A bacillus subtilis high-efficiency artificial terminator and application thereof

Abstract

The application discloses a bacillus subtilis efficient artificial terminator and application thereof, and belongs to the technical field of genetic engineering. The activity of different terminators is characterized first, and then the termination efficiency of the terminator is determined by using a different terminator determination platform, so that a series of novel terminators capable of improving the yield of target proteins are obtained. The green fluorescent protein gene is used as an upstream gene of the terminator, the red fluorescent protein gene is used as a downstream gene of the terminator, and the regulation level of the terminator on the upstream and downstream genes is characterized. The results show that the novel terminators have good effects on improving the expression amount of the upstream gene and inhibiting the expression amount of the downstream gene. The series of different terminators are applied to the expression of nattokinase and pullulanase recombinant proteins, and the results show that the terminators are helpful to improving the enzyme activity of the proteins and the increase of the protein expression amount, which has important application value for producing target proteins in the bacillus subtilis.

Description

[0001] This application is a divisional application of the original application number: CN 202011451933.4, the original application date was December 9, 2020, and the invention title was Bacillus subtilis artificial terminator and its application. Technical Field

[0002] This invention relates to a highly efficient artificial terminator for Bacillus subtilis and its application, belonging to the field of genetic engineering technology. Background Technology

[0003] Transcription terminators are RNA sequences located downstream of genes or operons, responsible for terminating transcription by dissociating RNA polymerase and releasing transcribed RNA. In prokaryotes, there are two types of transcription terminators: protein-factor-dependent terminators, which require the assistance of protein factors and consume ATP; and intrinsic terminators, which function solely through their own inverted palindromic sequence and poly-U hairpin structure. Due to their unique secondary structure, transcription terminators are often located at the 3' end of genes, playing a crucial role in maintaining mRNA stability and increasing its half-life. Termination of transcription by terminators causes RNA polymerase to detach from the transcription complex, improving RNA polymerase utilization efficiency and gene expression levels. Previous research on terminators has primarily focused on *E. coli*, with only a few publications mentioning their application in other microorganisms, such as *Saccharomyces cerevisiae*.

[0004] Bacillus subtilis is a widely used host for the production of food enzymes and important nutritional chemicals. Therefore, providing a stable and highly active terminator that can regulate gene expression in Bacillus subtilis is of significant value for the preparation of target proteins, especially those used in the food industry. Consequently, obtaining an efficient, compatible, and regulated artificial terminator system for Bacillus subtilis protein expression has become a research hotspot. Summary of the Invention

[0005] In order to obtain a highly efficient, compatible, and regulated protein expression Bacillus subtilis artificial terminator system, the present invention provides an element for regulating gene expression, wherein the element is a T5, T24, T31, T42, or T52 terminator, and the nucleotide sequences are shown in SEQ ID NO.1 to SEQ ID NO.5, respectively.

[0006] The above-mentioned T5, T24, T31, T42, and T52 terminators are used in gene expression, wherein the terminator is placed downstream of the gene to be expressed, and co-expressed with the gene.

[0007] In one embodiment of the present invention, the gene is a gene encoding nattokinase or a gene encoding aspartate lyase.

[0008] The present invention also provides a carrier containing the above-described elements.

[0009] The present invention also provides genetically engineered bacteria that express the above-mentioned vector.

[0010] The present invention also provides a method for regulating the expression of a target protein in Bacillus subtilis by co-expressing the above-mentioned elements with the target protein gene.

[0011] In one embodiment of the present invention, the Bacillus subtilis includes Bacillus subtilis 168, Bacillus subtilis WB400, Bacillus subtilis WB600 or Bacillus subtilis WB800.

[0012] In one embodiment of the present invention, the target protein includes an enzyme.

[0013] The present invention also provides the application of the above-mentioned regulatory elements or genetically engineered bacteria in the preparation of target proteins.

[0014] The present invention also provides the application of the above-mentioned regulatory elements or genetically engineered bacteria in the food, pharmaceutical or chemical fields.

[0015] Beneficial effects

[0016] This invention first characterized the activity of single terminators, finding that adding the T31 terminator increased upstream GFP expression by 1.98 times and decreased downstream mcherry expression by 33.8 times compared to not adding a terminator. Using the green fluorescent protein gene as the upstream gene of the terminator and the red fluorescent protein gene as the downstream gene, the regulatory levels of the terminators on the upstream and downstream genes were characterized. The results showed that these terminators were effective in inhibiting downstream gene expression; for example, adding the T42 terminator, which had the lowest termination efficiency, reduced downstream mcherry expression by 1.43 times compared to the control. Placing the terminators in different gene environments did not change the measured termination efficiency, and they still achieved the goal of inhibiting downstream gene expression. By using terminators with different termination strengths as 3' elements for gene expression, different expression levels of the target protein were obtained, which has important application value for the production of the target protein in Bacillus subtilis. Attached Figure Description

[0017] Figure 1The terminator termination efficiency was characterized, where G-mch-5, G-mch-24, G-mch-31, G-mch-42, and G-mch-52 represent the termination efficiencies of each terminator after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry in plasmid pBp43-GFP-mcherry, respectively.

[0018] Figure 2 : Termination efficiency of terminator is used to characterize reporter gene expression levels, where M: protein molecular weight standard; G-mch-0: no terminator added; G-mch-5, G-mch-24, G-mch-31, G-mch-42, and G-mch-52 represent the expression levels of upstream and downstream proteins in different elements after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry in plasmid pBp43-GFP-mcherry, respectively.

[0019] Figure 3 Characterization of upstream GFP fluorescence intensity of terminators, where control represents the reference plasmid, and G-mch-5, G-mch-24, G-mch-31, G-mch-42, and G-mch-52 represent the upstream GFP fluorescence intensity of each terminator after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry in plasmid pBp43-GFP-mcherry, respectively.

[0020] Figure 4 Characterization of downstream mcherry fluorescence intensity of terminators, where control represents the reference plasmid, and G-mch-5, G-mch-24, G-mch-31, G-mch-42, and G-mch-52 represent the downstream mcherry fluorescence intensity measured after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry in plasmid pBp43-GFP-mcherry, respectively.

[0021] Figure 5 The verification of terminator element compatibility is shown in inRBS-5, inRBS-24, inRBS-31, inRBS-42, and inRBS-52, which represent the termination efficiencies of each terminator after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry in plasmid pBp43-GFP-ins-mcherry, respectively.

[0022] Figure 6: Termination efficiency of terminator is used to characterize the expression level of reporter genes, where M: protein molecular weight standard; inRBS-0: no terminator is added; inRBS-5, inRBS-24, inRBS-31, inRBS-42, and inRBS-52 represent the expression levels of upstream and downstream proteins in different elements after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry in plasmid pBp43-GFP-ins-mcherry, respectively.

[0023] Figure 7 Characterization of GFP fluorescence intensity upstream of terminators, where control represents the reference plasmid, and inRBS-5, inRBS-24, inRBS-31, inRBS-42, and inRBS-52 represent the upstream GFP fluorescence intensity measured after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry in plasmid pBp43-GFP-ins-mcherry, respectively.

[0024] Figure 8 Characterization of downstream mcherry fluorescence intensity of terminators, where control represents the reference plasmid, and inRBS-5, inRBS-24, inRBS-31, inRBS-42, and inRBS-52 represent the downstream mcherry fluorescence intensity measured after inserting terminators T5, T24, T31, T42, and T52 between GFP and mcherry in plasmid pBp43-GFP-ins-mcherry, respectively.

[0025] Figure 9 Terminators are used to characterize the expression level of nattokinase, where M: protein molecular weight standard; NK-0: without terminator; NK-5, NK-24, NK-31, NK-42, and NK-52 represent the expression level of nattokinase upstream of each terminator after adding terminators T5, T24, T31, T42, and T52 to the 3' end of the nattokinase gene, respectively.

[0026] Figure 10 Terminators are used to characterize the expression level of aspartic acid kinase, where M: protein molecular weight standard; AspA-0: without terminator; AspA-5, AspA-24, AspA-31, AspA-42, and AspA-52 represent the expression levels of aspartic acid kinase upstream of each terminator after adding terminators T5, T24, T31, T42, and T52 to the 3' end of the aspartic acid kinase gene, respectively. Detailed Implementation

[0027] The culture media involved in the following examples are as follows:

[0028] Luria-Bertani (LB) liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0. LB solid medium: LB liquid medium with 1.5% agar powder added.

[0029] Terrific-Broth (TB) medium: 12 g / L peptone, 24 g / L yeast extract, 4 g / L NaCl, 17 mM KH2PO4, 72 mM K2HPO4, pH 7.0.

[0030] SPⅠ medium (20mL): 9.8mL SP-A solution, 9.8mL SP-B solution, 200μL 50% glucose solution, 200μL 100×CAYE solution, mix fresh before use.

[0031] SPⅠI medium (6 mL): 5.88 mL SPⅠ medium, 60 μL 50 mM CaCl2 solution, 60 μL 250 mM MgCl2 solution, mix fresh before use.

[0032] SP-A solution: 4 g / L (NH4)2SO4, 28 g / L K2HPO4·3H2O, 12 g / L KH2PO4, 2 g / L sodium citrate dihydrate.

[0033] SP-B solution: 0.4 g / L MgSO4·7H2O.

[0034] 100×CAYE solution: 20 g / L Casamino acid, 100 g / L Yeast Extract.

[0035] 100×EGTA solution: 3.8 g / L ethylene glycol bis(2-aminoethyl ether)tetraacetic acid (EGTA).

[0036] LB liquid medium and LB solid medium containing 1.5% agar were used for cell screening, culture, and characterization. TB medium was used for NK cell secretion expression.

[0037] The Bacillus subtilis 168 transformation method involved in the following examples is as follows:

[0038] A single colony of Bacillus subtilis 168 was inoculated into 2 mL of SP I medium and cultured on a shaker at 37°C for 12-14 h to obtain a seed culture. The seed culture was then inoculated into 5 mL of SP I medium at a rate of 1% (v / v) and cultured on a shaker at 37°C for 4-5 h before OD measurement. 600 When OD 600When the inoculum size is 1.0, the bacterial culture is transferred to 2 mL of SPⅠI medium at an inoculation rate of 1% (v / v) and incubated at 37°C and 200 rpm for 1.5 h. 20 μL of 100×EGTA (ethylene glycol bis(α-aminoethyl ether)tetraacetic acid) solution is added to the tube and cultured at 37°C and 200 rpm for 10 min. Then, 500 μL of the culture is dispensed into each 1.5 mL centrifuge tube. An appropriate amount of plasmid that has been verified to be correct by sequencing is added to the tube, and the mixture is mixed by pipetting and incubated at 37°C and 200 rpm for 2 h. After the culture is completed, 100 μL of the bacterial culture is evenly spread on the corresponding selective plate and incubated overnight at 37°C for 12-14 h.

[0039] The detection methods involved in the following embodiments:

[0040] Detection of green fluorescent protein (GFP) fluorescence:

[0041] Centrifuge the test sample at 12000 rpm for 5 min, collect the bacterial cells, wash three times with PBS buffer, and finally resuspend the bacterial culture with an equal volume of PBS buffer. Transfer 200 μL to a 96-well microplate and place it in a Synergy™ H4 fluorescence microplate reader for fluorescence detection. The program settings are: detect bacterial concentration at 600 nm; excitation light 495 nm, emission light 525 nm, gain 60, and detect fluorescence intensity.

[0042] Red fluorescent protein mCherry fluorescence detection:

[0043] For red fluorescent protein (mcherry) fluorescence detection, the sample was centrifuged at 12,000 rpm for 5 min, and the bacterial cells were collected. The cells were washed three times with PBS buffer, and an equal volume of PBS was used to suspend the cells. 200 μL of the suspension was transferred to a 96-well microplate and placed in a Synergy™ H4 fluorescence microplate reader for fluorescence detection. The program was set as follows: bacterial concentration was detected at 600 nm; excitation light was 587 nm, emission light was 610 nm, gain was 80, and fluorescence intensity was detected.

[0044] Methods for determining termination efficiency:

[0045] Here we use termination efficiency (TE) to quantify the proportion of transcription elongation complex that fails to pass through the terminator element. A TE value of 100 is assigned to a terminator element that disrupts all arriving transcription complexes. The TE for the spacer sequence between GFP and mcherry is 0. Because the protein level of the expressed fluorescent reporter gene cannot be directly used to measure the TE value, we use downstream mcherry (FI... DW ) and upstream GFP(FI UP The terminator readability (TR) is estimated by the fluorescence ratio of the fluorescence spectra. That is, TR = FI DW / FI UPA reference readability (TR) was established using standardized test sequences (i.e., the spacer sequences for GFP and mcherry). REF Then, all TR measurements are standardized: TR NORM =TR / TR REF The termination efficiency is estimated as follows: TE = 100 * (1 - TR) NORM ).

[0046] SDS-PAGE detection method:

[0047] Streak the preserved glycerol bacteria onto TB agar plates and incubate overnight at 37°C. Then, pick single colonies and transfer them to test tubes, incubating at 37°C for 8-10 hours. Calculate the cell density according to the initial OD value. 600 =0.05 was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of TB medium and incubated at 37 °C and 200 r / min for 24 h.

[0048] SDS-PAGE assay of nattokinase:

[0049] Take 1 mL of fermentation broth, centrifuge at 12000 r / min for 2 min, take 200 μL of supernatant, then add 50 μL of 5× Loading buffer, boil in water for 10 min, and then load the sample for detection.

[0050] SDS-PAGE assay of aspartate lyase:

[0051] Take 1 mL of culture medium, centrifuge at 12000 rpm for 2 min to collect bacterial cells, wash three times with 1×PBS buffer, then resuspend in TE buffer containing 1 mg / mL lysozyme, and incubate at 37℃ for 2 h. Sonicate the suspension for 3 s with 2 s intervals until clear and transparent. Centrifuge at 2000 rpm for 20 min, collect 200 μL of supernatant, add 50 μL of 5× Loading buffer, incubate in boiling water for 10 min, and then load for analysis.

[0052] Example 1: Construction of Termination Plasmid and Recombinant Expression of Fluorescent Protein

[0053] The specific steps are as follows:

[0054] (1) Using the pBp43-GFP-mcherry (G-mch) plasmid as a template (the construction method is disclosed in the patent application text with publication number CN111662906A), the whole plasmid PCR was performed using the primer insulator-F / R synthesized by the company. A spacer sequence (the sequence is: AATTACAACTGATTCTGAATTCAAAAAATATCATTTGTGATTTGTTTAAAGAAAACGATTTAAAAATTTAAAA) was inserted between the gfp and mcherry genes. The whole plasmid PCR was performed using the primer insulator-F / R to obtain the reference plasmid for determining the termination efficiency of the new terminator - pBp43-GFP-inRBS-mcherry (abbreviated as inRBS).

[0055] (2) The synthesized primer sequences with restriction sites were ligated into double strands by temperature gradient annealing. Then, the annealed DNA double strand sequence was ligated with the fragment obtained from BamHI and SacII digestion of the reference plasmid pBp43-GFP-inRBS-mcherry using T4 ligase to construct plasmids carrying terminators T5, T24, T31, T42, or T52 (see Table 2). DNA sequencing showed that the terminators were successfully ligated to the restriction sites between GFP and mcherry in plasmids pBp43-GFP-mcherry and pBp43-GFP-inRBS-mcherry, confirming the successful construction of a new *E. coli*-*Bacillus subtilis* shuttle vector. Recombinant plasmids pBp43-GFP-T5-mcherry and pBp43-GFP-T24 were obtained. -mcherry, pBp43-GFP-T31-mcherry, pBp43-GFP-T42-mcherry, pBp43-GFP-T52-mcherry; pBp43-GFP-T5-inRBS-mcherry, pBp43 -GFP-T24-inRBS-mcherry, pBp43-GFP-T31-inRBS-mcherry, pBp43-GFP-T42-inRBS-mcherry, pBp43-GFP-T52-inRBS-mcherry.

[0056] (3) The recombinant plasmid obtained after sequencing verification was transferred into Bacillus subtilis 168 and cultured at 37℃ for 12-14 h. Then, a single colony was picked and cultured in 5 mL of LB seed medium at 37℃. The colony was then transferred to a 250 mL Erlenmeyer flask containing 50 mL of LB medium at a final OD600 of 0.05 and cultured at 200 r / min and 37℃ for 24 h.

[0057] The termination efficiency of the screened terminators was measured in the G-mch platform for measuring termination efficiency. Figure 1 (and Table 3), SDS-PAGE protein gel detection ( Figure 2 ) and fluorescence intensity ( Figure 3 , Figure 4 Tables 4 and 5 show that there are differences in GFP and mcherry expression levels among different terminators, indicating that different terminators have different characteristics. The termination efficiency of terminators T42, T52, T5, T24, and T31 gradually increases. Among them, the addition of terminator T31 increases upstream GFP expression by 1.98 times and decreases downstream mcherry expression by 33.9 times compared with the absence of terminator.

[0058] In the termination efficiency measurement platform inRBS, the termination efficiency of the screened terminators was measured. Figure 5 (and Table 6), SDS-PAGE protein gel detection ( Figure 6 ) and fluorescence intensity ( Figure 7 , Figure 8 (Tables 7 and 8) are consistent with the results detected on the G-mch platform: With the addition of the T31 terminator, upstream GFP expression increased by 3-fold compared to without the terminator, while downstream mcherry expression decreased by 50-fold. Compared to the control, with the increase in terminator termination efficiency, downstream mcherry protein expression also decreased, consistent with the fluorescence assay values.

[0059] This experiment demonstrates that the five terminators have strong compatibility.

[0060] Table 1 Primer Table

[0061]

[0062]

[0063] Table 2 Termination Subsequences

[0064]

[0065] Table 3 Termination efficiency of the terminator (G-mch)

[0066] Termination Subname Termination efficiency (TE) T5 85.09 T24 90.90 T31 98.42 T42 43.33 T52 58.07

[0067] Table 4. GFP fluorescence intensity upstream of the terminator (G-mch)

[0068] Termination Subname <![CDATA[Upstream GFP fluorescence intensity (FT GFP / OD 600 )]]> Control (G-mch) 10225 T5 18047 T24 19032 T31 20214 T42 13400 T52 17193

[0069] Table 5. Downstream mcherry fluorescence intensity (G-mch) of the terminator

[0070]

[0071]

[0072] Table 6 Termination efficiency of the terminator (in RBS)

[0073] Termination Subname Termination efficiency (TE) T5 88.87 T24 92.46 T31 99.34 T42 48.71 T52 72.69

[0074] Table 7. GFP fluorescence intensity upstream of the terminator (in RBS)

[0075] Termination Subname <![CDATA[Upstream GFP fluorescence intensity (FT GFP / OD 600 )]]> Comparison (in RBS) 6533 T5 14350 T24 15294 T31 19658 T42 9346 T52 11643

[0076] Table 8. Downstream mcherry fluorescence intensity (in RBS) of the terminator

[0077] Termination Subname <![CDATA[Downstream mcherry fluorescence intensity (FT mcherry / OD 600 )]]> Comparison (in RBS) 14621 T5 3943 T24 2600 T31 292 T42 10770 T52 6988

[0078] Example 2: Construction of a recombinant expression system for nattokinase protein using terminators

[0079] (1) Primer sequences synthesized by the company (see Table 9).

[0080] (2) Construction of the nattokinase protein recombinant expression system: Using PBP43-GFP-mcherry as a template and primer temp-NK-F / R, the backbone was obtained by PCR amplification; using pBS04-pro-NK as a template and NK-F / R as primer, the PUT fragment was obtained by PCR amplification; the NK fragment and the backbone were assembled into two fragments (infusion assembly), and then transformed into JM109. Finally, a new plasmid was obtained and DNA sequencing was performed. The DNA sequencing results showed that the plasmid PBP43-NK-0term (without the terminator of this invention) was successfully obtained, and the new Escherichia coli-Bacillus subtilis shuttle vector was successfully constructed.

[0081] (3) Using PBP43-NK-0term as a template, primers with different terminators were used (see Table 1). Plasmids were obtained by whole plasmid PCR and DNA sequencing was performed. The DNA sequencing results showed that plasmids PBP43-NK-5term, PBP43-NK-24term, PBP43-NK-31term, PBP43-NK-42term, and PBP43-NK-52term were successfully obtained.

[0082] (4) The recombinant plasmid obtained after sequencing verification was transformed into Bacillus subtilis 168. After static culture at 37℃ for 12-14 h, a single colony was picked and cultured in 5 mL of TB seed medium at 37℃. The culture was carried out according to the initial cell density OD. 600 =0.05 Transfer to a 250mL Erlenmeyer flask containing 50mL TB medium, incubate at 200r / min and 37℃ for 24h.

[0083] (5) Take the supernatant of the fermentation broth and verify its expression level by SDS-PAGE (see [link]). Figure 9 The addition of terminators NK-24 and NK-42 slightly increased expression levels compared to the absence of terminators.

[0084] Table 9 Termination Primer List

[0085]

[0086] Example 3: Construction of an aspartate recombinant expression system using terminators

[0087] (1) Primer sequences synthesized by the company (see Table 9).

[0088] (2) Construction of the aspartic acid recombinant expression system: Using PBP43-GFP-mcherry as a template and primers AspA-vF / R, the backbone was obtained by PCR amplification; using pBp43-ECAspA as a template and primers AspA-iF / R, the AspA fragment was obtained by PCR amplification. The AspA fragment and the backbone were assembled in fusion, and then transformed into JM109. Finally, a new plasmid was obtained and DNA sequencing was performed. The DNA sequencing results showed that the plasmid PBP43-AspA-0term (without the terminator of this invention) was successfully obtained, and the new Escherichia coli-Bacillus subtilis shuttle vector was successfully constructed.

[0089] (3) Using PBP43-AspA-0term as a template, plasmids were obtained by full plasmid PCR using primers with different terminators and DNA sequencing was performed. The DNA sequencing results showed that plasmids PBP43-AspA-5term, PBP43-AspA-24term, PBP43-AspA-31term, PBP43-AspA-42term, and PBP43-AspA-52term were successfully obtained.

[0090] (4) The recombinant plasmid obtained after sequencing verification was transformed into Bacillus subtilis 168. After static culture at 37℃ for 12-14 h, a single colony was picked and cultured in 5 mL of TB seed medium at 37℃. The culture was carried out according to the initial cell density OD. 600 =0.05 Transfer to a 250mL Erlenmeyer flask containing 50mL TB medium, incubate at 200r / min and 37℃ for 24h.

[0091] (5) Take a certain amount of fermentation broth and verify its expression level by SDS-PAGE (see Figure 10Compared with AspA-0 without a terminator, the expression levels of AspA-5 and AspA-31 were significantly increased, approximately 2-3 times higher.

[0092] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. An element for regulating gene expression, characterized in that, The element is a T24 terminator, and its nucleotide sequence is shown in SEQ ID NO.

2.

2. Use of the terminator according to claim 1 in the expression of a gene, characterized in that, The terminator is placed downstream of the gene to be expressed, and co-expressed with the gene.

3. Use according to claim 2, wherein the compound is ###0002### The gene is either a gene encoding nattokinase or a gene encoding aspartate lyase.

4. A carrier containing the element of claim 1.

5. Genetically engineered bacteria expressing the vector of claim 4.

6. A method for regulating expression of a protein of interest in Bacillus subtilis, characterized by, The element described in claim 1 is co-expressed with the target protein gene.

7. The method of claim 6, wherein, The Bacillus subtilis strain is Bacillus subtilis 168, Bacillus subtilis WB400, Bacillus subtilis WB600, or Bacillus subtilis WB800.

8. The method of claim 6 or 7, wherein, The target protein is an enzyme.

9. The use of the element of claim 1 or the genetically engineered bacteria of claim 5 in the preparation of the target protein.

10. The application of the element of claim 1 or the genetically engineered bacteria of claim 5 in the food, pharmaceutical or chemical industries.

Images