Nadh pyrophosphatase mutant with improved catalytic performance and application thereof

Abstract

The application discloses a NADH pyrophosphatase mutant with improved catalytic performance and application thereof. The application provides an optimized NADH pyrophosphatase, which has improved catalytic performance compared with that before optimization. On this basis, the application further provides a NADH pyrophosphatase mutant with improved catalytic performance through site-directed mutagenesis. In addition, the application further provides a method for further improving the catalytic performance of the provided optimized NADH pyrophosphatase and the mutant thereof, and when a recombinant plasmid is constructed, specific promoter sequences and ribosome binding sites are inserted into the plasmid, so that the catalytic performance of the obtained NADH pyrophosphatase induced and expressed is higher than that of the parent. The provided optimized NADH pyrophosphatase and the mutant thereof not only have high catalytic performance, but also have good thermal stability, and can be used for biosynthesis of reduced nicotinamide mononucleotide, and are suitable for industrial production and application.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of enzyme engineering. More particularly, it relates to a NADH pyrophosphatase mutant with improved catalytic performance and application thereof. BACKGROUND

[0002] Nicotinamide adenine dinucleotide (NAD + ) is an important chemical substance in organisms, which is essential for organisms and plays an important role in energy metabolism. Studies have shown that increasing the content of NAD + in organisms can improve many diseases related to aging. For example, increasing the content of NAD + can prolong the life of yeast, worms and fruit flies, and delay neurodegenerative diseases such as Alzheimer's disease. However, NAD + cannot be absorbed by the human body directly, so at present, various precursors or related substances of NAD + are used for supplementation. As a precursor of NAD + , reduced nicotinamide mononucleotide (NMNH) can increase the content of NAD + higher and faster than nicotinamide riboside (NR) and nicotinamide mononucleotide (NMN), and supplementation of NMNH can also reduce the damage of renal tubular epithelial cells under hypoxia and reoxygenation, inhibit glycolysis, TCA cycle, etc.

[0003] NADH pyrophosphatase (Nudc) belongs to the Nudix hydrolase family, which can catalyze the hydrolysis of reduced nicotinamide adenine dinucleotide (NADH) into NMNH and AMP (adenosine monophosphate). The biosynthesis of NMNH can be realized by using NADH pyrophosphatase gene (Nudc) to construct recombinant bacteria. At present, there have been reports on the expression of NADH pyrophosphatase genes (Nudc) of different sources in Escherichia coli, but the enzyme activity of the expressed NADH pyrophosphatase is not high enough to meet the production needs of NMNH. For example, Wang et al. successfully expressed the soluble NADH pyrophosphatase in Escherichia coli BL21 (DE3) by using pET-32a (+) vector containing Trx tag. In the presence of magnesium ions, the specific enzyme activity of NADH pyrophosphatase derived from M. bovis BCG (NudC BCG ) and M. tuberculosis H37Rv (NudC Rv ) was 1.59 U / mg and 0.02 U / mg (X.D. Wang, et al. Mol Microbiol, 2011, 82: 1375-1391), respectively, which was not enough to meet the production needs of NMNH.

[0004] Therefore, the application provides an NADH pyrophosphatase with higher catalytic performance or a method for improving the catalytic performance of an NADH pyrophosphatase, which has important theoretical significance and practical value for the in-depth application of the NADH pyrophosphatase and the promotion of the biosynthesis of NMNH. SUMMARY

[0005] The application aims to overcome the defects and deficiencies of the prior art and provide an NADH pyrophosphatase mutant with improved catalytic performance and the use thereof.

[0006] The first object of the application is to provide an optimized NADH pyrophosphatase.

[0007] The second object of the application is to provide an NADH pyrophosphatase mutant with improved catalytic performance.

[0008] The third object of the application is to provide a gene encoding the optimized NADH pyrophosphatase.

[0009] The fourth object of the application is to provide a gene encoding the NADH pyrophosphatase mutant.

[0010] The fifth object of the application is to provide a method for improving the catalytic performance of the NADH pyrophosphatase.

[0011] The sixth object of the application is to provide a sequence for improving the catalytic performance of the NADH pyrophosphatase or the NADH pyrophosphatase mutant.

[0012] The seventh object of the application is to provide a recombinant plasmid capable of expressing the NADH pyrophosphatase with improved catalytic performance.

[0013] The eighth object of the application is to provide a recombinant bacterium containing the recombinant plasmid.

[0014] The ninth object of the application is to provide the use of the recombinant plasmid and the recombinant bacterium in the biosynthesis of reduced nicotinamide mononucleotide or in the preparation of a preparation for the biosynthesis of reduced nicotinamide mononucleotide.

[0015] The tenth object of the application is to provide a method for biosynthesizing reduced nicotinamide mononucleotide.

[0016] The above objects of the application are achieved by the following technical solutions.

[0017] The application provides an optimized NADH pyrophosphatase, which is obtained by optimizing and designing based on a gene sequence (GenBank: NEY29540.1) encoding NADH pyrophosphatase in Escherichia coli as a parent. Specifically, the amino acid sequence of the optimized NADH pyrophosphatase is shown in SEQ ID NO. 2, and the catalytic performance of the NADH pyrophosphatase is higher than that of the parent, and the NADH pyrophosphatase can be used for biosynthesis of reduced nicotinamide mononucleotide (NMNH).

[0018] The application also provides a gene encoding the optimized NADH pyrophosphatase; as one of optional embodiments, the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0019] The application also provides a recombinant plasmid containing the gene encoding the optimized NADH pyrophosphatase.

[0020] Specifically, the recombinant plasmid contains the gene shown in SEQ ID NO. 1, and the plasmid used for constructing the recombinant plasmid is pRSFDuet-1, pCDFDuet-1, pACYCDuet-1, pET-28a (+) or pET-3b; wherein the expression effect of the plasmid pET-28a (+) is better.

[0021] The application also provides a NADH pyrophosphatase mutant with improved catalytic performance, and the mutant is a mutant obtained by mutating any one or several amino acid sites of 110th, 120th, 122th, 147th, 148th, 149th, 150th or 218th amino acid in the amino acid sequence shown in SEQ ID NO. 2.

[0022] Specifically, the mutation is:

[0023] the 110th threonine is mutated into alanine;

[0024] or the 120th arginine is mutated into serine;

[0025] or the 122th arginine is mutated into alanine;

[0026] or the 147th threonine is mutated into phenylalanine;

[0027] or the 148th arginine is mutated into any one of threonine, phenylalanine, serine, isoleucine, leucine, glutamic acid, cysteine, alanine, histidine, lysine, aspartic acid, tyrosine, methionine, asparagine, tryptophan, proline, glycine, glutamine and valine;

[0028] or the 149th histidine is mutated into any one of tryptophan, phenylalanine, valine, tyrosine, isoleucine, glycine, asparagine, leucine, threonine, glutamine, serine, aspartic acid, cysteine, alanine, lysine, glutamic acid, methionine;

[0029] or the 150th arginine is mutated into cysteine;

[0030] or the 218th lysine is mutated into asparagine;

[0031] or the 148th arginine and the 149th histidine are mutated into alanine and glutamic acid respectively.

[0032] The present application also provides a gene encoding the NADH pyrophosphatase mutant.

[0033] The present application also provides a method for improving the catalytic performance of the NADH pyrophosphatase, which is as follows: when constructing a recombinant plasmid for expressing the NADH pyrophosphatase, the recombinant plasmid is modified as follows:

[0034] (1) the gene sequence encoding the NADH pyrophosphatase is replaced by a gene sequence encoding the NADH pyrophosphatase mutant;

[0035] and / or (2) the following sequence is inserted between the promoter sequence of the expression plasmid and the gene sequence to be expressed:

[0036] ① the ale promoter sequence shown in SEQ ID NO. 3 or the adhA promoter sequence shown in SEQ ID NO. 5;

[0037] and / or ② the ribosome binding site sequence shown in any one of SEQ ID NO. 18-20, SEQ ID NO. 22.

[0038] Specifically, the plasmid is pET-28a(+), and the promoter sequence of the plasmid is a T7 promoter sequence.

[0039] In the method, only the insertion of the ale promoter sequence shown in SEQ ID NO. 3 or the adhA promoter sequence shown in SEQ ID NO. 5 or the ribosome binding site sequence shown in any one of SEQ ID NO. 18-20, SEQ ID NO. 22 can improve the catalytic performance of the NADH pyrophosphatase. In addition, they can also be combined with each other or used together to improve the catalytic performance of the NADH pyrophosphatase.

[0040] For example, in constructing a recombinant expression plasmid for expressing the NADH pyrophosphatase shown in SEQ ID NO. 2, the ale promoter sequence shown in SEQ ID NO. 3 or the adhA promoter sequence shown in SEQ ID NO. 5 and the ribosome binding site sequence shown in any one of SEQ ID NO. 18-20, SEQ ID NO. 22 are inserted simultaneously; or on the basis of the insertion of the promoter sequence and the ribosome binding site sequence, the gene sequence encoding the NADH pyrophosphatase shown in SEQ ID NO. 2 is replaced by a gene sequence encoding the mutant NADH pyrophosphatase of the application.

[0041] The application also provides a sequence for improving the catalytic performance of the NADH pyrophosphatase or the mutant NADH pyrophosphatase, which is the ale promoter sequence shown in SEQ ID NO. 3 or the adhA promoter sequence shown in SEQ ID NO. 5; or the ribosome binding site sequence shown in any one of SEQ ID NO. 18-20, SEQ ID NO. 22.

[0042] The application also provides a recombinant plasmid capable of expressing the NADH pyrophosphatase with improved catalytic performance.

[0043] Specifically, the recombinant plasmid contains a gene encoding the optimized NADH pyrophosphatase or a gene encoding the NADH pyrophosphatase;

[0044] or contains a promoter sequence shown in any one of SEQ ID NO. 3 and SEQ ID NO. 5 and a gene encoding the optimized NADH pyrophosphatase or a gene encoding the NADH pyrophosphatase;

[0045] or contains a ribosome binding site sequence shown in any one of SEQ ID NO. 18-20, SEQ ID NO. 22 and a gene encoding the optimized NADH pyrophosphatase or a gene encoding the NADH pyrophosphatase;

[0046] or contains a promoter sequence shown in any one of SEQ ID NO. 3 and SEQ ID NO. 5, a ribosome binding site sequence shown in any one of SEQ ID NO. 18-20, SEQ ID NO. 22 and a gene encoding the optimized NADH pyrophosphatase or a gene encoding the NADH pyrophosphatase.

[0047] The application also provides a recombinant bacterium containing the recombinant plasmid.

[0048] Optionally, the recombinant bacteria is Escherichia coli, Bacillus subtilis, Bacillus cereus, Bacillus cereus, Bacillus licheniformis, Bacillus megaterium, Bacillus fragilis, Bacillus clausii, Bacillus alcalophilus or Bacillus thuringiensis, Saccharomyces cerevisiae, Pichia pastoris or Kluyveromyces lactis as a host bacteria.

[0049] The application also claims the use of the recombinant plasmid and the recombinant bacteria in biosynthesis of reduced nicotinamide mononucleotide or in preparation of a preparation for biosynthesis of reduced nicotinamide mononucleotide.

[0050] The application also provides a method for biosynthesis of reduced nicotinamide mononucleotide, comprising the following steps:

[0051] S1. Activate the recombinant bacteria strain to obtain a seed liquid;

[0052] S2. Seed the seed liquid obtained in step S1 into a fermentation medium containing NADH with a pH of 6.8-7.2 at a seeding amount of 8%-10%, and culture under the condition of a culture temperature of 35-37℃ and a dissolved oxygen content of 10%-15%, and when the OD 600 of the culture medium reaches 1.8-2, add 0.08-0.12 mM IPTG to induce expression of NADH pyrophosphatase under the condition of 24-26℃ to generate reduced nicotinamide mononucleotide.

[0053] The application has the following beneficial effects:

[0054] The application optimizes the gene sequence encoding NADH pyrophosphatase in Escherichia coli, and obtains the gene sequence shown in SEQ ID NO. 1, and the amino acid sequence of the NADH pyrophosphatase encoded by the gene sequence is shown in SEQ ID NO. 2. Compared with the original NADH pyrophosphatase of Escherichia coli, the catalytic performance of the NADH pyrophosphatase shown in SEQ ID NO. 2 is higher, that is, the application provides an optimized NADH pyrophosphatase, and the catalytic performance of which is improved compared with before optimization. On this basis, the application also provides a NADH pyrophosphatase mutant with improved catalytic performance through site-directed mutagenesis.

[0055] In addition, the application also provides a method for further improving the catalytic performance of the provided optimized NADH pyrophosphatase and mutant thereof, and when constructing the recombinant plasmid thereof, by inserting specific promoter sequences and ribosome binding sites into the plasmid, the catalytic performance of the NADH pyrophosphatase obtained by induced expression is higher than that of the parent. The optimized NADH pyrophosphatase and mutant thereof provided by the application not only has high catalytic performance, but also has good thermal stability, and can be used for biosynthesis of reduced nicotinamide mononucleotide, and is suitable for industrial production and application.

[0056] The application provides an effective strategy for high-efficiency expression of NADH pyrophosphatase, fermentation enzyme production process and application of the NADH pyrophosphatase in biosynthesis of reduced nicotinamide mononucleotide. BRIEF DESCRIPTION OF DRAWINGS

[0057] Figure 1 Enzyme activity determination results of the NADH pyrophosphatase expressed by different expression plasmids.

[0058] Figure 2 Enzyme activity determination results of the NADH pyrophosphatase expressed by recombinant bacteria containing different promoter sequences.

[0059] Figure 3 Enzyme activity determination results of the NADH pyrophosphatase expressed by recombinant bacteria containing different RBS sequences.

[0060] Figure 4 Enzyme activity determination results of the NADH pyrophosphatase expressed by different site mutation bacterial strains.

[0061] Figure 5 Enzyme activity determination results of the NADH pyrophosphatase expressed by the mutant bacterial strains after saturation mutation of R148 and H149 to other 19 different amino acids.

[0062] Figure 6 Molecular docking diagram of the substrate NADH and the NADH pyrophosphatase.

[0063] Figure 7 OD 600 , glucose and NADH pyrophosphatase activity changes of the R148A and H149E combined mutant M9 in the fermentation process.

[0064] Figure 8 NMNH production of the R148A and H149E combined mutant M9 at different substrate concentrations. DETAILED DESCRIPTION

[0065] The application will be further described below in combination with the drawings and specific examples, but the examples do not limit the application in any form. Unless otherwise specified, the reagents, methods and equipment used in the application are conventional reagents, methods and equipment in the technical field.

[0066] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0067] Example 1 Construction of NADH pyrophosphatase gene recombinant plasmid and enzyme activity determination thereof

[0068] This invention uses the gene sequence encoding NADH pyrophosphatase in *Escherichia coli* (GenBank: NEY29540.1) as the parent, and through optimized design, obtained the NADH pyrophosphatase gene (Nudc) sequence shown in SEQ ID NO.1. The gene sequence shown in SEQ ID NO.1 was artificially synthesized, and a recombinant plasmid expressing this gene was constructed using the pRSFDuet-1 vector. The recombinant plasmid, verified by sequencing, was named pRSFDuet-Nudc. The constructed recombinant plasmid was then transformed into *Escherichia coli* BL21 DE3, obtaining a recombinant bacterium expressing the gene shown in SEQ ID NO.1. This invention also simultaneously constructed a recombinant bacterium expressing NEY29540.1 using the same vector and host bacteria.

[0069] This invention, through inducing the recombinant bacteria to express recombinant NADH pyrophosphatase and measuring its enzyme activity, found that the NADH pyrophosphatase encoded by the gene shown in SEQ ID NO.1 (the amino acid sequence of the encoded NADH pyrophosphatase is shown in SEQ ID NO.2) has higher catalytic performance than the parent NADH pyrophosphatase. The enzyme activity of the parent NADH pyrophosphatase is 0.4 U / mL, and the enzyme activity of the optimized NADH pyrophosphatase is 0.88 U / mL.

[0070] Meanwhile, during the experimental process, this invention discovered that the enzyme activity of NADH pyrophosphatase (shown in SEQ ID NO.2) obtained by expressing different expression plasmids varied, meaning that different expression plasmids could affect the enzyme activity of the expressed NADH pyrophosphatase. Specifically, this invention constructed recombinant expression plasmids for the NADH pyrophosphatase shown in SEQ ID NO.2 using pRSFDuet-1, pCDFDuet-1, pACYCDuet-1, pET-28a(+), and pET-3b plasmids, respectively, and measured their enzyme activity after inducing expression. The enzyme activity assay results of the optimized NADH pyrophosphatase gene expressed using different expression plasmids are as follows: Figure 1 As shown, by Figure 1 It was found that the recombinant strain E. coli BL21(DE3) / pET-3b-EcNudc had the lowest enzyme activity (0.09 U / mL), while the recombinant strain E. coli BL21(DE3) / pET-28a(+)-Nudc had the highest enzyme activity (1.1 U / mL). This indicates that the use of the pET-28a(+) vector can enhance the enzyme activity of NADH pyrophosphatase.

[0071] The method for determining NADH pyrophosphatase activity is as follows:

[0072] (1) Obtain enzyme solution containing NADH pyrophosphatase

[0073] The obtained recombinant bacterial strains were activated on solid LB plates, and single colonies were picked and inoculated in 10 mL of LB medium, which was incubated at 37°C and 220 rpm for 12 h. Then, 1% of the inoculum was transferred into 30 mL of LB medium, which was incubated at 37°C and 220 rpm (about 2.5 h) until the OD 600 = 0.6-0.8, 0.5 mM of IPTG was added to induce the culture for 12 h. After the induction, equal amounts of bacterial liquid were collected, centrifuged at 4°C and 8000 rpm for 10 min, and the precipitate was resuspended and washed with 100 mM of Tris-HCl and then disrupted by ultrasonic treatment. The supernatant was obtained by centrifugation at 4°C and 8000 rpm for 10 min, and the NADH pyrophosphatase-containing enzyme solution was obtained. The NADH pyrophosphatase activity was determined.

[0074] (2) Determination of NADH pyrophosphatase activity

[0075] The enzyme reaction system (50 μL) was 50 mM of Tris-HCl, pH = 8.0; 5 mM of MgCl2; 25 mM of NADH; 4 U of alkaline phosphatase (calf intestine); 15.5 μL of enzyme solution, which was reacted at 37°C for 15 min. Then, 250 μL of EDTA (4 mM, pH = 8.0) was immediately added to terminate the reaction. Then, 700 μL of a mixture of 10% ascorbic acid and 0.42% molybdate was added, and color development was performed at 45°C for 20 min. The absorbance was detected at 820 nm. The enzyme activity was defined as follows: under the above reaction conditions, 1 μmol of NADH hydrolyzed by NADH pyrophosphatase per minute was defined as one enzyme unit U.

[0076] Example 2: Promoter modification to improve the enzyme activity of NADH pyrophosphatase

[0077] During the experiments, it was found that, based on the pET-28a(+)-Nudc recombinant plasmid constructed in Example 1, the enzyme activity of the expressed NADH pyrophosphatase could be changed by inserting different promoter sequences into the recombinant plasmid in series with the original T7 promoter sequence, i.e., the enzyme activity of the NADH pyrophosphatase of the present application could be improved by introducing specific promoter sequences.

[0078] Specifically, the names and sequences of the promoters used in the present embodiment are as follows:

[0079] ale (SEQ ID NO. 3): ttatccagaagatgttgttcaaaaagcgcatataaaagcgcggcaactaaatgtcttattacccgtagagagctttccggcgagagttcaatgggacaggttccagaaaacacgtcattattagatagataaggaataaccc

[0080] papx (SEQ ID NO. 4): ttgctcacatctcactttcgtaatgctcacattacgtgactgattctaacaaaacattaacaccaaggctc aaaattttgtcctaaacttgatctcgacgaaatggctgcacctaaatcgtgatgaaaatcacatttttatcgtaattgccctttaaaattcagagtgggggcgccgaccccatgtggtctcaagcccaaaggacgcgtaatgaggcgagtcagtcttaggcacaggattgatttgtcgcaatgattgacacgattccgcttgacgctgcgtaaggtttttgtaattttacaaacggccttttattcactaacaaagatctggtggaatat

[0081] adhA (SEQ ID NO. 5): gggtagttaatatccttttgaagcgaaaaattaagcattcaatacgggtattgcagtgtgtttaaccg ttcagttgaaggttgcgcctacactaagcatagttgttgatgaatttttcaattatatttgtatcgccatagctttcaaaaattttgtaaaatatttttagtt taagcaatgtgattcaacaactctggagaaagtctt

[0082] almR (SEQ ID NO. 6): tcatcttccccggtgtcccaaaacttcacaatcaaaaaacatttgtgatgttgataaattaaaaacacccaaaatcgatgaattacgccttcctgatctgtcttacgttagaacatctgacagcgcaatagcgttaaagacactcaccatccagcaactatatccatctaaaaaaccagaaaaacaaataacatcatgtttttaaactaattaaatgaaataaaattttaactcagccgccattgttcacaataaaataaactttataaattttatttttttgtgtcgaagccagcatcttttctgttcttgctgtggtgatatgcggtagtcttcaattcaaggacaagagaacgtg

[0083] tac-M (SEQ ID NO. 7): tgagctgttgacaattaatcatcgtgtggtaccatgtgt

[0084] smcA (SEQ ID NO. 8): ccagttcctcgccacgcctccctcggctccggcgcgaatgaacatcttattggctatatccaccgacacaaatgttgccatcccattgcttaatcgaataaaaatcaggctatgccatgggtaaatctttaacgataacgccattgaggctggtcatggctcgcataaatcttatggacttacctttacacatt

[0085] tac (SEQ ID NO. 9): tgagctgttgacaattaatcatcggctcgtataatgtgt

[0086] tac-MD (SEQ ID NO. 10): tgagctgttgccaattaatcatcgtgtggtaccatgtgt

[0087] pkan (SEQ ID NO. 11): ccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaa

[0088] The promoter sequence is inserted into the NADH pyrophosphatase recombinant plasmid (pET-28a(+)-Nudc) constructed in Example 1 by enzyme digestion and ligation or reverse PCR. The specific process is as follows: for the ale, papx, adhA, almR, and smcA promoters, the above promoter fragments are amplified from the E. coli genome using specific primers with enzyme digestion sites (the primer sequences used for amplification are shown in Table 1), and the promoter fragments are recovered after amplification and ligated with the double-digested vector. For the tac-M, tac, tac-MD, and pkan promoters, the promoter sequence is designed on the primer, and then a reverse polymerase chain reaction is used to obtain a linearized plasmid containing different promoters. Then, the methylated template plasmid (the methylated template plasmid is pET-28a(+)-Nudc) is digested with Dpn I restriction enzyme, and incubated at 37°C. The specific process is performed according to the FuniCut Dpn I kit instructions. Then, the ligation product and the digestion product are transformed into the cloning host E. coli JM109, and positive single colonies are screened and the plasmid is extracted for sequencing. The plasmid verified by sequencing to be correctly ligated is transformed into E. coli BL21(DE3) to construct recombinant bacteria containing different promoters. The obtained recombinant bacteria are induced for expression and the enzyme activity of the expressed NADH pyrophosphatase is determined using the method described in Example 1. TM Dpn I kit instructions. Then, the ligation product and the digestion product are transformed into the cloning host E. coli JM109, and positive single colonies are screened and the plasmid is extracted for sequencing. The plasmid verified by sequencing to be correctly ligated is transformed into E. coli BL21(DE3) to construct recombinant bacteria containing different promoters. The obtained recombinant bacteria are induced for expression and the enzyme activity of the expressed NADH pyrophosphatase is determined using the method described in Example 1.

[0089] Table 1 Specific primers used for amplifying promoter sequences

[0090]

[0091]

[0092] The determination results of the enzyme activity of the NADH pyrophosphatase expressed by the recombinant bacteria containing different promoter sequences are as follows Figure 2The results show that the enzyme activity of NADH pyrophosphatase obtained by expressing the same NADH pyrophosphatase gene using different promoters is different. Among the promoters used in this example, the NADH pyrophosphatase enzyme activity of the recombinant bacteria expressed by the adhA (shown in SEQ ID NO. 5) and T7 promoter in tandem is the highest, reaching 1.3 U / mL, which is 18.2% higher than the control, indicating that the introduction of the adhA promoter in tandem with the T7 promoter can improve the enzyme activity of NADH pyrophosphatase. Figure 2 The results show that the enzyme activity of NADH pyrophosphatase obtained by expressing the same NADH pyrophosphatase gene using different promoters is different. Among the promoters used in this example, the NADH pyrophosphatase enzyme activity of the recombinant bacteria expressed by the adhA (shown in SEQ ID NO. 5) and T7 promoter in tandem is the highest, reaching 1.3 U / mL, which is 18.2% higher than the control, indicating that the introduction of the adhA promoter in tandem with the T7 promoter can improve the enzyme activity of NADH pyrophosphatase.

[0093] Example 3: Improvement of NADH pyrophosphatase enzyme activity by ribosome binding site (RBS) modification

[0094] To further improve the enzyme activity of NADH pyrophosphatase expressed by the NADH pyrophosphatase gene shown in SEQ ID NO. 1, different ribosome binding site (RBS) sequences were designed and constructed in the application, and were named R1 to R12 in turn, and the sequences were shown in SEQ ID NO. 12 to 23 in turn. The pET-28a(+)-adhA+T7-Nudc recombinant plasmid from E. coli JM109 constructed in Example 2 was used as a DNA template, and 12 linearized plasmids carrying different RBS were obtained by reverse polymerase chain reaction.

[0095] The primers and reaction conditions used in the reverse polymerase chain reaction are shown as follows:

[0096] Table 2 Primers used in reverse polymerase chain reaction for amplifying linearized plasmids carrying different RBS

[0097]

[0098]

[0099] The reverse polymerase chain reaction was performed in a 50 μL system, 20 μL of ddH2O, 1 μL of template, 25 μL of 2×Phanta Max Master Mix, and 2 μL of upstream and downstream primers were added. The reaction conditions were as follows: after pre-denaturation at 95℃ for 3 min, the cycle was started: denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 6 min, a total of 34 cycles; and final extension at 72℃ for 5 min. Then the methylated template plasmid DNA (pET-28a(+)-adhA+T7-Nudc) was digested with DpnI restriction enzyme, transformed into E. coli JM109, and the transformants were obtained; and further sequencing was performed to obtain a series of RBS recombinant plasmids, which were transformed into E. coli BL21 (DE3) to construct recombinant bacteria containing different RBS sequences for expressing NADH pyrophosphatase. The obtained recombinant bacteria were induced for expression by the method described in Example 1, and the enzyme activity of the expressed recombinant NADH pyrophosphatase was determined.

[0100] The enzyme activity determination results of NADH pyrophosphatase expressed by the recombinant bacteria containing different RBS sequences are shown in Table 3. Figure 3As shown; where control represents the NADH pyrophosphatase activity expressed by the control strain pET-28a(+)-adhA+T7-Nudc(BL21DE3), 1 represents the NADH pyrophosphatase activity expressed by the R1 recombinant strain pET-28a(+)-adhA+T7-R1-Nudc(BL21DE3), 2 represents the NADH pyrophosphatase activity expressed by the R2 recombinant strain pET-28a(+)-adhA+T7-R2-Nudc(BL21DE3), and 3 represents the NADH pyrophosphatase activity expressed by the R3 recombinant strain pET-28a(+)-adhA+T7-R3-Nudc(BL21DE3). The enzyme activity of NADH pyrophosphatase expressed by DE3 is shown in Figure 4. Figure 5 shows the enzyme activity of NADH pyrophosphatase expressed by R4 recombinant strain pET-28a(+)-adhA+T7-R4-Nudc (BL21DE3). Figure 6 shows the enzyme activity of NADH pyrophosphatase expressed by R5 recombinant strain pET-28a(+)-adhA+T7-R6-Nudc (BL21DE3). Figure 7 shows the enzyme activity of NADH pyrophosphatase expressed by R7 recombinant strain pET-28a(+)-adhA+T7-R7-Nudc (BL21DE3). The enzyme activity of NADH pyrophosphatase expressed by DE3 is shown in Figure 8. Figure 9 shows the enzyme activity of NADH pyrophosphatase expressed by R8 recombinant strain pET-28a(+)-adhA+T7-R8-Nudc (BL21DE3). Figure 10 shows the enzyme activity of NADH pyrophosphatase expressed by R9 recombinant strain pET-28a(+)-adhA+T7-R10-Nudc (BL21DE3). Figure 11 shows the enzyme activity of NADH pyrophosphatase expressed by R11 recombinant strain pET-28a(+)-adhA+T7-R11-Nudc (BL21DE3). Figure 12 shows the enzyme activity of NADH pyrophosphatase expressed by R12 recombinant strain pET-28a(+)-adhA+T7-R12-Nudc (BL21DE3). The enzyme activity of NADH pyrophosphatase obtained by DE3 expression. Figure 3 The results show that, compared with the control bacteria, the NADH pyrophosphatase activity expressed by the recombinant bacteria R7, R8, R9, and R11 was significantly increased, especially that of the R7 recombinant bacteria, which reached an activity of 1.80 U / mL, an increase of 38.5% compared with the control bacteria. In addition, the NADH pyrophosphatase activities of the R8 and R11 recombinant bacteria were also significantly increased, reaching 1.6 U / mL and 1.7 U / mL, respectively, representing increases of 23.1% and 30.8% compared with the control.

[0101] Method for site-directed mutagenesis of NADH pyrophosphatase gene

[0102] The recombinant plasmid pET-28a(+)-adhA+T7-R7-Nudc is used as a DNA template, and a series of mutants are obtained through reverse polymerase chain reaction by using partial complementary primers containing mutation sites (as shown in Table 3).

[0103] Table 3 Primers for site-directed mutagenesis

[0104] Primer name Primer sequence F(110) CCCTTCCAAGGCCGAATGGGCAATGTTGTGTCA R(110) CCCATTCGGCCTTGGAAGGGTAAAGCTCGTGTCCACA F(122) TTGTCGCGAGGCCTATTACCCTCAGATCCTTCCG R(122) TAATAGGCCTCGCGACAATGCTGACACAACATTGCCCA F(148) AACACACCGCCCACCGCAATGGATACCACACCG R(148) ATTGCGGTGGGCGGTGTGTTGGGCGTCCAGAA F(150) CACCCGCCACTGCAATGGATACCACACCGT R(150) TCCATTGCAGTGGCGGGTGTGTTGGGCGTCCAGAAT F(218) TTGACCCGAACGAACTTTTAGAATTGAACTGG R(218) AAGTTCGTTCGGGTCAACAATAATGCCGAGTACGATAG F(120) AGCATTGTTCCGAGCGCTATTACCCTCA R(120) GCGCTCGGAACAATGCTGACACAACATTGCCCATTCT F(147) AACACTTCCGCCACCGCAATGGATACCACACCG R(147) ATTGCGGTGGCGGAAGTGTTGGGCGTCCAGAA F(149) AACACACCCGCGAACGCAATGGATACCACACCG R(149) ATTGCGTTCGCGGGTGTGTTGGGCGTCCAGAA

[0105] Note: The numbers in parentheses represent the mutated amino acid sites

[0106] The reverse PCR amplification reaction is performed in a 50 μL system, and 25 μL PrimeSTAR HS (Premix), 20 μL ddH2O, 1 μL template DNA, 2 μL of each upstream and downstream material are added to the reaction system. The reaction conditions are as follows: 95 °C pre-denaturation for 3 min, followed by 34 cycles of 95 °C denaturation for 15 s, 55 °C annealing for 15 s, and 72 °C extension for 6 min; and 72 °C final extension for 5 min. Then, the methylated template plasmid DNA (the methylated template plasmid DNA is pET-28a(+)-adhA+T7-R7-Nudc) is digested with DpnI restriction enzyme, and the specific process is carried out according to the FuniCut TM DpnI kit instructions. Subsequently, the enzyme-digested product is directly transformed into E. coli JM109, the plasmid is extracted, and the NADH pyrophosphatase is expressed in E. coli BL21 (DE3), and the enzyme activity of the mutant is verified by fermentation.

[0107] By using the above method, the mutants T110A, R122A, R148T, R150C, K218N, R120S, T147F and H149M are obtained, and the enzyme activity of the obtained mutants is verified by fermentation. Specifically, the mutant T110A is a mutant in which T at position 110 of the NADH pyrophosphatase enzyme shown in SEQ ID NO. 2 is mutated to A, and the other mutants are similarly mutated.

[0108] The determination results of the enzyme activity of the NADH pyrophosphatase expressed by different site-directed mutant bacterial strains are as follows Figure 4As shown, compared with the control strain pET-28a(+)-adhA+T7-R7-Nudc(BL21 DE3), the enzyme activities of all mutant strains were increased. Among them, the enzyme activities of R148T and H149M were significantly increased, reaching 3.4 U / mL and 3.0 U / mL, respectively, representing increases of 88.9% and 66.7%. In addition, the enzyme activities of T110A, R122A, K218N, and T147M were also significantly increased, reaching 2.2 U / mL, 2.2 U / mL, 2.4 U / mL, and 2.1 U / mL, respectively, representing increases of 22.2%, 22.2%, 33.3%, and 16.7% compared to the control strain.

[0109] Example 5: Method for saturation mutation of NADH pyrophosphatase gene

[0110] Based on the site-directed mutagenesis results in Example 4, this invention used positive mutants M3 (R148T) and M8 (H149M) as DNA templates and performed saturation mutagenesis (mutating R148 to G / A / V / L / I / P / F / Y / W / S / T / C / M / N / Q / D / E / K / H; and H149 to G / A / V / L / I / P / F / Y / W / S / T / C / M / N / Q / D / E / K / R). The PCR reaction conditions were as follows: 34 cycles of pre-denaturation at 95°C for 3 min, followed by 15 s of denaturation at 95°C, 15 s of annealing at 55°C, and 6 min of extension at 72°C; and a final extension at 72°C for 5 min. The methylated template plasmid DNA (pET-28a(+)-adhA+T7-R7-Nudc) was then digested with Dpn I restriction enzyme. Subsequently, the product of enzyme digestion was directly transformed into Escherichia coli JM109, and the plasmid was extracted and transformed into E. coli BL21(DE3) to express NADH pyrophosphatase.

[0111] The results of NADH pyrophosphatase activity assays of mutant strains obtained by saturating mutations of R148 and H149 into 19 different amino acids are as follows: Figure 5 As shown, by Figure 5 It was found that when R148 was mutated to 19 other amino acids, the NADH pyrophosphatase activity of all mutant strains at position 148 was increased. When position 149 was mutated to 19 other amino acids, the NADH pyrophosphatase activity of all mutant strains except H149R and H149P was also increased. Among all the mutant strains mentioned above, R148A and H149E showed the highest enzyme activity, reaching 5.0 U / mL and 5.1 U / mL, respectively, which is about 2.8 times that of the control strain.

[0112] In addition, the present application also carries out combined mutation on two sites with the most significant effect of R148 and H149 saturation mutation, i.e. R148A and H149E, so as to obtain a mutant M9 (R148A-H149E), and the enzyme activity of NADH pyrophosphatase thereof is determined, and the result shows that the enzyme activity of the combined mutant M9 (R148A-H149E) reaches 6 U / mL, which is 3.3 times of the control bacteria.

[0113] Specifically, pET-28a(+)-adhA+T7-R7-Nudc-R148A is used as a template, reverse PCR is carried out by using a complementary primer containing a mutation site (F: CAACACACCGCCGAACGCAATGGATACCA / R: TGCGTTCGGCGGTGTGTTGGGCGTCCAGAATCGAATC), and the reaction condition of PCR is that 3 min of pre-denaturation at 95℃ is started to cycle: 15 s of denaturation at 95℃, 15 s of annealing at 55℃, 6 min of extension at 72℃, a total of 34 cycles; and 5 min of terminal extension at 72℃. Then, the enzyme-digested product is directly transformed into E. coli JM109 after 2 h of Dpn I restriction enzyme digestion, the plasmid is extracted, and the NADH pyrophosphatase is expressed in E. coli BL21 (DE3).

[0114] The present application also carries out molecular docking prediction on the substrate NADH and NADH pyrophosphatase, and the molecular docking result is as shown in Figure 6 Figure 6 a in the formula (I) is the molecular docking result of NADH and wild-type pyrophosphatase, Figure 6 b in the formula (I) is the molecular docking result of NADH and the mutant R148A, Figure 6 c in the formula (I) is the molecular docking result of NADH and the mutant H149E, Figure 6 d in the formula (I) is the molecular docking result of NADH and the combined mutant M9 (R148A-H149E). As shown in the result of Figure 6 R148 and H149 sites are located on both sides of the substrate NADH, respectively, the positive charge of R148 will form electrostatic interaction with the negative charge of the phosphate bond on the substrate NADH, so as to hinder the contact of the substrate with the catalytic residues, and affect the catalytic efficiency. Therefore, when R148 is mutated into other amino acids, the enzyme activity is improved. In particular, the enzyme activity of R148A is the highest Figure 6 a, 6b). When H149 is mutated into glutamic acid, it will form electrostatic repulsion - Figure 6 ​​c), so the activity of the enzyme is also improved. In addition, the enzyme activity of the combined mutant M9 is mainly improved due to the loss of electrostatic interaction and electrostatic repulsion, thereby promoting the contact of the substrate NADH with the catalytic residues Figure 6 d).

[0115] Example 6 Fermentation of recombinant NADH pyrophosphatase in a 7L fermenter

[0116] The present application carried out scale-up fermentation of the R148A and H149E combined mutant M9 (R148A-H149E) in a 7L fermenter to further investigate its fermentation enzyme production.

[0117] The mutant strain was activated on a solid LB plate, a single colony was inoculated in 10 mL of LB medium, and cultured at 37°C, 220 rpm for 12 h; then inoculated into the seed medium at a 2% inoculation amount, and further cultured at 37°C, 220 rpm for 12 h; then the seed liquid was inoculated into a 7L fermenter containing 4L fermentation medium at a 10% inoculation amount. The culture temperature was first set at 37°C, the pH was 6.8-7.2, and the dissolved oxygen was maintained above 10% by adjusting the rotation speed and aeration amount; when the OD 600 reached 2, 0.1 mM IPTG was added to induce expression at 25°C, and the changes of OD 600 , glucose and NADH pyrophosphatase activity during the M9 fermentation process were detected.

[0118] The changes of OD 600 , glucose and NADH pyrophosphatase activity during the fermentation of the R148A and H149E combined mutant M9 are shown in Figure 6 The results shown in Figure 7 show that in the early stage, glucose is rapidly consumed, and when the glucose concentration is less than 2 g / L, the nutrient is continuously added at a flow rate of 0.1 mL / min, and the cell concentration increases in this stage, and the NADH pyrophosphatase activity is highest at 33 h, reaching 33.0 U / mL, which is 3.5 times that of the optimized shake flask induction.

[0119] Example 7 Biocatalytic synthesis of NMNH by NADH pyrophosphatase

[0120] To evaluate the application of NADH pyrophosphatase in the catalytic production of NMNH, the present application carried out a biotransformation experiment with the combined mutant M9 as the catalyst. With NADH as the substrate, the reaction was carried out in a Tris-HCl buffer at pH = 9.0, 40°C, 220 rpm, and the product NMNH content was detected every 15 min.

[0121] The generation of NMNH in the R148A and H149E combined mutant M9 at different substrate concentrations is as follows: Figure 7 As shown. By Figure 8 Figure 8 The results show that when the substrate concentration is 35.47 g / L, the yield reaches its highest point (16.65 g / L) after 30 min, with a conversion rate of 99.1%. However, when a second batch of the same concentration (35.47 g / L) of substrate is added after 30 min, the NMNH yield decreases, which is due to the instability of NMNH. When the substrate concentration is 17.74 g / L, the highest yield reaches 15.82 g / L, with a conversion rate of 94.2% after 30 min (the second batch of substrate is added at 15 min). However, when a third batch of substrate is added after 30 min, the NMNH yield also decreases. When the substrate concentration is 70.94 g / L, the highest yield is 15.06 g / L, with a conversion rate of 44.8%. The above results indicate that the NADH pyrophosphatase described in this invention can be used for the biosynthesis of NMNH, with an optimal substrate concentration of 35.47 g / L and an optimal reaction time of 30 min.

[0122] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An optimized NADH pyrophosphatase, characterized in that, The amino acid sequence of the enzyme is shown as SEQ ID NO.

2.

2. A mutant NADH pyrophosphatase having improved catalytic properties, characterized in that The mutant is a mutant obtained by mutating the amino acid sequence shown as SEQ ID NO. 2 as the parent; The mutation is: mutation of threonine at position 110 to alanine; or mutation of arginine at position 120 to serine; or mutation of arginine at position 122 to alanine; or mutation of threonine at position 147 to phenylalanine; or mutation of arginine at position 148 to any one of threonine, phenylalanine, serine, isoleucine, leucine, glutamic acid, cysteine, alanine, histidine, lysine, aspartic acid, tyrosine, methionine, asparagine, tryptophan, proline, glycine, glutamine, and valine; or mutation of histidine at position 149 to any one of tryptophan, phenylalanine, valine, tyrosine, isoleucine, glycine, asparagine, leucine, threonine, glutamine, serine, aspartic acid, cysteine, alanine, lysine, glutamic acid, methionine; or mutation of arginine at position 150 to cysteine; or mutation of lysine at position 218 to asparagine; or mutation of arginine at position 148 and histidine at position 149 to alanine and glutamic acid, respectively.

3. A gene encoding the optimized NADH pyrophosphatase of claim 1.

4. A gene encoding the NADH pyrophosphatase mutant of claim 2.

5. A method for improving the catalytic performance of the NADH pyrophosphatase of claim 1, characterized in that, The method is: when constructing a recombinant plasmid for expressing the NADH pyrophosphatase of claim 1, the recombinant plasmid is modified as follows: (1) replacing the gene sequence encoding the NADH pyrophosphatase of claim 1 with a gene sequence encoding the NADH pyrophosphatase mutant of claim 2; and / or (2) inserting the following sequence between the promoter sequence of the expression plasmid and the expressed gene sequence: ① the ale promoter sequence shown as SEQ ID NO. 3 or the adhA promoter sequence shown as SEQ ID NO. 5; and / or ② the ribosome binding site sequence shown as any one of SEQ ID NO. 18-20, SEQ ID NO.

22.

6. A recombinant plasmid capable of expressing an NADH pyrophosphatase with improved catalytic properties, characterized in that, The recombinant plasmid contains the gene of claim 3 or 4; or contains the promoter sequence shown as any one of SEQ ID NO. 3 and SEQ ID NO. 5 and the gene of claim 3 or 4; or contains the ribosome binding site sequence shown as any one of SEQ ID NO. 18-20, SEQ ID NO. 22 and the gene of claim 3 or 4; or contains the promoter sequence shown as any one of SEQ ID NO. 3 and SEQ ID NO. 5, the ribosome binding site sequence shown as any one of SEQ ID NO. 18-20, SEQ ID NO. 22 and the gene of claim 3 or 4; The plasmid used for constructing the recombinant plasmid is pRSFDuet-1, pCDFDuet-1, pACYCDuet-1 or pET-28a(+).

7. A recombinant bacterium containing the recombinant plasmid of claim 6.

8. Use of the recombinant plasmid of claim 6, the recombinant bacteria of claim 7 in biosynthesis of reduced nicotinamide mononucleotide or in preparation of a preparation for biosynthesis of reduced nicotinamide mononucleotide.

9. A method for biosynthesizing reduced nicotinamide mononucleotide, characterized in that, comprising the following steps: S1. Activating the strain of the recombinant bacteria of claim 7, and culturing to obtain a seed liquid; S2. The seed liquid obtained in step S1 is inoculated into the fermentation medium containing NADH with pH of 6.8-7.2 at an inoculation amount of 8%-10%, and is cultured at a culture temperature of 35-37°C and a dissolved oxygen amount of 10%-15%, until OD 600 When OD reaches 1.8-2, 0.08-0.12 mM IPTG is added to induce the expression of NADH pyrophosphatase at 24-26°C to generate reduced nicotinamide mononucleotide.

Images