A kit and method for detecting free ctDNA mutation sites
By designing an auxiliary template complementary to the ctDNA sequence and amplifying a target sequence of sufficient length, combined with fluorescent probe detection, the problem of low sensitivity in ctDNA fragment detection in existing technologies has been solved, achieving highly sensitive detection of tumor-specific mutations.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- XIAMEN HUAZAO BIOTECHNOLOGY CO LTD
- Filing Date
- 2023-01-07
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies have low sensitivity when detecting free ctDNA fragments, especially those near mutation sites.
An auxiliary template was designed to be complementary to the ctDNA sequence containing the mutation site. The target sequence of sufficient length was amplified by ARMS-PCR technology and detected by fluorescent probes to improve detection sensitivity.
It significantly improved the detection sensitivity of free ctDNA mutation sites and enhanced the detection capability of tumor-specific mutation sites in plasma.
Smart Images

Figure CN116287151B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a kit and method for detecting ctDNA mutation sites. Background Technology
[0002] Cancer has become a leading cause of death among Chinese residents, and its incidence and mortality rates continue to rise. The main reason is that most cancer patients in my country are diagnosed at an advanced stage, resulting in a low five-year survival rate. Early detection and treatment at stage I or II can significantly improve the five-year survival rate. Therefore, early screening, early diagnosis, and early treatment are crucial for improving the survival rate of cancer patients. Liquid biopsy is a technique that detects early-stage cancer by detecting cancer signals released into body fluids during the growth, necrosis, and apoptosis of cancer cells. Peripheral blood cell-free DNA is the most widely used analytical indicator in liquid biopsy.
[0003] Cell-free DNA (cfDNA) refers to DNA fragments circulating outside cells in peripheral blood, ranging in size from 70 to 170 bp. It primarily originates from DNA produced by normal cells during necrosis or apoptosis. In certain diseases, such as cancer, tumor cells also release cell-free DNA fragments, called ctDNA. Due to the rapid metabolism and proliferation of tumor cells, and the large-scale apoptosis and necrosis following hypoxia, a significant amount of ctDNA is released into the bloodstream. Furthermore, because tumor cells often contain many mutations, the ctDNA released into the bloodstream contains mutation sites. However, since cell-free ctDNA is mostly in a randomly fragmented state, some mutation sites are located at the ends and are difficult to detect. Therefore, detecting tumor-specific mutations or epigenetic changes in cell-free ctDNA can enable non-invasive cancer screening and companion diagnosis, showing broad clinical application prospects.
[0004] Among current gene mutation detection methods, quantitative real-time PCR (qPCR) is widely used due to its simplicity, short detection cycle, low cost, and high sensitivity. The amplification refractory mutation system (ARMS) is a commonly used amplification system for identifying gene mutation sites. Its basic principle is that if the 3′ base of the primer is not complementary to the template base, it cannot be extended using a conventional thermostable DNA polymerase. Therefore, primers are designed based on known mutation sites, with their 3′ bases complementary to both the mutated and normal template bases. Combined with TaqMan fluorescent probes, the difference in the amount of PCR amplification products is monitored to distinguish between wild-type and mutant templates. In summary, ARMS utilizes specific primers for highly precise PCR amplification of the mutant target sequence, while simultaneously using probes to detect the amplification products. This allows for the detection of rare mutations in cell-free DNA on a real-time quantitative PCR platform, achieving high specificity and sensitivity for gene mutation detection.
[0005] ctDNA carrying tumor-specific mutations in the blood consists of randomly fragmented, cell-free DNA segments with an average length of 70–170 bp. In traditional ARMS amplification systems, ctDNA fragments near the mutation sites cannot be detected as templates, limiting the sensitivity of ARMS in detecting ctDNA mutations. Therefore, the sensitivity of this technology in detecting cell-free ctDNA fragments needs improvement. Summary of the Invention
[0006] The main objective of this invention is to provide a kit and method for detecting ctDNA mutation sites to solve the problem of low sensitivity in the detection of free ctDNA fragments in existing technologies.
[0007] To achieve the above objectives, the present invention provides an amplification method for detecting cell-free ctDNA mutation sites. Specifically, the present invention provides an auxiliary template, which complements one side of the ctDNA sequence containing the mutation site. The ctDNA sequence containing the mutation site is then paired with the auxiliary template to extend, forming a longer target sequence containing the mutation site. The target sequence is then detected using conventional ARMS-PCR technology.
[0008] Furthermore, when using the amplification method provided by this invention to detect cell-free ctDNA fragments containing mutation sites in tumors, this invention provides the following amplification reagents, including ARMS primer pairs, fluorescent probes, and auxiliary templates. The auxiliary template sequence is inversely complementary to the gene sequence containing the mutation site in tumor cells and is 25-40 bases shorter than the ctDNA sequence containing the mutation site.
[0009] Furthermore, since the length of the ctDNA fragment containing the mutation site is approximately 70-170 bases, the designed helper template is complementary to the 3' end of the ctDNA sequence containing the mutation site in tumor cells by 30-145 bases. The first base at the 3' end of the helper template is complementary to the base adjacent to the mutation site in the ctDNA sequence. This technique aims to amplify a sufficiently long target sequence by adding a helper template, using the ctDNA containing the mutation site as a primer, so that it can be used as a template for mutation site detection in the next reaction. A specific schematic diagram is shown below. Figure 1 As shown.
[0010] Furthermore, the ARMS primer pair includes a mutant ARMS forward primer. The 3' end base of the mutant ARMS forward primer is complementary to the target sequence containing the mutation site. The first base at the 3' end of the forward primer is complementary to the base at the mutation site of the free ctDNA, which is different from the wild-type template, thereby distinguishing the wild-type template from the mutant template. The 2nd to 4th positions of the 3' end of the mutant ARMS forward primer have 1 to 2 mismatched bases, preferably the 3rd and / or 4th positions are mismatched bases.
[0011] Furthermore, the ARMS primer pair also includes a reverse primer, which is inversely complementary to the target sequence containing the mutation site along the auxiliary template of the ctDNA sequence.
[0012] Furthermore, the fluorescent probe is complementary to the target sequence containing the mutation site, with the middle position of the probe sequence being complementary to the mutated base of the target sequence containing the mutation site. One end of the fluorescent probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescent quencher group. The fluorescent reporter group is selected from any of the following: FAM, HEX, VIC, CY3, ROX, TEXAS RED, CY5; the fluorescent quencher group is selected from any of the following: TAMRA, BHQ1, Dabcyl, QYS-7, BHQ2.
[0013] The technical solution proposed in this invention is to provide an auxiliary template. In a specific detection system, if the free ctDNA contains a mutation site, this portion of ctDNA will preferentially pair with its complementary fragment (i.e., the added auxiliary template) to extend, forming a longer target sequence containing the mutation site, thereby increasing the amount of mutation template in the entire system. In the next reaction, the amount of mutation template is enriched and amplified using ARMS mutation primers, and the probe will specifically hybridize to more mutation target sequences. When the primer-mediated extension reaction reaches the probe position, Taq enzyme will cleave the probe from the 5' end through its 5'-3' exonuclease activity, causing the fluorescent group to emit autofluorescence, thereby improving the detection sensitivity.
[0014] As some specific implementation methods, optionally, the gene and mutation site are selected from any of the following: EGFRL858R, BRAF V600E, KIT T670I, BRAF V600K, ABL1 T315I, IDH1 R132, EGFR S768I, EGFRT790M, KRAS G12C.
[0015] As a specific embodiment, the auxiliary template sequence for detecting the EGFR L858R site in this invention is: GACCTAAAGCCACCTCCTTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCC.
[0016] The present invention also provides a kit comprising any of the amplification reagents disclosed herein.
[0017] Furthermore, in the kit provided by the present invention, 1 µL of 0.1 µM auxiliary template is used in every 20 µL reaction system, and the preferred mass of ctDNA template is 0.5 ng to 1 ng.
[0018] Advantages of this invention:
[0019] In the detection of cell-free DNA mutation sites, compared with the conventional AMRS amplification system, this invention only requires the design of one additional suitable auxiliary template to solve the problem that conventional PCR amplification systems cannot detect ctDNA fragments containing mutation sites. An auxiliary template is designed to target the mutation site in genomic DNA, serving as the template in the reaction system. The target sequence containing the mutation site acts as a primer, extending along the auxiliary template to amplify a longer target sequence containing the mutation site. In subsequent reactions, the newly amplified target sequence containing the mutation site serves as a template, and the designed mutation primers and TaqMan probes are added to amplify the captured fluorescence signal, enabling more sensitive differentiation between cell-free point mutation target sequences and normal DNA sequences in plasma.
[0020] In conventional PCR detection methods, the complexity and integrity of the template, the purity of the primers and their binding efficiency to the template, the reaction temperature, the thermostability and amplification performance of the DNA polymerase, the ionic composition of the reaction buffer, and reaction optimizers all affect the sensitivity of quantitative real-time PCR. However, these influencing factors cannot be considered fundamental factors in the detection of mutation sites in cell-free ctDNA. Because the concentration of cell-free ctDNA in plasma is low and the fragments are small, especially breaks near mutation sites, these mutation sites may be undetectable. The amplification system designed in this invention solves this technical problem by adding an auxiliary template, thereby improving the detection sensitivity of cell-free ctDNA in plasma.
[0021] In terms of usage, the amplification system provided by this invention has a short detection time, high efficiency, low cost, and higher detection sensitivity than traditional ARMS primers. This technology of the present invention has high reference value for detecting tumor-specific mutation sites in cell-free DNA in plasma. Attached Figure Description
[0022] Figure 1 The schematic diagram of the amplification design of this invention.
[0023] Figure 2 The diagram shows the design concept for EGFR amplification.
[0024] Figure 3 The specificity detection results of the amplification method of this invention are shown in the figure.
[0025] Figure 4 Example 1: Sensitivity results of lung cancer cell DNA and fragmented DNA.
[0026] Figure 5 Figure showing the sensitivity detection results of the amplification method in Example 1.
[0027] Figure 6 Example 2: Sensitivity results of lung cancer cell DNA and fragmented DNA.
[0028] Figure 7 Example 2: Sensitivity detection results of the amplification method.
[0029] Figure 8 Example 3: Sensitivity results of lung cancer cell DNA and fragmented DNA.
[0030] Figure 9 Example 3: Sensitivity detection results of the amplification method.
[0031] Figure 10 Example 4: Sensitivity results of lung cancer cell DNA and fragmented DNA.
[0032] Figure 11 Example 4: Sensitivity detection results of the amplification method. Detailed implementation method:
[0033] The advantages and features of this disclosure, as well as the methods for carrying out the invention, will become clearer upon reference to the following embodiments in conjunction with the accompanying drawings. However, these embodiments should not be construed as limiting the scope to those set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
[0034] If the reagents used in the process do not specify specific conditions, they shall be carried out under the usual conditions or the conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments used do not specify the manufacturers, they can be obtained from commercially available products.
[0035] Unless otherwise defined, all terms (including technical and scientific terms) in this specification may be defined as commonly understood by one of ordinary skill in the art to which this disclosure pertains. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having meanings consistent with their meanings in the context of this disclosure and the relevant field, and will be interpreted in a non-idealized or overly formal sense unless clearly defined herein.
[0036] Example 1
[0037] Quantitative PCR was used to detect the EGFR L858R mutation site in lung cancer.
[0038] The amplification method designed in this invention can be used to detect various mutation sites in cell-free ctDNA. This invention focuses on the EGFR L858R mutation site in lung cancer. The specific process is as follows:
[0039] According to the NCBI database, the sequence near the EGFR L858R mutation site in lung cancer is as follows:
[0040] TTCTCTGTTTCAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCAT GTCAAGATCACAGATTTTGGGCGGGCCAAACTGCTGGGTGCGGAAGAGAA AGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCTTTAGGTCAGC CAGCATTTTCCTGACACCAGGGACCAGGCTGCCTTCCCACTAGCTGTATTGTTTAACAC ATGCAGGGGAGGATGCTCTCCAG
[0041] 1. Design of specific primers, probes, and auxiliary templates: The auxiliary template sequences, primer sequences, and probe sequences designed based on existing mutation site sequences are as follows.
[0042] The amplification design concept described in this invention is as follows: Figure 2 The specific base sequence information is as follows:
[0043] The auxiliary template sequence is shown below:
[0044] GACCTAAAGCCACCTCCTTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCC
[0045] Primer sequences:
[0046] L858R - Upstream primer: TCAAGATCACAGATTTTGCACG
[0047] L858R - Downstream primer: GACCTAAAGCCACCTCCTTACTT
[0048] Probe sequence: 5' FAM-AGCAGTTTGGCCTGCCCAAAATCTG -BHQ 3'
[0049] All primers and probes were synthesized by Shanghai Jierui Biotechnology Co., Ltd.
[0050] 2. Experimental Methods
[0051] Experimental materials: Lung cancer cells 1975 (confirmed to contain EGFR L858R mutation) and normal whole blood cells (confirmed to be free of mutation) were included in this study. The fragmented genomic DNA of lung cancer cells 1975 simulated cell-free ctDNA in human blood.
[0052] 3. Experimental steps:
[0053] 1) Sample collection: Lung cancer cells were collected in RNase-free EP tubes; venous blood from healthy individuals was collected in DNA collection tubes.
[0054] 2) DNA extraction:
[0055] Cellular genomic DNA or normal whole blood DNA was analyzed using the Magen (D6312-02) kit, with the following specific steps:
[0056] a) Take 200µL of cell suspension or 200µL of plasma, add 20µL of proteinase K and 200µL of buffer AL, and incubate at 70℃ with shaking for 10 min.
[0057] b) Add 40µL of magnetic beads and 600µL of MLF, and let stand for 8 minutes;
[0058] c) Then place on a magnetic rack, discard the supernatant, and retain the precipitate. Add 600 µL of MW1, vortex, and place on a magnetic rack;
[0059] d) After the solution becomes clear and transparent, discard the supernatant, keep the precipitate, add MW2, vortex again, and place it on a magnetic rack;
[0060] e) Repeat step d);
[0061] f) Discard the supernatant, keep the precipitate, dry it at 56℃ for 3 minutes, and wait until the residual liquid is completely discarded and the surface is matte;
[0062] g) Elute with 100µL ddH2O, and determine the concentration and purity;
[0063] h) A portion of the obtained DNA solution was stored at low temperature (i.e., the sample was not broken), while the other portion of the DNA was broken into fragments of about 70~170bp.
[0064] i) The specific steps for DNA fragmentation are as follows: Place the obtained DNA solution in a DNA ultrasonic fragmentation instrument (SCIENTZ18-A), set the temperature to 4℃, and set the parameters as follows (ultrasonic on for 30 s, ultrasonic off for 30 s, power 300 W, total ultrasonic time 30 min). After ultrasonication is completed, take the DNA sample and detect it in 2% agarose gel electrophoresis. Cut the gel and recover the DNA fragments of 70~170bp. The specific steps are performed according to the operation steps of the agarose gel DNA recovery kit (DP210830). After recovery, store it at low temperature or at -20℃ (i.e., fragmented DNA sample) for further research.
[0065] 3) Specificity detection of the amplification system: Negative control 1 consisted of primers + probe + auxiliary template + water; negative control 2 consisted of primers + probe + auxiliary template + fragmented DNA from normal whole blood; the experimental group consisted of primers + probe + auxiliary template + fragmented DNA from lung cancer cells. The specific reaction system is shown in the table below. If negative control 1 and negative control 2 show no amplification curve, while the experimental group shows an amplification curve, then the amplification system is considered specific and can be used for subsequent experimental detection.
[0066] The quantitative PCR amplification system used was AceQ qPCR Probe Master Mix (Q112-02), as shown in Table 1 below:
[0067] Table 1 Preparation of Reaction Reagents
[0068]
[0069] The templates were, in order, water, fragmented DNA from whole blood of a normal person, and fragmented DNA from lung cancer cells.
[0070] The specific reaction conditions are as shown in Table 2 below:
[0071] Table 2 TaqMan Real-Time PCR Reaction Conditions
[0072]
[0073] 4) Example of the technical problem to be solved by the present invention: Take lung cancer cell DNA samples of the same mass, with fragmented and unfractured samples, add primers and TaqMan probes for amplification, add 0.5 ng of template, and the specific reaction system and reaction conditions are the same as those in step 3) above, and place them in a qRT-PCR instrument for detection.
[0074] 5) Experimental verification of the amplification system designed in this invention in solving the above-mentioned technical problems:
[0075] The experimental group consisted of fragmented genomic DNA samples from lung cancer cells, primers, TaqMan probes, and auxiliary templates; the negative control group consisted of fragmented genomic DNA samples from lung cancer cells, primers, and TaqMan probes, with a template mass of 0.5 ng. The specific experimental steps are shown in section 3) above.
[0076] 4. Experimental Results:
[0077] a) Results Figure 3 The results of the amplification method specificity test showed that negative control 1 and negative control 2 had no amplification curves, while the experimental group (lung cancer cell fragmented DNA) had an amplification curve, indicating that the amplification system was specific enough and could be used for subsequent experimental testing.
[0078] b) Results Figure 4 The results show that in a reaction system with a template mass of 0.5 ng, the Ct value of fragmented DNA from lung cancer cells is higher (CT=34.64) compared to genomic DNA from lung cancer cells (CT=33.90), indicating that DNA fragmentation affects amplification efficiency, i.e., reduces detection sensitivity.
[0079] c) Results Figure 5 In a reaction system with a template mass of 0.5 ng, the Ct value of the experimental group (DNA fragmentation sample + primer + TaqMan probe) was significantly lower (CT=31.61) compared to the negative control group (DNA fragmentation sample + primer + TaqMan probe + auxiliary template), indicating that the amplification method in this invention can significantly increase the concentration of free ctDNA fragments containing mutation sites in tumor cells, thereby improving detection sensitivity.
[0080] Example 2
[0081] The mutation site and reaction system from Example 1 were selected, and the template mass was set to 1 ng.
[0082] 1) Example of technical challenge: Take lung cancer cell DNA samples of the same mass, with fragmented and unfractured samples for comparison, add primers and TaqMan probes for amplification, add 1 ng of template mass, and the specific reaction system and reaction conditions are as shown in Example 1.
[0083] 2) Experimental verification of the amplification method designed in this invention to solve the above-mentioned technical problems:
[0084] The experimental group consisted of fragmented genomic DNA samples from lung cancer cells, primers, TaqMan probes, and auxiliary templates; the negative control group consisted of fragmented genomic DNA samples from lung cancer cells, primers, and TaqMan probes, with a template mass of 1 ng. Specific experimental procedures are shown in Example 1.
[0085] Experimental results
[0086] a) Results Figure 6 In a reaction system with a template mass of 1 ng, the CT value of fragmented DNA from lung cancer cells was higher (CT=33.59) compared to that of genomic DNA from lung cancer cells (CT=31.86).
[0087] b) Results Figure 7 In a reaction system with a template mass of 1 ng, the Ct value of the experimental group (DNA fragmentation sample + primer + TaqMan probe) was significantly lower (CT=31.07) compared to the negative control group (DNA fragmentation sample + primer + TaqMan probe + auxiliary template), indicating that the amplification method in this invention can effectively improve the detection sensitivity of free ctDNA containing mutation sites.
[0088] Example 3
[0089] The mutation site and reaction system from Example 1 were selected, and the template mass was set to 0.1 ng.
[0090] 1. Example of technical challenge: Compare lung cancer cell DNA samples of the same mass with and without DNA fragmentation, add primers and TaqMan probes for amplification, add 0.1 ng of template, and the specific reaction system and reaction conditions are as shown in Example 1.
[0091] 2. Experimental verification of the amplification method designed in this invention to solve the above-mentioned technical problems:
[0092] The experimental group consisted of lung cancer cell genomic DNA fragments, primers, TaqMan probes, and auxiliary templates; the negative control group consisted of lung cancer cell genomic DNA fragments, primers, and TaqMan probes, with a template mass of 0.1 ng. Specific experimental procedures are shown in Example 1.
[0093] Experimental results
[0094] c) Results Figure 8 In a reaction system with a template mass of 0.1 ng, the CT value of fragmented DNA from lung cancer cells was higher (CT=36.94) compared to that of genomic DNA from lung cancer cells (CT=35.54).
[0095] d) Results Figure 9 In a reaction system with a template mass of 0.1 ng, the Ct value of the experimental group (DNA fragmentation sample + primer + TaqMan probe) was significantly lower (CT=32.94) compared to the negative control group (DNA fragmentation sample + primer + TaqMan probe + auxiliary template), indicating that the amplification method in this invention can effectively improve the detection sensitivity of free ctDNA containing mutation sites.
[0096] Example 4
[0097] The mutation site and reaction system from Example 1 were selected, and the template mass was set to 2.5 ng.
[0098] 1. Example of technical challenge: Compare lung cancer cell DNA samples of the same mass with and without DNA fragmentation, add primers and TaqMan probes for amplification, add 2.5 ng of template, and the specific reaction system and reaction conditions are as shown in Example 1.
[0099] 2. Experimental verification of the amplification method designed in this invention to solve the above-mentioned technical problems:
[0100] The experimental group consisted of lung cancer cell genomic DNA fragments, primers, TaqMan probes, and auxiliary templates; the negative control group consisted of lung cancer cell genomic DNA fragments, primers, and TaqMan probes, with a template mass of 2.5 ng. Specific experimental procedures are shown in Example 1.
[0101] Experimental results
[0102] e) Results Figure 10 In a reaction system with a template mass of 2.5 ng, the CT value of fragmented DNA from lung cancer cells was higher (CT=31.65) compared to that of genomic DNA from lung cancer cells (CT=30.90).
[0103] f) Results Figure 11In a reaction system with a template mass of 2.5 ng, the Ct value of the experimental group (DNA fragmentation sample + primer + TaqMan probe) was significantly lower (CT=31.57) compared to the negative control group (DNA fragmentation sample + primer + TaqMan probe + auxiliary template), indicating that the amplification method in this invention can effectively improve the detection sensitivity of free ctDNA containing mutation sites.
[0104] In summary, when the auxiliary template is 0.1µM, the system with a template mass of 0.5~1ng has the best amplification effect. That is, under the amplification concept of this invention, the auxiliary template mass can be set in the range of 0.5~1ng per 20µL reaction system.
[0105] The above embodiments are merely examples to clearly illustrate the application and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations. However, obvious variations or modifications derived therefrom are still within the scope of protection of the claims of this patent application.
Claims
1. An amplification method for detecting cell-free ctDNA mutation sites, characterized in that, An auxiliary template is provided, which complements one side of the ctDNA sequence containing the mutation site; The ctDNA sequence containing the mutation site is paired with an auxiliary template to extend it, forming a longer target sequence containing the mutation site. The target sequence is then detected using ARMS-PCR technology. The helper template sequence is inversely complementary to the gene sequence containing this mutation site in the tumor cell, and its length is 25-40 bases shorter than the ctDNA sequence containing the mutation site. The auxiliary template complements the 30-145 bases extending from the 3' end of the ctDNA sequence containing the mutation site, and the first base at the 3' end of the auxiliary template is complementary to the bases adjacent to the mutation site in the ctDNA sequence containing the mutation site.
2. The amplification method according to claim 1, characterized in that, The amplification reagents used in the amplification method to detect free ctDNA mutation sites include ARMS primer pairs and fluorescent probes.
3. The amplification method according to claim 2, characterized in that, The ARMS primer pair includes a mutant ARMS forward primer. The 3' end base of the mutant ARMS forward primer is complementary to the target sequence containing the mutation site. The first base at the 3' end of the forward primer is complementary to the base at the mutation site of the ctDNA, which is different from the wild-type template, thereby distinguishing the wild-type template from the mutant template.
4. The amplification method according to claim 3, characterized in that, The mutated ARMS forward primer has 1 to 2 mismatched bases at positions 2 to 4 of the 3' end.
5. The amplification method according to claim 4, characterized in that, The ARMS primer pair also includes a reverse primer, which is inversely complementary to the target sequence containing the mutation site along the extension of the free ctDNA sequence along the helper template.
6. The amplification method according to claim 2, characterized in that, The fluorescent probe complements the target sequence containing the mutation site, and the middle position of the probe sequence is complementary to the mutated base of the target sequence containing the mutation site.
7. The amplification method according to claim 6, characterized in that, The fluorescent probe is labeled with a fluorescent reporter group at one end and a fluorescent quencher group at the other end. The fluorescent reporter group is selected from any one of the following: FAM, HEX, VIC, CY3, ROX, TEXAS RED, CY5; the fluorescent quencher group is selected from any one of the following: TAMRA, BHQ1, Dabcyl, QYS-7, BHQ2.
8. The amplification method according to any one of claims 1-7, characterized in that, The mutation sites include EGFRL858R, BRAF V600E, KIT T670I, BRAF V600K, ABL1 T315I, IDH1 R132, EGFR S768I, EGFR T790M or KRAS G12C.
9. An amplification reagent for detecting the EGFR L858R mutation site using the amplification method according to any one of claims 1-7, characterized in that, The auxiliary template sequence for detecting EGFR L858R is: GACCTAAAGCCACCTCCTTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCC.
10. A reagent kit, characterized in that, Includes the amplification reagent as described in claim 9.
11. The reagent kit according to claim 10, characterized in that, Each 20µL reaction system contains 1µL of 0.1µM auxiliary template.
Citation Information
Patent Citations
Detecting probe, method and kit for multi-target-point gene mutation, methylation modification and / or hydroxymethylation modification
CN109517819A
Low-frequency mutations enrichment sequencing method for free target DNA in plasma
US20180371453A1