

[0022]

[0023] Its 16S rRNA sequence information is as follows:

[0024] Ggatacgggcggcgggctacacatgcaagtcgagcggatgacgggagcttgctccttgattcagcggcggacgggtg

[0025] agtaatgcctaggaatctgcctggtagtgggggacaacgtttcgaaaggaacgctaataccgcatacgtcctacgggaga

[0026] aagcaggggaccttcgggccttgcgctatcagatgagcctaggtcggattagctagttggtggggtaatggctcaccaag

[0027] gcgacgatccgtaactggtctgagaggatgatcagtcacactggaactgagacacggtccagactcctacgggaggcag

[0028] cagtggggaatattggacaatgggcgaaagcctgatccagccatgccgcgtgtgtgaagaaggtcttcggattgtaaagc

[0029] actttaagttgggaggaagggcagtaagctaataccttgctgttttgacgttaccgacagaataagcaccggctaactctgt

[0030] gccagcagccgcggtaatacagagggtgcaagcgttaatcggaattactgggcgtaaagcgcgcgtaggtggttcgtta

[0031] agttggatgtgaaagccccgggctcaacctgggaactgcatccaaaactggcgagctagagtacggtagagggtggtgg

[0032] aatttcctgtgtagcggtgaaatgcgtagatataggaaggaacaccagtggcgaaggcgaccacctggaactgatactga

[0033] cactgaggtgcgaaagcgtggggagcaaacaggattagataccctggtagtccacgccgtaaacgatgtcaactagccg

[0034] ttggaatccttgagattttagtggcgcagctaacgcattaagttgaccgcctggggagtacggccgcaaggttaaaactcaa

[0035] atgaattgacgggggcccgcacaagcggtggagcatgtggtttaattcgaagcaacgcgaagaaccttaccaggccttg

[0036] acatgcagagaactttccagagatggattggtgccttcgggaactctgacacaggtgctgcatggctgtcgtcagctcgtgt

[0037] cgtgagatgttgggttaagtcccgtaacgagcgcaacccttgtccttagttaccagcacgttatggtgggcactctaaggag

[0038] actgccggtgacaaaccggaggaaggtggggatgacgtcaagtcatcatggcccttacggcctgggctacacacgtgct

[0039] acaatggtcggtacagagggttgccaagccgcgaggtggagctaatctcacaaaaccgatcgtagtccggatcgcagtct

[0040] gcaactcgactgcgtgaagtcggaatcgctagtaatcgcgaatcagaatgtcgcggtgaatacgttcccgggccttgtaca

[0041] caccgcccgtcacaccatgggagtgggttgcaccagaagtagctagtctaaccttcgggaggacggtaccacggtgatacggg。

[0042] 2) Genetic stability

[0043] The *Pseudomonas proteus* PHBA133 was passaged 50 times on solid culture medium using the streak method. The cell morphology, growth rate, and fermentation rate and conversion rate of p-hydroxycinnamic acid were measured. There were no significant differences from the primary strain, indicating good genetic stability.

[0044] Example 3: Substrate specificity of Pseudomonas proteus PHBA133

[0045] Cinnamic acid, p-hydroxycinnamic acid, and ferulic acid were added to the fermentation medium at 2 g / L, respectively. After culturing for 48 h, the residual concentrations of different substrates were measured, and the degradation rates were calculated. As shown in Table 1, *Pseudomonas proteus* PHBA133 has a broad substrate activity spectrum, acting on all tested substrates, especially p-hydroxycinnamic acid, with a degradation rate as high as 98.4%.

[0046] Table 2 Substrate Specificity

[0047]

[0048] Example 3: Production of p-hydroxybenzaldehyde using Pseudomonas proteus PHBA133

[0049] The strain *Pseudomonas proteus* PHBA133 was inoculated onto a solid slant culture medium (5 g / L yeast extract, 10 g / L peptone, 5 g / L beef extract, 5 g / L NaCl, 20 g / L agar, pH 7.0) and cultured for 24 h. One loopful of the slant culture was then picked up with an inoculation needle and transferred to a liquid fermentation medium (4 g / L glucose, 2 g / L p-hydroxycinnamic acid, 3 g / L KH₂PO₄, 2 g / L ammonium sulfate, 0.2 g / L magnesium sulfate, 1 mg / L vitamin B1, 0.1 mg / L biotin, 2 mg / L FeSO₄, 0.1 mg / L ZnSO₄, 0.1 mg / L CuSO₄, 1 g / L yeast extract, 1 g / L peptone, pH 7.0) and cultured at 30 °C with shaking at 220 rpm for 36 h. The p-hydroxybenzaldehyde content was determined to be 1.2 g / L.

[0050] Example 4: Production of p-hydroxybenzaldehyde using Pseudomonas proteus PHBA133

[0051] The strain *Pseudomonas proteus* PHBA133 was inoculated onto a solid slant culture medium (5 g / L yeast extract, 10 g / L peptone, 5 g / L beef extract, 5 g / L NaCl, 20 g / L agar, pH 7.0) and cultured for 24 h. One loopful of the slant culture was then picked up with an inoculation needle and transferred to a liquid fermentation medium (4 g / L glucose, 2 g / L p-hydroxycinnamic acid, 3 g / L KH₂PO₄). The following ingredients were added: ammonium sulfate 2 g / L, magnesium sulfate 0.2 g / L, vitamin B1 1 mg / L, biotin 0.1 mg / L, FeSO4 2 mg / L, ZnSO4 0.1 mg / L, CuSO4 0.1 mg / L, yeast extract 1 g / L, peptone 1 g / L, pH 7.0. The mixture was cultured at 30℃ and 220 rpm with shaking. 1 g / L of Tween-80 was added to the fermentation broth at 20 h. Fermentation was stopped after 36 h, and the p-hydroxybenzaldehyde content was determined to be 1.4 g / L.

[0052] Example 5: Production of p-hydroxybenzaldehyde using Pseudomonas proteus PHBA133

[0053] The strain *Pseudomonas proteus* PHBA133 was inoculated onto a solid slant culture medium (5 g / L yeast extract, 10 g / L peptone, 5 g / L beef extract, 5 g / L NaCl, 20 g / L agar, pH 7.0) and cultured for 24 h. One loopful of the slant culture was then picked up with an inoculation needle and transferred to a liquid fermentation medium (4 g / L glucose, 5 g / L p-hydroxycinnamic acid, 3 g / L KH₂PO₄). The fermentation broth was prepared with the following ingredients: ammonium sulfate 2 g / L, magnesium sulfate 0.2 g / L, vitamin B1 1 mg / L, biotin 0.1 mg / L, FeSO4 2 mg / L, ZnSO4 0.1 mg / L, CuSO4 0.1 mg / L, yeast extract 1 g / L, peptone 1 g / L, pH 7.0. The broth was cultured at 30℃ and 220 rpm with shaking. At 20 h, 20% (V / V) isoamyl alcohol was added to the fermentation broth. Fermentation was completed after 36 h, and the p-hydroxybenzaldehyde content was determined to be 3.4 g / L.

[0054] Example 6: Production of benzaldehyde using Pseudomonas proteus PHBA133

[0055] The strain *Pseudomonas proteus* PHBA133 was inoculated onto a solid slant culture medium (5 g / L yeast extract, 10 g / L peptone, 5 g / L beef extract, 5 g / L NaCl, 20 g / L agar, pH 7.0) and cultured for 24 h. One loopful of the slant culture was then picked up with an inoculation needle and transferred to a liquid fermentation medium (4 g / L glucose, 2 g / L cinnamic acid, 3 g / L KH₂PO₄, 2 g / L ammonium sulfate, 0.2 g / L magnesium sulfate, 1 mg / L vitamin B1, 0.1 mg / L biotin, 2 mg / L FeSO₄, 0.1 mg / L ZnSO₄, 0.1 mg / L CuSO₄, 1 g / L yeast extract, 1 g / L peptone, pH 7.0) and cultured at 30 °C with shaking at 220 rpm. At 20 h, 1 g / L phytic acid was added to the fermentation broth. Fermentation was completed after 36 h, and the benzaldehyde content was determined to be 1.4 g / L.

[0056] Example 6: Production of vanillin using Pseudomonas proteans PHBA133

[0057] The strain *Pseudomonas proteus* PHBA133 was inoculated onto a solid slant culture medium (5 g / L yeast extract, 10 g / L peptone, 5 g / L beef extract, 5 g / L NaCl, 20 g / L agar, pH 7.0) and cultured for 24 h. One loopful of the slant culture was then picked up with an inoculation needle and transferred to a liquid fermentation medium (4 g / L glucose, 2 g / L ferulic acid, 3 g / L KH₂PO₄, 2 g / L ammonium sulfate, 0.2 g / L magnesium sulfate, 1 mg / L vitamin B1, 0.1 mg / L biotin, 2 mg / L FeSO₄, 0.1 mg / L ZnSO₄, 0.1 mg / L CuSO₄, 1 g / L yeast extract, 1 g / L peptone, pH 7.0) and cultured at 30 °C with shaking at 220 rpm. At 20 h, 1 g / L Triton X-100 was added to the fermentation broth, and fermentation was completed after 36 h. The vanillin content was determined to be 1.5 g / L.

Claims

1. A strain of Pseudomonas mutabilis PHBA133, characterized in that, The strain is named Pseudomonas plecoglossicida and preserved in China General Microbiological Culture Collection Center on December 26, 2022, with the preservation number of CGMCC No. 26275.

2. Use of the Pseudomonas PHBA133 in the production of p-hydroxybenzaldehyde by fermentation.

3. Use according to claim 2, characterized in that, The fermentation substrate is p-hydroxycinnamic acid.

4. Use according to claim 3, characterized in that, The Pseudomonas PHBA133 is inoculated into a liquid fermentation medium, and the components and final concentrations in the fermentation medium are as follows: glucose 1-4 g / L, p-hydroxycinnamic acid 1-2 g / L, KH2PO4 3 g / L, ammonium sulfate 2 g / L, magnesium sulfate 0.2 g / L, VB1 1 mg / L, biotin 0.1 mg / L, FeSO4 2 mg / L, ZnSO4 0.1 mg / L, CuSO4 0.1 mg / L, yeast extract powder 1 g / L, proteose peptone 1 g / L, pH 7.0, and the culture is carried out at 25-40°C and 150-220 r / min under shaking conditions. After 18-30 h of fermentation, a product promoter or an organic solvent is added to the fermentation broth, and the entire culture period is 36-96 hours.

5. Use according to claim 4, characterized in that, The product promoter is one or a combination of Tween-80, Triton-x100 and phytic acid, and the addition amount is 1-3 g / L.

6. Use according to claim 4, characterized in that, The organic solvent is butyl acetate, n-butanol, isoamyl alcohol or toluene, and the volume ratio of the organic solvent to the fermentation broth is 20%.

Images