Method and application of an improved group I intron ribozyme sequence for constructing circular RNA

Abstract

The present invention discloses a method and application for constructing circular RNA using an improved type I intronic ribozyme sequence. The present invention provides a type I intronic ribozyme sequence backbone fragment. Based on the type I intronic sequence of Anabaena, the coxsackievirus internal ribosome entry site (CVB3_IRES) sequence is split to mimic the E1 and E2 sequences, resulting in a type I intronic ribozyme sequence backbone fragment with self-splicing properties. This invention, for the first time, utilizes a type I intronic ribozyme sequence based on Anabaena tRNA to creatively propose a model for in vitro synthesis of circRNA that addresses the problem of introducing redundant sequences. This optimizes the sequence design model, simplifies the sequence structure without affecting circularization, and retains key circularization sequences.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method and application of a modified type I intron ribozyme sequence for constructing circular RNA. Background Technology

[0002] Type I intron ribozymes were among the first RNA catalysts discovered. They possess a highly conserved secondary structure and, in the presence of magnesium ions and exogenous guanylic acid, undergo two transesterification reactions leading to intron self-splicing and exon ligation. Numerous researchers have utilized rearranged type I intron ribozyme sequences to synthesize circRNAs. Puttaraju M et al. demonstrated that circRNAs could be synthesized using type I intron ribozyme and exon sequences from *Anabaena* tRNA (Nucleic Acids Res, 1992, 20, 5357–5364). In 2018, Anderson et al. reported in *Nature Communications* the in vitro transcription and circularization of *Anabaena* type I introns into circular RNA, which could efficiently express the corresponding protein. Their working mechanism is as follows: Figure 1 As shown in A. However, the sequence reported by Anderson et al. has an inherent drawback, namely, the introduction of unnecessary redundant sequences ( Figure 1 Sequences such as E2, 5' internal homologous sequence, 5' separator sequence, 3' internal homologous sequence, 3' separator sequence, and E1 in A (also known as "scar" sequences)). Summary of the Invention

[0003] The purpose of this invention is to provide an improved Anabaena type I intron sequence, which uses the split Coxsackievirus internal ribosome entry site (CVB3_IRES) sequence to simulate the E1 and E2 sequences of the Anabaena intron sequence; the improved type I intron sequence can effectively complete the circularization of the target sequence, and there is no residue of the Anabaena exon sequence, and the target sequence can be successfully expressed.

[0004] In a first aspect, the present invention provides a type I intron ribozyme sequence backbone fragment, which is obtained by splitting and optimizing the CVB3_IRES sequence to simulate the E1 and E2 sequences based on the type I intron sequence of Anabaena, thus obtaining a type I intron ribozyme sequence backbone fragment with self-splicing properties.

[0005] The type I intron ribozyme sequence backbone fragments mentioned above include, in sequence: 5' homologous arm, 3' end of the Anabaena T4 intron, CVB3_IRES_1, exogenous gene, CVB3_IRES_2, 5' end and 3' homologous arm of the Anabaena T4 intron;

[0006] The nucleotide sequence of CVB3_IRES_1 is positions 185-934 of sequence 1;

[0007] The nucleotide sequence of CVB3_IRES_2 is positions 1655-1697 of sequence 1.

[0008] In the type I intron ribozyme sequence backbone fragment mentioned above,

[0009] The nucleotide sequence of the 5' homologous arm is positions 24-53 of sequence 1;

[0010] The nucleotide sequence at the 3' end of the intron of Anabaena T4 is positions 54-184 of sequence 1;

[0011] The position of the nucleotide sequence substitution sequence 1 of the exogenous gene, from position 935 to 1654;

[0012] The nucleotide sequence at the 5' end of the intron of Anabaena T4 is positions 1698-1813 of sequence 1;

[0013] The nucleotide sequence of the 3' homologous arm is positions 1814-1848 of sequence 1.

[0014] The type I intron ribozyme sequence backbone fragment described above (denoted as the type I intron ribozyme sequence backbone fragment with transcription promoter) also includes a transcription promoter located upstream of the 5' homologous arm.

[0015] In the type I intron ribozyme sequence backbone fragment mentioned above,

[0016] The transcription promoter is the T7 promoter;

[0017] The nucleotide sequence of the T7 promoter is positions 1-23 of sequence 1.

[0018] Furthermore, in an embodiment of the present invention, the exogenous gene is an EGFP-encoding gene, and the nucleotide sequence of the type I intron ribozyme sequence backbone fragment is sequence 1.

[0019] In embodiments of the present invention, type I intron ribozyme sequence backbone fragments can be directly synthesized.

[0020] Secondly, the present invention provides a plasmid for preparing circular RNA.

[0021] The plasmid provided by this invention is any one of the following:

[0022] 1) A plasmid containing a type I intron ribozyme sequence backbone fragment with a transcription promoter as described in the first aspect; wherein the type I intron ribozyme sequence backbone fragment is transcribed using its own transcription promoter;

[0023] Specifically, the plasmid was synthesized by a commissioned company and contains a backbone fragment of a type I intron ribozyme with a transcription promoter.

[0024] 2) A plasmid is obtained by inserting the type I intron ribozyme sequence backbone fragment without a transcription promoter in the first aspect downstream of the promoter in the expression vector; the type I intron ribozyme sequence backbone fragment is transcribed using the transcription promoter in the expression vector.

[0025] In an embodiment of the present invention, the plasmid is constructed using a first method, and the expression vector is specifically pUC57. The plasmid containing the backbone fragment of the type I intron ribozyme sequence with the transcription promoter in the first aspect is specifically the plasmid pUC57-cEGFP.

[0026] Thirdly, the present invention provides a method for preparing circular RNA, comprising the following steps:

[0027] 1) Linearize the plasmid described in the second aspect to obtain a linearized plasmid;

[0028] The enzyme used for linearization has a restriction enzyme recognition site located in a region other than the type I intron ribozyme sequence backbone fragment in the plasmid described in the second aspect. In other words, the restriction enzyme recognition site mentioned above does not exist on the backbone fragment.

[0029] Furthermore, in an embodiment of the present invention, the expression vector is pUC57; in this embodiment, the enzyme recognition site selected in pUC57 is NdeI.

[0030] 2) Amplify the type I intron ribozyme sequence backbone fragment from the linearized plasmid to obtain the type I intron ribozyme sequence backbone fragment amplification product;

[0031] The primers used for the amplification described above are as follows:

[0032] Forward primer: TGCATCTAGATTAATACGACTCACT

[0033] Reverse primer: CTAGATATGCTGTTATCCGTCGATT.

[0034] 3) The amplified product of the type I intron ribozyme sequence backbone fragment was transcribed in vitro to obtain the transcript;

[0035] In an embodiment of the present invention, the transcription was performed using an RNA synthesis kit (E2040S, NEB, USA).

[0036] 4) Add GTP to the transcript and incubate to achieve circularization, thereby obtaining circularized RNA.

[0037] In an embodiment of the present invention, the final concentration of the above-mentioned GTP in the incubation system is 2 mM, and the incubation conditions are 55°C for 15 min.

[0038] Fourthly, the present invention provides a kit for preparing circular RNA, comprising the following:

[0039] 1) The type I intron ribozyme sequence backbone fragment and expression vector described in the first aspect; or, the plasmid described in the second aspect;

[0040] 2) The enzyme used for linearization in the third aspect;

[0041] 3) Primers required for amplification in the third aspect;

[0042] 4) Reagents and / or instruments required for in vitro transcription in the third aspect;

[0043] 5) GTP.

[0044] This invention, for the first time, creatively proposes a method to solve the problem of introducing redundant sequences in the in vitro synthesis of circRNA by utilizing the type I intron ribozyme sequence based on Anabaena tRNA, which has the following advantages:

[0045] (1) The sequence design pattern was optimized, and the structural components of the sequence were simplified without affecting the cyclic formation, while retaining the key cyclic sequences;

[0046] (2) No additional sequences are introduced except for the IRES original and coding region that promote translation. Theoretically, this can reduce the rejection response of the body's innate immune system triggered by the introduction of exogenous additional sequences, thereby promoting the stable translation of the coding sequence and achieving the therapeutic goal.

[0047] (3) This invention constructs a basic framework for the sequence and selects the IRES original with well-known translation effect, namely the CVB3_IRES original. If a new target is needed, the coding region can be replaced. The operation is simple and easy to implement. Attached Figure Description

[0048] Figure 1 The diagram shows the cyclization strategies for type I catalytic ribozymes; (A) a schematic diagram of currently common cyclization strategies; (B) a schematic diagram of the modified cyclization system.

[0049] Figure 2 For identification of circulation; (A) Schematic diagram of RNA gel electrophoresis; (B) Schematic diagram of PCR gel electrophoresis; (C) Schematic diagram of adapter site; (D) Western blotting detection of EGFP expression; where IVT represents the in vitro transcription product; circRNA represents the purified product; circRNA+Rnase R represents the product after Rnase R enzyme treatment. Detailed Implementation

[0050] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0051] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0052] Example 1: Preparation of plasmids expressing circular RNA

[0053] 1. Construction of the type I intron ribozyme sequence backbone and cEGFP circular template plasmid

[0054] This invention employs an improved strategy based on type I intron ribozymes from Anabaena tRNA to construct cEGFP circular template plasmids.

[0055] The improved type I intron ribozyme based on Anabaena tRNA is a redesigned version of previously reported sequences, addressing the inherent limitations of self-splicing in existing type I intron synthases. Based on existing sequences, this invention fully recognizes the importance of exons E1 and E2 in type I intron synthase self-splicing and accurately decomposes and optimizes the translation-promoting IRES element (CVB3 in this invention) to mimic the sequences of E1 and E2 (e.g., ...). Figure 1 As shown in B). This invention, without altering the self-splicing characteristics of type I intron ribozymes, will not introduce additional exogenous sequences (i.e.: ( Figure 1 The E2, 5' internal homologous sequence, 5' separator sequence, 3' internal homologous sequence, 3' separator sequence, and E1 sequences (also known as "scar" sequences) in A reduce the body's innate immune response to exogenous RNA.

[0056] The redesigned Anabaena tRNA-based type I intron ribozyme sequence backbone containing a foreign gene comprises the following elements from 5' to 3': a 5' homologous arm, the 3' end of the Anabaena T4 intron, CVB3_IRES_1, the foreign gene, CVB3_IRES_2, the 5' end of the Anabaena T4 intron, and the 3' homologous arm; a transcription promoter such as the T7 promoter can also be linked upstream of the 5' homologous arm.

[0057] When the exogenous gene is an EGFP-encoding gene, the nucleotide sequence of the type I intron ribozyme sequence backbone of the EGFP-encoding gene is sequence 1.

[0058] In sequence 1, positions 1-23 are the T7 promoter, positions 24-53 are the 5' homologous arms, positions 54-184 are the 3' end of the Anabaena T4 intron, positions 185-934 are CVB3_IRES_1, positions 935-1654 are the location of the foreign gene (here, the EGFP coding gene), positions 1655-1697 are CVB3_IRES_2, positions 1698-1813 are the 5' end of the Anabaena T4 intron, and positions 1814-1848 are the 3' homologous arms.

[0059] The plasmid pUC57-cEGFP was synthesized by Nanjing GenScript Technology Co., Ltd. This plasmid contains the type I intron ribozyme sequence backbone of the EGFP encoding gene. Specifically, the type I intron ribozyme sequence backbone of the EGFP encoding gene was cloned into the pUC57 expression vector, and the type I intron ribozyme sequence backbone fragment was transcribed using its own transcription promoter.

[0060] The pUC57-cEGFP plasmid was then introduced into E. coli to obtain recombinant bacteria. After culturing, the plasmid of the recombinant bacteria was extracted to obtain the cEGFP circular template plasmid.

[0061] 2. Template amplification and purification recovery

[0062] 1) Linearization

[0063] The above cEGFP circular template plasmid was cut into a linearized plasmid by the endonuclease NdeI (this enzyme is not present in the backbone of the type I intron ribozyme sequence of the EGFP encoding gene, but is located on the pUC57 plasmid).

[0064] 2) Amplify the type I intron ribozyme sequence backbone of the EGFP encoding gene.

[0065] Primers were designed to amplify the backbone of the type I intron ribozyme sequence of the EGFP encoding gene. Using the linearized plasmid described above as a template, high-fidelity PCR amplification was performed using KOD-Plus-Neo (KOD-401, TOYOBO, JAPAN).

[0066] Forward primer: TGCATCTAGATTAATACGACTCACT

[0067] Reverse primer: CTAGATATGCTGTTATCCGTCGATT

[0068] After the PCR reaction was completed, the amplification product was purified and recovered using a DNA template column (DP214, TIANGEN, China) to obtain purified template DNA (containing the T7 promoter).

[0069] 3. In vitro transcription and circulation

[0070] The purified template DNA was transcribed in vitro using an RNA synthesis kit with primers containing the T7 promoter sequence (E2040S, NEB, USA). Excess template DNA was then digested with DNase I and purified and recovered (T2030S, NEB, USA) to obtain purified linear RNA precursor (IVT, a product of in vitro transcription, with a concentration of approximately 2000 ng / µl).

[0071] GTP was added to the purified linear RNA precursor to a final concentration of 2 mM, and the mixture was incubated at 55°C for 15 min to perform in vitro circularization, yielding the incubated RNA product. The incubated RNA product was then purified again by column chromatography to obtain the circularized product (denoted as circRNA).

[0072] 4. Identification of circotypes

[0073] Based on the characteristic of circRNA's tolerance to RNase R, the cyclized product obtained in step 3 above was treated with RNase R to remove the remaining linear RNA precursor in the cyclization reaction. Then, a second column purification was performed to obtain the product after RNase R treatment (denoted as circRNA+RNase R).

[0074] 1) Agarose gel electrophoresis

[0075] The cyclized product obtained in step 3 above, the in vitro transcribed product obtained in step 3 above, and the product treated with RNase R enzyme were subjected to agarose gel electrophoresis.

[0076] The results are as follows Figure 2 As shown in A, IVT is the product of in vitro transcription; circRNA is the circularized product; circRNA+Rnase R is the product after treatment with Rnase R enzyme; and the linear control is the linear RNA obtained by in vitro transcription of a DNA molecule composed of the CVB3_IRES sequence and the EGFP coding gene sequence (sequence 1, positions 935-1654) (these two sequences are closely adjacent and spliced ​​together), with a PolyA tail added.

[0077] The above CVB3_IRES sequence is the original, unresolved sequence. For details, please refer to the following reference: Wesselhoeft RA, Kowalski PS, Anderson DG. Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat Commun. 2018; 9(1):2629. Published 2018 Jul 6. doi:10.1038 / s41467-018-05096-6).

[0078] As can be seen from the figure, compared with the linear control, both the in vitro transcription product and the product after RNase R treatment and cyclization were circular, indicating that RNA was clearly circularized.

[0079] 2) Validation after reverse transcription

[0080] The in vitro transcription product (IVT) obtained in step 3 above and the product after treatment with RNase R (denoted as circRNA+RNase R in the figure) were subjected to reverse transcription according to the following system and procedure to obtain the reverse transcription product.

[0081] The reverse transcription system described above is shown in Table 1 below (PrimeScript). TM RT Master Mix, Takara, RR036A).

[0082] Table 1

[0083]

[0084] The reverse transcription procedure is as follows:

[0085] 37℃ for 15 min (reverse transcription reaction)

[0086] 85℃ for 5 seconds (reverse transcriptase inactivation reaction)

[0087] 4℃

[0088] Then, using each reverse transcription product as a template, PCR amplification was performed by designing primers for the adapter sites to obtain the PCR amplification products.

[0089] The primers for the above-mentioned linker sites are as follows:

[0090] Forward primer: GGATCACTCTCGGCATGGAC

[0091] Reverse primer: GCTAGCGCCCAATGGTAAGA

[0092] The results are as follows Figure 2 As shown in B, it can be seen that a clear single-band PCR product was obtained.

[0093] The above PCR products were subjected to Sanger sequencing, and the results are as follows: Figure 2 As shown in C, the ring-forming site (the junction site indicated by the arrow, where the beginning and end meet) can be seen.

[0094] 3) Exogenous gene expression proteins

[0095] The linear control (linear RNA obtained by in vitro transcription of a DNA molecule composed of the CVB3_IRES sequence and the EGFP encoding gene sequence (sequence 1, positions 935-1654, which are closely adjacent and spliced ​​together), plus a Poly A tail), the in vitro transcription product IVT obtained in step 3), the circularized product (circRNA) obtained in step 3), and the product treated with RNase R (circRNA + RNase R) were respectively transformed into the lung adenocarcinoma cell line H1299. Cells were collected 24 hours after transfection. Lysis was performed on ice for 30 min using Western blotting and IP lysis buffer (P0013, Beyotime, China), followed by centrifugation at 12000g for 20 min, and the supernatant was collected.

[0096] The extracted protein was analyzed for EGFP expression using Western blotting.

[0097] The results are as follows Figure 2 As shown in Figure D, EGFP is clearly expressed in the IVT, circRNA, and circRNA+RNase R groups.

[0098] Based on the above evidence, this invention not only creatively solves the problem of introducing foreign redundant sequences, but also still allows for the detection of significant EGFP protein expression.

Claims

1. A group I intron ribozyme sequence backbone fragment, which is obtained by splitting and optimizing the CVB3_IRES sequence based on the group I intron sequence of Anabaena to mimic the E1 and E2 sequences, thereby obtaining a group I intron ribozyme sequence backbone fragment with self-splicing properties; The I-type intron ribozyme sequence skeleton fragments include: 5' homology arm, 3' end of Anabaena T4 intron, CVB3_IRES_1, foreign gene, CVB3_IRES_2, 5' end and 3' homology arm of Anabaena T4 intron; The nucleotide sequence of CVB3_IRES_1 is positions 185-934 of sequence 1; The nucleotide sequence of CVB3_IRES_2 is positions 1655-1697 of sequence 1.

2. The group I intron ribozyme sequence backbone fragment according to claim 1, characterized in that: The nucleotide sequence of the 5' homology arm is positions 24-53 of SEQ ID NO: 1; The nucleotide sequence at the 3' end of the Anabaena T4 intron is positions 54-184 of SEQ ID NO: 1; The nucleotide sequence of the exogenous gene replaces the positions 935-1654 of sequence 1; The nucleotide sequence of the 5' end of the Anabaena T4 intron is SEQ ID NO: 1698-1813; The nucleotide sequence of the 3' homology arm is positions 1814-1848 of SEQ ID NO:

1.

3. The group I intron ribozyme sequence backbone fragment according to claim 1 or 2, characterized in that: The I-type intron ribozyme sequence backbone fragment further includes a transcription promoter located upstream of the 5' homology arm.

4. The group I intron ribozyme sequence backbone fragment according to claim 3, characterized in that: The transcription promoter is a T7 promoter; The T7 promoter is positions 1-23 of sequence 1.

5. A plasmid for preparing circularized RNA, any of the following: 1) A plasmid containing the type I intron ribozyme sequence backbone fragment according to claim 3 or 4; the type I intron ribozyme sequence backbone fragment is transcribed using its own transcription promoter; 2) A plasmid obtained by inserting the type I intron ribozyme sequence backbone fragment according to claim 1 or 2 into the downstream of the promoter in an expression vector; the type I intron ribozyme sequence backbone fragment is transcribed using the transcription promoter in the expression vector.

6. A method for preparing circularized RNA, comprising the following steps: 1) linearizing the plasmid according to claim 5 to obtain a linearized plasmid; The restriction enzyme cleavage site of the linearization enzyme is present in the region excluding the backbone fragment of the type I intron ribozyme sequence in the plasmid of claim 5; 2) amplifying the group I intron ribozyme sequence backbone fragment from the linearized plasmid to obtain a group I intron ribozyme sequence backbone fragment amplification product; 3) in vitro transcribing the amplified product of the group I intron ribozyme sequence backbone fragment to obtain a transcription product; 4) Adding GTP to the transcription product for incubation to achieve cyclization and obtain circularized RNA.

7. A kit for preparing circularized RNA, comprising: 1) The group I intron ribozyme sequence backbone fragment according to any one of claims 1 to 4 and the expression vector according to claim 5; or the plasmid according to claim 5; 2) The enzyme used for linearization according to claim 6; 3) primers required for amplification according to claim 6; 4) Reagents and / or instruments required for in vitro transcription; 5)GTP.

Images