Transcriptional repressor gene osmax1 and application thereof in rice resistance to brown planthopper

By cloning and overexpressing the transcriptional repressor OsSMAX1 gene, the problem of insufficient resistance to brown planthopper in rice was solved, achieving the goal of increasing and stabilizing rice yield, and providing a solution for insect-resistant gene modification.

CN116286861BActive Publication Date: 2025-11-25WUHAN UNIV +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310118133.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-15
Publication Date
2025-11-25
Estimated Expiration
2043-02-15

Smart Images

  • Figure GHA0000017027600000091
    Figure GHA0000017027600000091
  • Figure HDA0004079290060000011
    Figure HDA0004079290060000011
  • Figure HDA0004079290060000012
    Figure HDA0004079290060000012
Patent Text Reader

Abstract

The application discloses a transcriptional repressor OsSMAX1 gene and application thereof in rice resistance to brown planthopper. The application finds for the first time that the transcriptional repressor OsSMAX1 gene is crucial to the function of the gene Bph9 in resisting the brown planthopper. In the insect-resistant material NIL-Bph9-9311, the OsSMAX1 gene is knocked out by using the CRISPR / Cas9 technology, so that the resistance of the plant to the brown planthopper is significantly reduced. By genetic transformation and crossbreeding, the OsSMAX1 gene is introduced into a rice variety containing the Bph9 and lacking the OsSMAX1 gene, so that the resistance of the rice to the brown planthopper can be significantly improved, the harm caused by the brown planthopper is reduced, and the purposes of yield increase and yield stabilization are achieved. Meanwhile, the OsSMAX1 is a strigolactone and Karrikin signal pathway gene, which provides a theoretical basis for the above signal pathway to participate in the regulation of insect resistance, and has a reference significance for the research on gene molecular functions and breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant genetic engineering, and particularly relates to a transcriptional repressor gene OsSMAX1 and its application in brown planthopper resistance of rice. BACKGROUND

[0002] Rice is one of the most important food crops in China, and the brown planthopper is a monophagous pest of rice, which feeds on the phloem of rice. Mild damage of the brown planthopper leads to reduced growth vigor and yield of rice, and severe damage can cause the death of the whole rice plant, and even no harvest. Therefore, curbing the development and damage of the brown planthopper is a major requirement for ensuring the safety of rice production.

[0003] Traditional control of the brown planthopper relies heavily on chemical pesticides. The overuse of chemical insecticides has led to a significant increase in the resistance of the brown planthopper, making the effect of pesticide control gradually decline. The use of insecticides has also eliminated the natural enemies of the brown planthopper in rice fields, making the control more difficult. It has been proven that the foundation of integrated management and sustainable control of crop diseases and pests is resistant varieties. Utilizing the crop's own disease and pest resistance genes to improve and breed new crop varieties is the most economical and environmentally friendly measure for disease and pest control, and is also the only way for green development of future agriculture (Deng et al 2021).

[0004] At present, more than 40 genes resistant to the brown planthopper have been identified from cultivated rice and wild rice resources, and 16 of them have been cloned by map-based cloning (Du et al 2020). For example, Bph14 is the first example of a rice insect-resistant gene isolated by map-based cloning (Du et al 2009), and Bph9 is a rice gene resistant to the brown planthopper isolated by map-based cloning in recent years (Zhao et al 2016). The steps of map-based cloning include genetic mapping, physical mapping, sequence analysis, and genetic transformation to verify the function.

[0005] Strigolactone (SL) is a new type of plant hormone, which can inhibit plant branching, promote the branching of mycorrhizal fungal hyphae, promote the germination of parasitic weed seeds such as striga, and so on. Karrikin (KAR) is a small molecule in the smoke formed by the combustion of plants, which can regulate seed germination, seedling development, root morphology and other plant growth and development processes. OsSMAX1 can form a complex with transcriptional repressor TPRs to inhibit the expression of downstream target genes of KAR signaling pathway. When KAR signal is sensed by receptor protein D14L, OsSMAX1 is induced to be ubiquitinated by D3, and then degraded by 26S proteasome, thereby relieving the inhibition of transcriptional co-repressor TPRs on the expression of downstream target genes, promoting the synthesis of strigolactone, and regulating the development of rice mesocotyl and the symbiosis of arbuscular mycorrhizae (Choi et al 2020; Zheng et al 2020). However, the function of OsSMAX1 in rice resistance to brown planthopper is still unclear. SUMMARY

[0006] The purpose of the present application is to provide a transcriptional repressor OsSMAX1 gene and its application in rice resistance to brown planthopper.

[0007] The present application constructs a near-isogenic line NIL-Bph9-9311 containing Bph9 resistant gene to brown planthopper with indica rice 9311 as genetic background by molecular marker assisted selection, and a near-isogenic line NIL-Bph9-Nip containing Bph9 resistant gene with japonica rice Nipponbare as genetic background. The identification of resistance to brown planthopper shows that NIL-Bph9-9311 shows resistance to brown planthopper, while NIL-Bph9-Nip shows susceptibility to brown planthopper. It is shown that there is a gene in NIL-Bph9-9311 that determines the function of Bph9 resistance to brown planthopper, and this gene is absent in NIL-Bph9-Nip. This gene is temporarily named DE9 (Dominant Epistatic gene of Bph9).

[0008] Further, a segregation population of NIL-Bph9-9311 and NIL-Bph9-Nip is constructed by genetic method, and DE9 gene determining the function of Bph9 resistance to brown planthopper is cloned by map-based cloning method, and it is found that DE9 gene is transcriptional repressor OsSMAX1 gene. By genetically transforming OsSMAX1 gene, the susceptible rice NIL-Bph9-Nip shows resistance to brown planthopper, which confirms that OsSMAX1 gene plays a role in the function of Bph9 resistance to brown planthopper.

[0009] In order to achieve the purpose of the present application, in the first aspect, the present application provides a transcriptional repressor OsSMAX1 gene, which is a gene encoding the following protein (a) or (b):

[0010] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 3;

[0011] (b) a protein derived from (a) in which the sequence shown in SEQ ID NO: 3 is substituted, deleted or added by one or more amino acids and which has equivalent function.

[0012] The nucleotide sequence of the OsSMAXl gene is:

[0013] i) the nucleotide sequence shown in SEQ ID NO: 1;

[0014] ii) a nucleotide sequence which is substituted, deleted and / or increased by one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 1 and which expresses the same functional protein;

[0015] iii) a nucleotide sequence which hybridizes to the sequence shown in SEQ ID NO: 1 under stringent conditions, which are hybridization in 0.1 x SSPE or 0.1 x SSC containing 0.1% SDS at 65°C, and washing the membrane with the same solution, and which expresses the same functional protein; or

[0016] iv) a nucleotide sequence which has more than 90% homology to the nucleotide sequence of i), ii) or iii) and which expresses the same functional protein.

[0017] The cDNA sequence of which is:

[0018] i') the nucleotide sequence shown in SEQ ID NO: 2;

[0019] ii') a nucleotide sequence which is substituted, deleted and / or increased by one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 2 and which expresses the same functional protein;

[0020] iii') a nucleotide sequence which hybridizes to the sequence shown in SEQ ID NO: 2 under stringent conditions, which are hybridization in 0.1 x SSPE or 0.1 x SSC containing 0.1% SDS at 65°C, and washing the membrane with the same solution, and which expresses the same functional protein; or

[0021] iv') a nucleotide sequence which has more than 90% homology to the nucleotide sequence of i'), ii') or iii') and which expresses the same functional protein.

[0022] In a second aspect, the present application provides a biological material containing the OsSMAXl gene, which includes but is not limited to a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector or an engineered bacterium.

[0023] In a third aspect, the present application provides any one of the following applications of the OsSMAX1 gene or the biological material containing the OsSMAX1 gene:

[0024] (1) for rice resistance to brown planthopper;

[0025] (2) for plant variety improvement;

[0026] (3) for preparing transgenic plants.

[0027] Preferably, the plant is a plant of the family Poaceae, more preferably rice.

[0028] In a fourth aspect, the present application provides the application of the OsSMAX1 gene or the biological material containing the OsSMAX1 gene in breeding rice varieties with resistance to brown planthopper in cooperation with the brown planthopper resistance gene Bph9.

[0029] In a fifth aspect, the present application provides a method for improving the resistance of a plant to brown planthopper, which utilizes genetic engineering means to overexpress the OsSMAX1 gene in a plant containing the brown planthopper resistance gene Bph9 (GenBank: KU216221.1) of rice.

[0030] The overexpression method can be selected from the following 1) to 5), or an optional combination:

[0031] 1) by introducing a plasmid containing the gene;

[0032] 2) by increasing the copy number of the gene on the plant chromosome;

[0033] 3) by changing the promoter sequence of the gene on the plant chromosome;

[0034] 4) by operably linking a strong promoter to the gene;

[0035] 5) by introducing an enhancer.

[0036] Preferably, the plant is a plant of the family Poaceae, more preferably rice.

[0037] The expression vector carrying the target gene can be introduced into plant cells by using conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology, 2 ndEdition).

[0038] In a sixth aspect, the present application provides the use of the transgenic plant obtained according to the method in plant breeding.

[0039] Further, the breeding method includes, but is not limited to, transgenesis, crossing, backcrossing, selfing or vegetative propagation.

[0040] In a sixth aspect, the present application provides molecular markers closely linked to the OsSMAX1 gene, including InDel molecular markers 8D2-23 and 8D2-27, and primers for amplifying the markers 8D2-23 and 8D2-27 are shown in SEQ ID NO: 4-5 and SEQ ID NO: 6-7, respectively.

[0041] In a seventh aspect, the present application provides detection reagents or kits containing the above-mentioned primers.

[0042] In an eighth aspect, the present application provides any of the following uses of the molecular markers or the detection reagents or kits:

[0043] (1) for breeding brown planthopper-resistant rice varieties;

[0044] (2) for detecting the presence of the OsSMAX1 gene in rice materials.

[0045] By the above technical solutions, the present application has at least the following advantages and beneficial effects:

[0046] (I) The present application first discovers that the OsSMAX1 gene plays a role in the exertion of the Bph9 brown planthopper resistance function. Knocking out the OsSMAX1 gene in the NIL-Bph9-9311 insect-resistant material using the CRISPR / Cas9 technology leads to a significant down-regulation of the plant resistance to the brown planthopper. By genetic transformation and crossing, introducing the OsSMAX1 gene into a rice variety containing Bph9 and lacking the OsSMAX1 gene can significantly improve the resistance of the rice to the brown planthopper, thereby reducing the damage caused by the brown planthopper and achieving the purpose of increasing and stabilizing the yield.

[0047] (II) The cloned OsSMAX1 gene of the present application can be used in the breeding of rice varieties with brown planthopper resistance in cooperation with the Bph9 brown planthopper resistance gene, which has important significance for the improvement of rice varieties.

[0048] (III) The present application discloses that the OsSMAX1 gene is involved in the brown planthopper resistance of rice, which has certain reference value for in-depth study of the involvement of strigolactone and Karrikin signaling pathways in the regulation mechanism of insect resistance, and has reference significance for the study of gene molecular functions and breeding.

[0049] (Four) The successful cloning of the OsSMAX1 gene further proves the reliability of the map-based cloning method for cloning important genes in rice, and the cloned gene has clear function and good effect. BRIEF DESCRIPTION OF DRAWINGS

[0050] Figure 1 Figure 1 is a fine mapping result of the DE9 (OsSMAX1) gene in the preferred embodiment of the present application.

[0051] Figure 2 Figure 2 is a rice variety with DE9 (OsSMAX1) gene and resistance to brown planthopper bred by marker-assisted selection in the preferred embodiment of the present application.

[0052] Figure 3 Figure 3 is the identification result of the transgenic plant of the OsSMAX1 genomic complementation vector against brown planthopper in the preferred embodiment of the present application.

[0053] Figure 4 Figure 4 is the identification result of the OsSMAX1 gene knockout plant in the NIL-Bph9-9311 background against brown planthopper in the preferred embodiment of the present application. DETAILED DESCRIPTION

[0054] The present application provides a transcriptional repressor OsSMAX1 gene and its application in rice resistance to brown planthopper.

[0055] The present application provides a transcriptional repressor OsSMAX1 gene, and the nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0056] Further, the full length of the cDNA of the gene is 3385bp, and the cDNA sequence is shown in SEQ ID NO:2.

[0057] The present application also provides a protein encoded by the gene, and the amino acid sequence of the protein is shown in SEQ ID NO:3.

[0058] It should be understood that one or more amino acids can be substituted, added and / or deleted from the amino acid sequence shown in SEQ ID NO: 3 by those skilled in the art without affecting the activity of the OsSMAX1 protein (i.e. not in the active center of the protein), to obtain an amino acid sequence with equivalent function.

[0059] In addition, considering the degeneracy of codons, for example, the polynucleotide sequence encoding the above-mentioned protein can be modified in its coding region without changing the amino acid sequence, or in its non-coding region without affecting protein expression. Therefore, the present application also comprises one or more nucleotides substituted, added and / or deleted from the polynucleotide sequence encoding the above-mentioned protein, with the same function as the above-mentioned nucleotide sequence encoding the protein.

[0060] The present application also provides the use of the gene in the breeding of rice to improve the resistance of rice to the brown planthopper.

[0061] The present application also provides molecular markers 8D2-23 and 8D2-27 tightly linked to the OsSMAX1 gene, and their use in breeding brown planthopper-resistant rice varieties. The primer sequences for amplifying the molecular markers are as follows (SEQ ID NO: 4-7):

[0062] Forward primer: 8D2-23-F: TACCAATTTCGACCGCCAAC (5'-3')

[0063] Reverse primer: 8D2-23-R: TGTGTTTCTTTGCATGCCGA (5'-3').

[0064] Forward primer: 8D2-27-F: ATATACCGCGTTTGGGCAAC (5'-3')

[0065] Reverse primer: 8D2-27-R: TCTTCTTCCGAGAACCACCT (5'-3').

[0066] Those skilled in the art should understand that the molecular markers designed or produced according to the sequences disclosed in the present application can be used to detect the presence of the OsSMAX1 gene in rice varieties, and applied to the breeding of brown planthopper-resistant rice.

[0067] The present application cloned the transcriptional repressor OsSMAX1 gene by the following steps:

[0068] 1. Fine mapping of OsSMAX1 gene. NIL-Bph9-9311 is resistant to BPH, and NIL-Bph9-Nip is susceptible to BPH. NIL-Bph9-9311 / NIL-Bph9-Nip F1 is backcrossed with NIL-Bph9-Nip as the recurrent parent. The resistant BC1F1 is backcrossed with NIL-Bph9-Nip again. Through the above successive backcrossing, BPH-resistant phenotype identification and genetic background detection strategy, it is found that the gene locus DE9 (Dominant Epistatic gene of Bph9) determining the function of Bph9 resistance to BPH is located on chromosome 8.

[0069] According to the rice genome sequence published by the International Rice Genome Project, InDel marker primers of the target segment of chromosome 8 are designed. The markers are detected in the BC3F2 large population by PCR and agarose gel electrophoresis method. The relationship between the phenotype and genotype of the recombinant single plant obtained by screening is used to fine map the gene locus DE9 determining the function of Bph9 resistance to BPH between InDel markers 8D2-22 and 8D2-31, and tightly linked to 8D2-23 and 8D2-27. By screening the Fosmid genomic library of NIL-Bph9-9311, Fosmid clone 7B8 covering the fine mapping interval of the candidate gene is obtained. The sequencing results show that the gene locus DE9 determining the function of Bph9 resistance to BPH is fine mapped in a 20 kb interval, which contains only one candidate gene OsSMAX1.

[0070] 2. Full-length cDNA cloning of OsSMAX1 gene. Primers are designed according to the predicted cDNA sequence of OsSMAX1 gene, and a 1500 bp fragment is amplified from the cDNA of BPH-resistant rice. Primers are designed based on this sequence, and the 3' and 5' end sequences of the cDNA are obtained by RACE (rapid amplification of cDNA ends), and finally the full-length cDNA of OsSMAX1 gene is obtained.

[0071] Those skilled in the art should understand that according to the nucleotide sequence of OsSMAX1 gene disclosed in the present application, OsSMAX1 gene can be amplified from the genome of BPH-resistant rice by designing appropriate PCR primers.

[0072] 3. Genetic transformation of OsSMAX1 gene to verify its function. The fragment containing the complete OsSMAX1 genomic sequence was excised from the Fosmid clone 7B8 and ligated into the pCAMBIA1301 vector. After sequencing verification, the resulting vector was the OsSMAX1 genomic complementation vector. It was introduced into the NIL-Bph9-9311, and finally 25 transgenic positive plants of the OsSMAX1 genomic complementation vector were obtained. The T1 generation plants were used for resistance identification. The seedling group method was used for identification. The control rice NIL-Bph9-Nip was all dead, and the OsSMAX1 genomic complementation vector transgenic positive plants survived normally.

[0073] At the same time, the CRISPR / Cas9 vector of OsSMAX1 gene was constructed, and the NIL-Bph9-9311 was transformed to obtain 13 transgenic plants of OsSMAX1 CRISPR / Cas9 vector. The T2 generation of OsSMAX1 gene homozygous knockout transgenic plants were identified for resistance to insects, and it was found that the resistance of OsSMAX1 gene knockout plants to brown planthopper was significantly down-regulated.

[0074] The following examples are used to illustrate the present application, but not to limit the scope of the present application. If not specifically indicated, the examples are all according to the conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or according to the conditions recommended by the manufacturer's instructions. Example 1 Fine mapping and cloning of the DE9 (OsSMAX1) gene of the dominant epistatic gene Bph9

[0075] 1. Fine mapping results of DE9 (OsSMAX1)

[0076] The present application constructs the near-isogenic line NIL-Bph9-9311 containing the Bph9 gene for resistance to brown planthopper with the genetic background of indica rice 9311, and the near-isogenic line NIL-Bph9-Nip containing the Bph9 gene with the genetic background of japonica rice Nipponbare by molecular marker assisted selection. The resistance to brown planthopper identification shows that NIL-Bph9-9311 shows resistance to brown planthopper, while NIL-Bph9-Nip shows susceptibility to brown planthopper. It is shown that there is a gene in NIL-Bph9-9311 that determines the function of Bph9 resistance to brown planthopper, and this gene is missing in NIL-Bph9-Nip. This gene is temporarily named DE9 (Dominant Epistatic gene of Bph9).

[0077] By crossing the insect-resistant NIL-Bph9-9311 with the insect-susceptible NIL-Bph9-Nip, the NIL-Bph9-9311 / NIL-Bph9-Nip F1 is backcrossed with the NIL-Bph9-Nip as a recurrent parent, the BC1F1 material is identified for resistance to the brown planthopper, and the BC1F1 resistant to the brown planthopper is backcrossed with the NIL-Bph9-Nip again. Through the above continuous backcrossing, the phenotype identification of the brown planthopper resistance, and the detection strategy of the genetic background, it is found that the gene locus DE9 determining the function of Bph9 to resist the brown planthopper is located on the 8th chromosome.

[0078] Using the markers R8M12 and R8M17 at the ends of the positioning interval, 1188 single plants are screened, and a total of 87 recombinant single plants are obtained. According to the comparison of the sequences of O. sativa 9311 and Nipponbare published on the Gramene website (http: / / www.gramene.org / ), InDel with polymorphic differences in the positioning interval is screened, and primers are designed according to the flanking sequences of the InDel. The recombinant single plants are further screened by molecular markers, and the group method is used to identify the phenotype of the recombinant single plants. According to the genotype and phenotype of the recombinant single plants, DE9 is finally located in the interval of 140 kb between InDel markers 8D2-21 and 8D2-33. Further, 5970 materials are screened by using InDel markers 8D2-21 and 8D2-33, the recombinant single plants are used for molecular marker encryption in the positioning interval, and the recombinant single plants are used for phenotype analysis of the brown planthopper resistance. DE9 is finely located between InDel markers 8D2-22 and 8D2-31, and is closely linked to InDel markers 8D2-23 and 8D2-27 (in the same Fosmid, about 40 kb in length).

[0079] Forward primer: 8D2-23-F: TACCAATTTCGACCGCCAAC (5'-3');

[0080] Reverse primer: 8D2-23-R: TGTGTTTCTTTGCATGCCGA (5'-3').

[0081] Forward primer: 8D2-27-F: ATATACCGCGTTTGGGCAAC (5'-3');

[0082] Reverse primer: 8D2-27-R: TCTTCTTCCGAGAACCACCT (5'-3').

[0083] A Fosmid clone 7B8 covering the fine mapping interval of DE9 was obtained by screening the Fosmid genomic library of NIL-Bph9-9311. The sequencing result showed that DE9 fine mapping was in a 20 kb interval, only containing one candidate gene, which was a transcriptional repressor OsSMAX1 Figure 1

[0084] 2. RACE to obtain the full-length cDNA of OsSMAX1

[0085] A cDNA sequence of the candidate gene was amplified using the total RNA reverse transcription product of NIL-Bph9-9311 leaf sheath as template and primers designed according to the prediction result of OsSMAX1 gene. The 5' end and 3' end sequences of OsSMAX1 gene were obtained using the 5' and 3' Full RACE kit of Takara Company by designing primers from the sequence, the transcription start site and termination site of OsSMAX1 were determined, and the full-length cDNA sequence of OsSMAX1 was obtained, the nucleotide sequence of which is shown as SEQ ID NO: 2.

[0086] Example 2: Molecular marker assisted selection of brown planthopper resistant rice carrying DE9 (OsSMAX1) gene

[0087] In this example, a brown planthopper resistant japonica rice variety NIL-DE9 (OsSMAX1)-Bph9-Nip (near-isogenic line with genetic background of Nip containing Bph9 and DE9 (OsSMAX1) genes) carrying DE9 (OsSMAX1) gene was bred by molecular marker assisted selection using molecular markers, and the specific method is as follows:

[0088] ​NIL-Bph9-9311 / NIL-Bph9-Nip F1 is backcrossed with NIL-Bph9-Nip as the recurrent parent, and the NIL-Bph9-9311 / NIL-Bph9-Nip F1 is identified for resistance to brown planthopper from the BC1F1 material, and the BC1F1 resistant to brown planthopper is backcrossed with NIL-Bph9-Nip again. The DE9 (OsSMAX1) gene-containing BC2F1 is screened out by using the closely linked InDel markers 8D2-23 and 8D2-27, and backcrossed with NIL-Bph9-Nip to obtain BC3F1; the DE9 (OsSMAX1) gene-containing BC3F1 is screened out by using the molecular markers 8D2-23 and 8D2-27 linked to the DE9 (OsSMAX1) gene, and backcrossed with NIL-Bph9-Nip to obtain BC4F1; the DE9 (OsSMAX1) gene-containing BC4F1 is screened out by using the molecular markers 8D2-23 and 8D2-27 linked to the DE9 (OsSMAX1) gene, and backcrossed with NIL-Bph9-Nip to obtain BC5F1; the DE9 (OsSMAX1) gene-containing BC5F1 is screened out by using the molecular markers 8D2-23 and 8D2-27 linked to the DE9 (OsSMAX1) gene, and backcrossed with NIL-Bph9-Nip to obtain BC6F1; the material with no difference in agronomic traits from Nipponbare is selected for generation propagation to obtain BC6F2; and the DE9 (OsSMAX1) gene site homozygous BC6F2 is screened out by using the molecular markers 8D2-23 and 8D2-27 linked to the DE9 (OsSMAX1) gene, and generation propagation is carried out, and the material has no difference in agronomic trait phenotype from Nipponbare, but it contains the DE9 (OsSMAX1) gene, and is named as NIL-DE9 (OsSMAX1) -Bph9-Nip (Nipponbare genetic background containing Bph9 and DE9 (OsSMAX1) gene near-isogenic line). The seedling group method is used for identification by using the Wuhan field brown planthopper population, and the results show that 4 days after the insects are released, the control susceptible TN1 and NIL-Bph9-Nip die obviously, but the NIL-DE9 (OsSMAX1) -Bph9-Nip still survives, and the plant grows healthily Figure 2)。From the figure, it can be seen that 4 days after the brown planthopper was identified in the seedling stage, TN1 was the control susceptible variety Taichung local No. 1, which showed susceptibility to brown planthopper; NIL-Bph9-9311, a near-isogenic line containing Bph9 in the genetic background of 9311, showed resistance to brown planthopper; NIL-Bph9-Nip, a near-isogenic line containing Bph9 in the genetic background of Nipponbare, showed susceptibility to brown planthopper; and NIL-DE9 (OsSMAX1)-Bph9-Nip, a near-isogenic line containing Bph9 and DE9 (OsSMAX1) genes in the genetic background of Nipponbare bred by molecular marker-assisted selection, showed resistance to brown planthopper.

[0089] It can be confirmed that the DE9 (OsSMAX1) gene can be used to breed brown planthopper-resistant rice varieties in cooperation with the brown planthopper-resistant gene Bph9.

[0090] Example 3 Functional verification and application of OsSMAX1 gene

[0091] 1. Construction of genetic transformation vector

[0092] (1) Construction of OsSMAX1 genomic complementation vector. The vector used is pCAMBIA1301 vector. By analyzing the sequence information of Fosmid plasmid 7B8 containing the OsSMAX1 gene, it is found that a 9124 bp fragment containing the complete OsSMAX1 genomic sequence can be obtained by XbaI digestion. The fragment is cut from the Fosmid plasmid 7B8 and connected to the XbaI site of the pCAMBIA1301 vector. After sequencing verification, the OsSMAX1 genomic complementation vector is constructed.

[0093] (2) Construction of OsSMAX1 gene CRISPR / Cas9 vector.

[0094] The pYLCRISPR / Cas9 multi-target vector (Ma et al 2015) constructed by the academician Liu Yaoguang's research group of South China Agricultural University is used to construct the CRISPR / Cas9 knockout vector of the OsSMAX1 gene. According to the CDS sequence of the OsSMAX1 gene, the online software CRISPR-GE (http: / / skl.scau.edu.cn / home / ) is used for knockout site analysis. The specific target sequence (5'-GGCTGGCAGGAGGGCTCTTACGG-3') of the OsSMAX1 gene is selected, and primers are designed to amplify sgRNA and U6a promoter, respectively. The primer sequences are as follows:

[0095] gRT-OsSMAX1: GCTGGCAGGAGGGCTCTTAgttttagagctagaaat (5'-3')

[0096] OsU6a-OsSMAXl: TAAGAGCCCTCCTGCCAGCCggcagccaagccagca (5'-3')

[0097] The sgRNA with target fragment and U6a fragment were amplified together by the method of overlap PCR, and the fragments at both ends could be reverse complementary pairing. The recovered fragment was sgRNA expression cassette. The sgRNA expression cassette was connected into pYLCRISPR / Cas9 plasmid according to the connection system in Table 1.

[0098] Table 1

[0099]

[0100] The enzyme digestion and connection were performed by temperature cycling for about 10-15 cycles (37°C 5 min; 10°C 5 min, 20°C 5 min), and the product was directly transformed. The plasmid of the positive clone with correct sequencing was extracted and used for subsequent genetic transformation experiments.

[0101] 2. Genetic transformation

[0102] The OsSMAXl genomic complementation vector was introduced into NIL-Bph9-Nip by Agrobacterium-mediated genetic transformation method, and the OsSMAXl gene CRISPR / Cas9 vector was introduced into NIL-Bph9-9311.

[0103] 3. OsSMAXl gene transgenic function verification

[0104] The OsSMAXl genomic complementation vector was introduced into NIL-Bph9-Nip to obtain 25 transgenic positive plants, and after harvesting the seeds, Tl generation transgenic plants were obtained. The positive transgenic lines were identified for resistance to brown planthopper by seedling group method. After 4 days of access to brown planthopper, the susceptible control varieties TN1 and NIL-Bph9-Nip were dead, and the OsSMAXl genomic complementation vector transgenic positive lines of NIL-Bph9-Nip grew healthily without leaf damage, showing strong resistance to brown planthopper Figure 3)。From the figure, the results of the transgenic plants 4 days after releasing the insects; TN1 is the control susceptible variety Taichung Native No. 1, which shows susceptibility to brown planthopper; NIL-DE9 (OsSMAX1)-Bph9-Nip, a near-isogenic line of Nipponbare genetic background containing Bph9 and DE9 (OsSMAX1) genes bred by molecular marker-assisted selection, which shows resistance to brown planthopper; NIL-Bph9-Nip, a near-isogenic line of Nipponbare genetic background containing Bph9, which shows susceptibility to brown planthopper; CLB44-6, CLB43-10 and CLB54-10, T2 generation homozygous lines of NIL-Bph9-Nip background into which the OsSMAX1 genomic complementation vector is transferred, which shows resistance to brown planthopper. The above-mentioned insect resistance identification results show that the OsSMAX1 gene is the favorable dominant epistatic gene DE9 that promotes the function of Bph9 to resist brown planthopper.

[0105] OsSMAX1 CRISPR / Cas9 vector trans-NIL-Bph9-9311 obtained 13 transgenic plants. According to the sequences at both ends of the target, primer pairs were designed to amplify and sequence these transgenic plants to determine the knockout mutation type of the OsSMAX1 gene and whether it is homozygous knockout. For the identified OsSMAX1 gene CRISPR / Cas9 vector trans-NIL-Bph9-9311 transgenic homozygous knockout plants, after harvesting the offspring seeds, the phenotype of resistance to brown planthopper was identified by the seedling group method. After 4 days of access to brown planthoppers, the susceptible control variety TN1 (Taichung Native No. 1) died, and NIL-Bph9-9311 still survived and grew well, showing strong resistance to brown planthoppers. While the OsSMAX1 gene CRISPR / Cas9 vector trans-NIL-Bph9-9311 transgenic homozygous knockout plants showed susceptibility to brown planthoppers and withered and died Figure 4 )。From the figure, the results of the transgenic plants 4 days after releasing the insects; TN1 is the control susceptible variety Taichung Native No. 1, which shows susceptibility to brown planthopper; NIL-Bph9-9311, a near-isogenic line of 9311 genetic background containing Bph9, which shows resistance to brown planthopper; N131-134 and N131-727, NIL-Bph9-9311 background into which the OsSMAX1 CRISPR / Cas9 vector is transferred, which shows susceptibility to brown planthopper. The experimental results also further confirm that the OsSMAX1 gene is the favorable dominant epistatic gene DE9 that promotes the function of Bph9 to resist brown planthopper.

[0106] While the application has been described in detail with particular references to specific embodiments thereof, it will be understood by those skilled in the art that various changes can be made and equivalents can be substituted for elements thereof without departing from the scope of the application. In addition, many modifications can be made to adapt a particular situation or material to the teachings of the application without departing from the central scope thereof. Therefore, it is intended that the application not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this application, but that the application will include all embodiments falling within the scope of the appended claims.

[0107] References:

[0108] 1 Liu WC, Liu ZD, Huang C, Lu MR, Liu J, Yang QP (2016) Statistics and analysis of the occurrence and damage of major crop pests in the past 10 years. Plant Protection 42(5):1-9.

[0109] 2 IRRI (International Rice Research Institute) (2012) Annual report 2011. Los (Bangladesh): International Rice Research Institute.

[0110] 3 Lou YG, Cheng J (2011) Mechanism of rice planthopper catastrophe and basic research for sustainable management. Chinese Journal of Applied Entomology 48:231-238.

[0111] 5 Du B, Chen RZ, Guo JP, He GC (2020) Current understanding of the genomic, genetic, and molecular control of insect resistance in rice. Mol Breeding 40:24.

[0112] 6 Du B, Zhang WL, Liu BF, Hu J, Wei Z, Shi ZY, He RF, Zhu LL, Chen RZ, Han B, He GC (2009) Identification and characterization of Bph14, a gene conferring resistance to brown planthopper in rice. Proc Natl Acad Sci U S A 106:22163-22168.

[0113] 7. Zhao Y, Huang J, Wang ZZ, Jing SL, Wang Y, Ouyang YD, Cai BD, Xin XF, Liu X, Zhang XC, Pan YF, Ma R, Li QF, Jiang WH, Zeng Y, Shangguan XX, Wang HY, Du B, Zhu LL, Xu X, Feng YQ, He SY, Chen RZ, Zhang QF, He GC (2016). Allelic diversity in an NLR gene BPH9 enables rice to combat planthopper variation. Proc Natl Acad Sci U S A 113: 12850-12855.

[0114] 8. Choi J, Lee T, Cho J, Servante EK, Pucker B, Summers W, Bowden S, Rahimi M, An K, An G, Bouwmeester HJ, Wallington EJ, Oldroyd G, Paszkowski U. The negative regulator SMAX1 controls mycorrhizal symbiosis and strigolactone biosynthesis in rice. Nat Commun. 2020 Apr 30; 11(1): 2114. doi: 10.1038 / s41467-020-16021-1. PMID: 32355217; PMCID: PMC7193599.

[0115] 9. Zheng J, Hong K, Zeng L, Wang L, Kang S, Qu M, Dai J, Zou L, Zhu L, Tang Z, Meng X, Wang B, Hu J, Zeng D, Zhao Y, Cui P, Wang Q, Qian Q, Wang Y, Li J, Xiong G. Karrikin Signaling Acts Parallel to and Additively with Strigolactone Signaling to Regulate Rice Mesocotyl Elongation in Darkness. Plant Cell. 2020 Sep;32(9):2780-2805. doi: 10.1105 / tpc.20.00123. Epub 2020 Jul 14. PMID: 32665307; PMCID: PMC7474294.

[0116] 10. Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463.

[0117] 11. Geiserson & Corey, 1998, Plant Molecular Biology, 2nd Edition.

[0118] 12. Sambrook J & Russell DW, 2001, Molecular Cloning: a Laboratory Manual.

[0119] 13. Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant. 2015;8: 1274-1284. doi: 10.1016 / j.molp.2015.04.007.

Claims

1. Any of the following applications of the transcriptional repressor OsSMAX1 gene or biological material containing the gene: (1) for conferring resistance to brown planthopper in rice; (2) for plant variety improvement; (3) for preparing transgenic plants; said transcriptional repressor OsSMAX1 gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID NO: 3: said biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria; said plant is rice.

2. The use of the transcriptional repressor OsSMAX1 gene or biological material containing the gene in breeding rice varieties with resistance to brown planthopper in synergy with the brown planthopper resistance gene Bph9; said transcriptional repressor OsSMAX1 gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID NO: 3: said biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria.

3. A method for improving the resistance of rice to Nilaparvata lugens, characterized by, Overexpression of the transcriptional repressor OsSMAX1 gene in plants containing the brown planthopper resistance gene Bph9 is achieved by genetic engineering; said overexpression is achieved by means selected from 1) to 5) below, or optionally a combination thereof: 1) by introducing a plasmid containing the gene; 2) by increasing the copy number of the gene on the plant chromosome; 3) by changing the promoter sequence of the gene on the plant chromosome; 4) by operably linking a strong promoter to the gene; 5) by introducing an enhancer; said transcriptional repressor OsSMAX1 gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID NO:

3.

4. The use of the transgenic rice obtained by the method of claim 3 in rice breeding.

5. Use according to claim 4, characterized in that, The breeding method comprises transgenesis, hybridization, backcrossing, selfing or vegetative reproduction.