Salt-tolerant protein ghiput1 and application of coding gene thereof

By overexpressing the GhIPUT1 gene in cotton, the problem of cotton growth in saline-alkali soil was solved, the salt tolerance and yield of cotton were improved, and the synergistic improvement of high yield and salt tolerance was achieved.

CN116286963BActive Publication Date: 2026-02-06INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211699895.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-28
Publication Date
2026-02-06
Estimated Expiration
2042-12-28

AI Technical Summary

Technical Problem

In existing technologies, cotton growing in saline-alkali soil faces problems such as difficulty in seedling formation, stunted growth, missing seedlings, and large-scale seedling death. Furthermore, salt stress is sensitive to cotton germination and seedling stages, and there is a lack of effective salt tolerance mechanisms and molecular genetic improvement methods.

Method used

By overexpressing the GhIPUT1 gene in cotton, the protein encoded by this gene can regulate the plant's salt tolerance, thereby improving the cotton's salt tolerance and yield. The GhIPUT1 gene is introduced into the cotton genome using transgenic, hybridization, and backcrossing methods to achieve stable gene expression and genetic improvement.

Benefits of technology

It significantly improved the salt tolerance and yield of cotton, increased the yield of seed cotton per plant, reduced Na+ accumulation, and achieved synergistic improvement of high yield and salt tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116286963B_ABST
    Figure CN116286963B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biology, and particularly to a salt-tolerant protein GhIPUT1 and application of a coding gene thereof. The GhIPUT1 protein provided by the present application can significantly increase the boll number of a single cotton plant, improve the seed cotton yield of a single plant, and realize the synergistic improvement of high yield and salt tolerance of cotton.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the application of the salt tolerance-related protein GhIPUT1 and its encoding gene. Background Technology

[0002] Cotton is an important economic crop in my country, possessing strong salt and alkali tolerance and considered one of the pioneer plants for improving saline-alkali land (Kong et al., 2016; Wang et al., 2017). Although cotton is a salt-tolerant crop, excessive soil salinity can still cause serious damage, especially during the germination and seedling stages when it is highly sensitive to salt stress (Peng et al., 2017; Wang et al., 2019). When planting cotton in saline-alkali land, problems such as difficulty in seedling establishment, stunted growth, missing seedlings, large-scale seedling death, and low and unstable yields are frequently observed. The difficulty in establishing seedlings and poor yield per plant in saline-alkali land have long plagued cotton production (Jiang et al., 2006; Liu et al., 2011).

[0003] Plants respond to salt stress by producing Ca 2+ Signals, but for a long time, the control of extracellular Na+ + Sensing and driving salt-induced Ca 2+ The components and mechanisms of signal transduction remain unclear. Hu Zhangli's research group, in collaboration with others, based on Ca... 2+ Imaging-based genetic screening revealed for the first time in Arabidopsis that MOCA1 in the plasma membrane is the glucuronidyl transferase (IPUT1) that forms glycosylinositol phosphorylceramide (GIPC) on the outer side of the plasma membrane, revealing that glycosphingolipid GIPC acts as a salt receptor mediating Ca2+. 2+ The mechanism of influx (Jiang et al., 2019). This study found that Na+ under salt stress... + First, it binds to the glycosphingolipid GIPC, a salt receptor outside the cell membrane, causing a change in the potential of the outer membrane. Subsequently, the calcium in the membrane... 2+ Influx channels open, intracellular Ca 2+ The concentration increased, followed by the Na of SOS1. + Once the transport pathway is activated, the plant's salt tolerance mechanism response under salt stress is initiated (Jiang et al., 2019; Liao et al., 2021; Wang et al., 2021). Unlike the salt-sensing ion channels in animals, the plant-specific glycosphingolipid GIPC is the first non-ion channel salt receptor discovered (Jiang et al., 2019; Steinhorst et al., 2019). This salt stress response mechanism may indicate that lipids are involved in adapting to different levels of environmental salt stress and could be used to improve crop salt tolerance.

[0004] The salt receptor GIPC (glucosidase-phosphatidylinositol ceramide) is a major component of the outer lipid bilayer of the plant plasma membrane, accounting for 40% of the membrane lipids. It can provide a potential molecular genetic target for transgenic salt-tolerant crops (Steinhorst et al., 2019; Wang et al., 2021). Inositol phosphoryl ceramide glucuronyltransferase 1 (IPUT1) is the only enzyme responsible for the glycosylation pathway of IPC glucuronidation to GIPC; therefore, IPUT1 may play an important role in the genetic improvement of crop resistance (Wang Meiling, 2020; Tartaglio et al., 2017). Currently, there are no reports on the function and salt tolerance of IPUT1 in cotton. Summary of the Invention

[0005] This invention provides the application of the salt tolerance-related protein GhIPUT1 and its encoding gene, and discovers that overexpression of GhIPUT1 lines achieves synergistic improvement in high yield and salt tolerance, which has significant application potential.

[0006] This invention provides the application of GhIPUT1 protein or its encoding gene, or biological materials containing its encoding gene, in regulating plant salt tolerance or plant height.

[0007] This invention provides the application of GhIPUT1 protein or its encoding gene, or biological materials containing its encoding gene, in improving the salt tolerance of plants or increasing plant height.

[0008] According to the application, the plant is a dicotyledonous plant or a monocotyledonous plant.

[0009] According to the application, the dicotyledonous plants include one or more of cotton, Arabidopsis thaliana, and tobacco; the monocotyledonous plants include one or more of rice, corn, and wheat.

[0010] Preferably, the plant includes cotton and / or Arabidopsis thaliana.

[0011] This invention provides the application of GhIPUT1 protein or its encoding gene, or biological materials containing its encoding gene, in increasing cotton yield.

[0012] This invention provides the application of GhIPUT1 protein or its encoding gene, or biological materials containing its encoding gene, in increasing the number of bolls per cotton plant and / or the yield of seed cotton per plant.

[0013] This invention provides GhIPUT1 protein or its encoding gene, or biological materials containing its encoding gene, for reducing Na+ in cotton. + Applications accumulated over time.

[0014] According to the application, the biomaterial is a carrier, host cell, or recombinant bacteria.

[0015] In some embodiments of the present invention, the gene ID (Huazhong Agricultural University database) of the cotton gene GhIPUT1 is Ghir_A11G026530.

[0016] This invention also provides a method for constructing salt-tolerant or high-yielding cotton by overexpressing the GhIPUT1 gene in cotton through transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0017] According to the method described, the gene GhIPUT1 is cloned and constructed into a plant expression vector, and the gene is transformed into cotton plants using this vector to obtain overexpressed plant progeny.

[0018] The beneficial effects of this invention are:

[0019] The GhIPUT1 protein provided by this invention can significantly increase the number of bolls per cotton plant and improve the yield of seed cotton per plant, thus achieving synergistic improvement of high cotton yield and salt tolerance. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0021] Figure 1 This is a diagram of GhIPUT1 gene expression in cotton seedlings after 12h and 24h of salt stress treatment. Figure A shows the expression of GhIPUT1 gene in germinating seeds. Figure B shows the relative expression level of GhIPUT1 gene in different organs of upland cotton. Figure C shows the expression pattern of GhIPUT1 gene in cotton seedlings under drought stress (5% PEG). Figure D shows the expression pattern of GhIPUT1 gene in cotton seedlings under salt stress (150 mM NaCl).

[0022] Figure 2 This invention relates to the homology analysis of GhIPUT1 amino acid sequences from different species.

[0023] Figure 3 This invention is a phylogenetic tree analysis of GhIPUT1 proteins from different species.

[0024] Figure 4 This invention describes the localization of GhIPUT1 in Arabidopsis protoplast cells.

[0025] Figure 5This is a plasmid map of the PC2300S-GhIPUT1 expression vector of the present invention.

[0026] Figure 6 This invention relates to the PCR detection of the (A) nptⅡ gene and (B) GhIPUT1 gene in the transformed plants; 1-12 are T0 regenerated lines in sequence.

[0027] Figure 7 This represents the expression level of GhIPUT1 in the transgenic lines OE-3, OE-8, and WT under normal culture conditions of this invention.

[0028] Figure 8 This invention relates to the following data on cotton seedlings at the three-leaf stage under salt stress: (A) growth, (B) dry matter accumulation, (C) K+ concentration, and (D) Na+ concentration. + Concentration and (E) Na + Comparison of transportation efficiency.

[0029] Figure 9 This invention relates to the Na content of roots in cotton seedlings (A) at the three-leaf stage under salt stress. + Comparison of ion flow and (B) growth of different grafted seedlings.

[0030] Figure 10 This invention describes the mid-growth status of different cotton materials under normal cultivation conditions. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0032] Example 1: Expression analysis, phylogenetic tree analysis, and subcellular localization of the GhIPUT1 gene.

[0033] Using salt-sensitive cotton variety J0102 as the research object, transcriptome analysis revealed that salt stress significantly increased the expression of four IPUT1 genes (Ghir_A11G026530, Ghir_D13G018490, Ghir_D11G026720, and Ghir_A13G017750) in germinating cotton seeds. Furthermore, with the extension of salt stress duration, the expression of the GhIPUT1 gene in germinating cotton seeds continued to be upregulated (see...). Figure 1 (A). Subsequently, Ghir_A11G026530, which is highly expressed under salt stress, was selected as the target gene.

[0034] 1.1. Cloning of the GhIPUT1 gene, tissue-specific expression patterns, and analysis of drought and salt stress induction.

[0035] Total RNA was extracted from root, stem, and leaf tissues of drought-tolerant cotton (Zhong H177) and salt-tolerant cotton (Zhong 9807) seedlings at the three-leaf stage. The RNA was then reverse transcribed into cDNA. Primers were designed using the GhIPUT1 gene sequence information, and real-time PCR was used to analyze the tissue-specific expression pattern and drought and salt stress induction of GhIPUT1. Seedling culture conditions, total RNA extraction, qRT-PCR primers, and procedures are as follows:

[0036] The experiment was conducted in a light-illuminated (sodium lamp) incubation chamber with a light intensity of 450 μmol / m². -2 s -1 The light exposure time was 14 hours, the daytime temperature was 28℃±2℃, and the nighttime temperature was 20℃±2℃. Seeds of cotton material H177 were disinfected with 9% hydrogen peroxide for 30 minutes, rinsed several times with clean water, and then evenly sown on a sand bed rinsed with deionized water. A layer of polyester cloth was placed on top, followed by a thin layer of sand. After 4 days, the seedlings were transferred to 32 cm × 26 cm × 32 cm plastic boxes for hydroponic cultivation using a modified Hoagland nutrient solution; 6 seedlings were placed in each box, the nutrient solution was changed every 7 days, and air was pumped in every 24 hours. The modified Hoagland nutrient solution formula is: 2.5 mM Ca(NO3)2, 1 mM MgSO4, 0.5 mM (NH4)H2PO4, 0.1 mM MFe-Na-EDTA, 0.2 μM CuSO4, 1 μM ZnSO4, 20 μM H3BO3, 5 pM (NH4)6Mo7O 24 1 μM MnSO4 and 2.5 mM KCl. After cotton seedlings reached the three-leaf stage, different tissues such as roots, stems, and leaves were ground into powder using liquid nitrogen. Total RNA was extracted from the cotton using the EASYspin Plus Plant RNA Rapid Extraction Kit (Adley), and cDNA was synthesized using a reverse transcription kit (TakaRa). Using the synthesized cDNA as a template, real-time PCR was performed using the SYBR Primix Ex TaqII (Tli RNaseH Plus) (TaKaRa) quantitative PCR reagent. Primers were designed based on the full-length sequence of the GhIPUT1 gene: upstream primer: 5'AGAATAGTGACGCAACTGACC3' (SEQ ID NO.1), downstream primer: 5'AACCCGTAGTACCAAGAAACA3' (SEQ ID NO.2). The reaction system was as follows: 10 μL 2×SYBR Premix ExTaq II, 2 μL cDNA template, 0.8 μL PCR forward primer (10 μM), 0.8 μL PCR reverse primer (10 μM), 0.4 μL ROX, and 6 μL sterile water. The reaction program was: 95℃ for 30 s, 40 cycles, followed by 95℃ for 5 s and 60℃ for 34 s. The cotton actin7 gene was used as an internal reference gene, utilizing 2... -ΔΔCt The relative expression levels of genes were analyzed using three biological replicates and three technical replicates. The data were visualized and analyzed using Graphpad 5.0 software.

[0037] The results showed that GhIPUT1 was expressed in root, stem, and leaf tissues, with the highest expression level in roots. Figure 1 To clarify whether GhIPUT1 expression is regulated by drought and salt stress, three-leaf stage seedlings of salt-tolerant cotton (Zhong 9807) and drought-tolerant cotton (Zhong H177) were treated with 200 mM salt solution and 5% PEG6000, respectively. qRT-PCR analysis showed that 5% PEG6000 drought stress treatment had no significant effect on GhIPUT1 expression in leaves and roots of drought-tolerant cotton (Zhong H177) (see [reference needed]). Figure 1 (C). Salt stress significantly induced the expression of GhIPUT1 in the roots of salt-tolerant cotton seedlings (C9807). The expression level was highest at 12 h of salt stress (2.7 times that of the control), then gradually decreased, recovering to the control level at 72 h of salt stress. However, salt stress had no significant effect on the expression level of GhIPUT1 in cotton seedling leaves (see [link to study]. Figure 1(C). The above results indicate that the GhIPUT1 gene may specifically participate in the salt tolerance response process during cotton seed germination and seedling development.

[0038] 1.2. Phylogenetic analysis of the GhIPUT1 gene

[0039] IPUT1 amino acid sequences of multiple species, including Asian cotton, sea island cotton, Ramond cotton, durian, Colombian mallow, cocoa, hibiscus, rice, Arabidopsis thaliana, Cercis chinensis, rubber tree, poplar, poplar, white poplar, and papaya, were downloaded from the NCBI database and compared for homology with the GhIPUT1 amino acid sequence of upland cotton (see [link]). Figure 2 Using MEGA 5.0 software, a phylogenetic tree was constructed based on the IPUT1 amino acid sequences of the above plants. The results showed that the GhIPUT1 amino acid sequence of upland cotton belongs to the same subbranch as that of Asian cotton, sea island cotton, Raymond cotton, durian, Colombian mallow, cocoa, and hibiscus. Among them, the GhIPUT1 amino acid sequence of upland cotton has the highest homology with GaIPUT1 of Asian cotton, followed by a close phylogenetic relationship with GrIPUT1 of Raymond cotton and GbIPUT1 of sea island cotton, revealing the evolutionary pattern of tetraploid upland cotton GhIPUT1 (see...). Figure 3 ).

[0040] 1.3. Subcellular localization analysis of GhIPUT1 protein

[0041] Subcellular localization prediction of GhIPUT1 protein was performed using WoLF PSORT (https: / / wolfpsort.hgc.jp / ) software, and the results showed that it is located in the cell membrane. Primers were designed based on the full length of the GhIPUT1 gene, and the following primers were used: upstream primer: 5'AGAATAGTGACGCAACTGACC3 (SEQ ID NO.1)', downstream primer: 5'AACCCGTAGTACCAAGAAACA3' (SEQ ID NO.2). The target gene GhIPUT1 was then amplified using these primers, and the target fragment was detected and recovered using 1.5% agarose gel electrophoresis. The recovered target gene fragment and empty vector were ligated into a vector containing the green fluorescent protein (GFP) gene, and then transfected into competent E. coli cells. Positive single clones were selected, cultured, and plasmids were extracted. The extracted target plasmids were co-transformed into Arabidopsis protoplasts with cell membrane markers. The protoplast extraction and transformation methods are as follows:

[0042] Three-week-old Arabidopsis leaves were selected and cut into 1 mm strips perpendicular to the main stem using a double-edged blade. These strips were then quickly placed in an enzymatic hydrolysis solution (1% cellulase R-10, 0.25% sorbase R-10, 20 mmol / L MES, 0.4 mol / L mannitol, 20 mmol / L KCl, 0.1% BSA, 10 mmol / L CaCl2, and 5 mmol / L β-mercaptoethanol) and incubated in the enzyme solution at 25°C in the dark for 3 h. After digestion, the enzymatic hydrolysate was diluted to the same volume with W5 (20 mmol / L MES, 154 mmol / L NaCl, 125 mmol / L CaCl2, 5 mmol / L KCl, pH 5.8), then centrifuged at 1000 r / min for 2 min, the supernatant was removed, and the protoplasts were resuspended in W5 solution. Next, the protoplasts that had been allowed to stand for 10 h were treated with fluorescein diacetate (FDA) at a final concentration of 25 mol / L at room temperature for 10 min, and the viability of the protoplasts was identified by microscopic examination under a fluorescence microscope. Next, Arabidopsis protoplasts were transformed. MMg solution [0.4 mol / L mannitol, 15 mmol / L MgCl2, and 4 mmol / L MES (pH 5.7)] was added to the protoplasts to resuspend them. Then, 100 μL of the resuspended protoplasts and 25 μL of the recombinant vector were added to a 1.5 mL centrifuge tube, followed by 125 μL of PEG solution (40% PEG-4000, 0.2 mol / L mannitol, and 0.1 mol / L CaCl2). The mixture was gently shaken and incubated at 23°C in the dark for 30 min. Next, 4 volumes of W5 solution were added and mixed. The mixture was centrifuged at 100×g for 1 min at room temperature to remove the PEG. The protoplasts were then resuspended in 100 μL of W5 solution and cultured at 22°C in low light for 8–10 h.

[0043] After transient expression in Arabidopsis protoplasts, the localization of GhIPUT1 was observed under an LSM880 laser confocal microscope (Zeiss, Germany). The results showed that the protein of the overexpression vector 35S::GhIPUT1-GFP was distributed in a bright green color in both the cell membrane and cytoplasm, indicating the widespread expression of the GhIPUT1 gene (see [link to original text]). Figure 4 ).

[0044] Example 2: Obtaining the expression vector, recombinant expression cells, and transgenic cotton of the GhIPUT1 gene

[0045] 2.1. Construction of recombinant expression vectors

[0046] The GhIPUT1 gene was constructed into the expression vector PC2300S to obtain a recombinant expression vector. Gene expression was initiated with a 35S promoter and terminated with a 35S poly terminator. Kanamycin was used as a selection marker. The specific method is as follows: Primers were designed using the full-length sequence of the GhIPUT1 gene from Example 1. The upstream primer was 5'AGAATAGTGACGCAACTGACC3' (SEQ ID NO.1), and the downstream primer was 5'AACCCGTAGTACCAAGAAACA3' (SEQ ID NO.2). Amplification was performed to obtain the PCR product of the GhIPUT1 gene sequence. The target fragment was digested with restriction endonucleases SacI (5' end) and BamHI (3' end). The digested PCR product was then constructed into the overexpression vector PC2300S containing the NpTII gene using a homologous recombination kit (ClonExpress II OneStep Cloning Kit, Novizan), obtaining the overexpression vector PC2300S-GhIPUT1. Figure 5 ).

[0047] 2.2. Obtaining Recombinant Expression Cells

[0048] The plasmid vector containing the recombinant vector PC2300S-GhIPUT1 was transformed into Agrobacterium EHA105 competent cells to obtain Agrobacterium containing the recombinant vector. Sequencing was then performed to obtain recombinant expression cells. The specific procedure is as follows: In a clean, sterile Eppendorf tube, 20 mg of purified plasmid DNA containing the recombinant vector and 200 ml of Agrobacterium competent cells were added and mixed well. The mixture was placed on ice for 5 minutes, then transferred to liquid nitrogen for 8 minutes, and then quickly incubated in a 37°C water bath for 5 minutes. 800 μL of YEB liquid medium was added, and the mixture was incubated on a shaker at 28°C (250 rpm) for 4-5 hours. The transformed Agrobacterium was transferred using a micropipette to YEB solid selective medium plates containing the appropriate antibiotics and spread evenly with a sterile glass rod. The plates were allowed to stand at room temperature for 15 minutes, then inverted and incubated at 28°C for 2-3 days, observing colony growth.

[0049] 2.3. Obtaining Genetically Modified Cotton

[0050] The recombinant vector PC2300S-GhIPUT1 was transferred into cotton using Agrobacterium-mediated genetic transformation to obtain cotton plants transgenic with the GhIPUT1 gene. The specific procedures are as follows:

[0051] 1. Select healthy, plump HM-1 cotton seeds, remove the seed coat, surface disinfect with 0.1% HgCl2 for 10 minutes, then wash 3-4 times with sterile distilled water. Inoculate onto sterile seedling culture medium for germination. After 1 day, support the seedlings, remove the seed coat, insert the radicle into the culture medium to promote rapid growth, and incubate in the dark at 28℃ for 6 days to obtain sterile seedlings for Agrobacterium infection. 2. Using the hypocotyl of the sterile seedlings as explants, cut them into 0.5-0.8 cm segments. Infect them with Agrobacterium-activated bacterial suspension (0.5-0.8 OD) activated on MGL liquid medium for 8 minutes. Then blot the bacterial suspension on the surface of the hypocotyl segments with sterile filter paper and dry them appropriately. Inoculate the hypocotyls onto a co-culture medium lined with filter paper. Co-culture at 22℃ for 2-3 days. 3. After co-culture is complete, inoculate hypocotyl segments onto selection medium I and culture in a light-controlled incubator. Subculture every 4 weeks until embryogenic callus is obtained. Subculture the embryogenic callus tissue onto differentiation medium I to induce cotyledonary embryo formation. Subculture every 4 weeks until cotyledonary embryos are obtained. 4. Transfer the cotyledonary embryos to the seedling culture medium, gently inserting them with the radicle facing down into the medium to differentiate into seedlings. Subculture the seedlings onto the seedling culture medium. Once the regenerated plants have strong root systems, wash off the culture medium with tap water, then harden the seedlings with tap water for about a week before transplanting them into square pots containing nutrient soil.

[0052] Leaves from regenerated plants were harvested, and total cotton DNA was extracted using the CTAB method. PCR detection was performed on resistant plants using specific primers for the nptII and GhIPUT1 genes, respectively. The nptII gene primer sequences are as follows: NPTIIF68:ACTGGGCACAACAGACAATCG (SEQ ID NO.3), NPTIIR356: GCATCAGCCATGATGGATACTTT (SEQ ID NO.4), fragment size 289 bp. The GhIPUT1 gene primer sequences are as follows: upstream primer: 5'AGAATAGTGACGCAACTGACC3' (SEQ ID NO.1), downstream primer: 5'AACCCGTAGTACCAAGAAACA3' (SEQ ID NO.2), fragment size 1206 bp.

[0053] Of these, 30 were positive transformants. PCR detection results for the nptⅡ and GhIPUT1 genes in some of these transformants are shown below. Figure 6The results showed that GhIPUT1 amplified approximately 1200 bp of the target fragment. This gene amplified to the expected size in the transgenic embryogenic callus tissue, consistent with the plasmid positive control. In lines 10 and 12, the expected size fragment was not amplified, indicating that the target gene had not been successfully integrated. Plants 1-9 and 11 were PCR-positive, indicating that the target gene had been integrated into the genome of the embryogenic callus tissue. Ultimately, 25 T0 generation positive transgenic cotton plants containing the GhIPUT1 gene were obtained.

[0054] Repeated PCR detection of the GhIPUT1 gene in transformed plants was performed until T3 homozygous single plants were screened. Two independent transgenic lines, OE-3 and OE-8, were selected for analysis. The expression level at the three-leaf stage was determined by RT-PCR. The GhIPUT1 gene was strongly expressed in both OE-3 and OE-8, indicating that the GhIPUT1 gene was stably inherited (see...). Figure 7 ).

[0055] Example 3: Salt Tolerance Functional Analysis of GhIPUT1

[0056] Following the hydroponic cotton cultivation method described in Example 1, when the seedlings reached the stage of having their third true leaf fully expanded, normal cultivation conditions (CK), drought stress (5% PEG6000), and salt stress (S: 150 mM) were applied, with each treatment replicated 6 times. Stress treatment was administered at the three-leaf stage. Seven days after drought or salt stress treatment, the plants were harvested, rinsed thoroughly with distilled water, and the surface moisture was absorbed with absorbent paper. The seedling roots and above-ground parts were separated and blanched at 105℃ for 30 min, then dried at 80℃ until constant weight. The dry matter weight was measured. The dried plants were then pulverized and sieved, and treated with 1 mol / L... -1 After HCl extraction for 12 h and shaking for 30 min, the solution was filtered, and K was determined using an atomic absorption spectrophotometer. + and Na + Concentration. The results showed that drought stress (5% PEG6000) treatment inhibited the growth of WT, OE-3, and OE-8 seedlings, but the drought tolerance of different lines was not significantly different from that of WT (results not shown). Salt stress significantly inhibited the growth of cotton seedlings and led to senescence, death, and abscission of mature leaves in WT seedlings (see...). Figure 8 Compared to WT, the OE-3 and OE-8 lines showed enhanced tolerance to salt stress, significantly improved aboveground and root growth, with only a few leaves showing yellowing, and improved salt tolerance in cotton seedlings. Salt stress significantly reduced potassium levels in cotton seedlings. + Concentration, while OE-3 and OE-8 only have K in the roots. + The concentration should be slightly lower than WT (see Figure 8The results showed that GhIPUT1 regulates the salt tolerance of cotton and affects K. + Absorption dynamics were irrelevant. Salt stress significantly increased Na+ in cotton seedlings. + Both OE-3 and OE-8 maintained low Na concentrations in their aboveground parts and roots. + Concentration (see) Figure 8 (D); At the same time, salt stress increased the Na+ of cotton seedlings. + Transportation efficiency, but there was no significant difference between different cotton materials (see...). Figure 8 The results showed that GhIPUT1 modulates the salt tolerance of cotton and affects the Na+ content. + It is unrelated to transportation.

[0057] Determination of Na in the roots of different cotton materials using non-destructive micro-measuring techniques + Changes in absorption; 7 days after salt stress treatment, select uniformly growing cotton seedlings, and use a blade to cut a portion of the root system (~3 cm) from the base of the seedling as a root tissue sample; rinse the sample with deionized water, immerse it in distilled water for 15 min, and then immerse it in 10 mL of test solution (0.5 mmol / L). -1 NaCl, 0.1 mmol / L -1 KCl, 0.1 mmol / L -1 CaCl2, 0.1 mmol / L -1 MgCl2, 0.3 mmol / L -1 MES, 0.2 mmol / L -1 The solution was equilibrated in Na₂SO₄ (pH 6.0 adjusted with Tris or HCl) for 15 min, then transferred to a fresh 10 mL test solution to begin the test. Eight seedlings were tested per treatment, with each test lasting 7–10 min (to reach a steady state). Data from the first 2–3 mins were discarded during the calculation. The results showed that salt stress significantly increased Na₂SO₄ concentration in the roots of different materials. + External drainage; compared to WT, OE-3 and OE-8 maintained higher Na levels in their root systems. + External discharge (see) Figure 9 (A) indicates that GhIPUT1 regulates Na in cotton roots. + The absorption dynamics of GhIPUT1 overexpression. To further clarify the effect of GhIPUT1 overexpression on Na... +To investigate the regulatory effect of concentration absorption, a grafting experiment was conducted between WT and OE-3. The seedlings were cultured in hydroponics for 5 days, and grafting began when the first true leaf appeared. A double-scion, single-rootstock (Y-type) grafting method was used. A double-edged blade was used to make a 1-2 cm vertical cut downwards along the middle of the rootstock. The lower parts of both scions were cut into wedge shapes and inserted side-by-side at the same height into the rootstock cut. The cut was then sealed with paraffin wax film for fixation. After grafting, the grafted seedlings were placed in a plastic bag with several small holes and exposed to light at an intensity of 80-100 μmol / m². -2 s -1 Seedlings were allowed to recover under conditions of 14h / 10h light / dark cycles and 25℃ / 20℃ temperatures, and the plastic bags were removed after 7 days. The results showed that the rootstock significantly affected the salt tolerance of the scion (see...). Figure 9 (B) Under salt stress, grafting with WT rootstock reduced the salt tolerance of OE-3 scions, while grafting with OE-3 rootstock increased the salt tolerance of WT scions. These results indicate that overexpression of GhIPUT1 improves the salt tolerance of cotton seedlings mainly by reducing Na+ in the roots. + The absorption dynamics.

[0058] During the mid-to-late stages of growth, overexpression of GhIPUT1 under normal culture conditions significantly increased plant height and seed cotton yield. Pot experiments showed that the transgenic lines OE-3 and OE-8 exhibited plant heights increased by 20.2% and 15.1% respectively compared to the WT line (see...). Figure 10 Overexpression of GhIPUT1 significantly increased the number of bolls per plant, with OE-3 and OE-8 showing increases of 32.0% and 24.0% respectively compared to WT. Overexpression of GhIPUT1 had no significant effect on boll weight and lint percentage (see Table 1). Therefore, compared to WT, overexpression of GhIPUT1 significantly improved seed cotton yield per plant. Meanwhile, overexpression of GhIPUT1 had no significant effect on fiber quality indicators such as fiber length, breaking strength, and micronaire value (results not shown).

[0059] Table 1. Comparison of yield and yield composition of different cotton materials under normal cultivation conditions.

[0060]

[0061] Transcriptomic studies revealed that salt stress significantly increased the expression of four IPUT1 genes (Ghir_A11G026530, Ghir_D13G018490, Ghir_D11G026720, and Ghir_A13G017750) in germinating seeds. Subsequent results showed that salt stress significantly induced GhIPUT1 expression in the roots of salt-tolerant cotton seedlings, indicating that the GhIPUT1 gene may be involved in the cotton's salt tolerance response. Subsequently, the cotton IPUT1 gene was successfully introduced into the cotton genome using Agrobacterium-mediated transformation, and the gene was stably expressed in progeny, obtaining T3 generation homozygous lines overexpressing the GhIPUT1 gene. Our experimental results showed that the IPUT1 overexpression lines significantly reduced Na+ expression. + Accumulation improved the salt tolerance of transgenic cotton seedlings. At the same time, under normal conditions, the transgenic lines significantly increased the number of bolls per plant and improved the seed cotton yield per plant. The overexpression lines achieved synergistic improvement in high yield and salt tolerance.

[0062] In conclusion, GhIPUT1 can serve as a superior gene for improving cotton, contributing to enhanced agronomic traits and seed cotton yield. Simultaneously, it can synergistically improve cotton's salt tolerance, providing important biological genetic material and theoretical basis for the research of cotton salt-tolerant genes and the creation of cotton stress-resistant materials. This gene has significant application prospects.

[0063] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of GhIPUT1 protein or a gene encoding the same or a biological material containing the gene in improving salt tolerance of cotton or increasing plant height of cotton; the biological material is a vector, a host cell or a recombinant bacterium; the amino acid sequence of the GhIPUT1 protein is shown as SEQ ID NO.

5.

2. Application of GhIPUT1 protein or a gene encoding the same or a biological material containing the gene in improving yield of cotton; the biological material is a vector, a host cell or a recombinant bacterium; the amino acid sequence of the GhIPUT1 protein is shown as SEQ ID NO.

5.

3. Application of GhIPUT1 protein or a gene encoding the same or a biological material containing the gene in improving boll number per plant and / or seed cotton yield per plant of cotton; the biological material is a vector, a host cell or a recombinant bacterium; the amino acid sequence of the GhIPUT1 protein is shown as SEQ ID NO.

5.

4. Use of a GhIPUT1 protein or a gene encoding the same, or a biological material containing the gene encoding the same, in reducing Na + accumulation in cotton. the biological material is a vector, a host cell or a recombinant bacterium; the amino acid sequence of the GhIPUT1 protein is shown as SEQ ID NO.

5.

5. A method of constructing a salt tolerant or high yielding cotton plant, comprising, Cotton is made to overexpress GhIPUT1 gene by transgenic, hybridization, backcross, selfing or vegetative propagation; the nucleotide sequence of the GhIPUT1 gene is shown as SEQ ID NO.

6.

6. The method of claim 5, wherein, Gene GhIPUT1 is cloned and constructed into a plant expression vector, and the gene is transformed into cotton in vivo by means of the vector to obtain overexpression plant offspring.

Citation Information

Patent Citations

  • Application of cotton sucrose transporter gene GhSUT6 in improving salt tolerance of plants

    CN115043919A