Primer combinations for detecting Mycoplasma pneumoniae and its macrolide resistance sites

By designing specific primers and LNA probes combined with fluorescent quantitative PCR methods, the problems of long cycle and low sensitivity in the existing technology of Mycoplasma pneumoniae resistance detection were solved, and rapid and accurate detection of Mycoplasma pneumoniae and its resistance sites was achieved, with a detection limit of 30-50 copies/mL.

CN116287343BActive Publication Date: 2025-09-12KUNMING UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310283718.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-22
Publication Date
2025-09-12
Estimated Expiration
2043-03-22

AI Technical Summary

Technical Problem

Existing Mycoplasma pneumoniae resistance detection technologies have problems such as long detection cycle, low sensitivity and poor specificity, especially the inability to quickly and accurately detect newly emerging drug-resistant mutation sites.

Method used

Specific primers and LNA probes were designed and combined with fluorescence quantitative PCR to detect specific resistance sites (2067 and 2617) of Mycoplasma pneumoniae and its 23S rRNA. The probes were labeled with FAM, CY5 and ROX fluorescent groups to achieve rapid and accurate detection of resistance sites.

Benefits of technology

It achieves rapid, accurate and sensitive detection of Mycoplasma pneumoniae and its drug-resistant mutations, with a detection limit of 30 copies/mL for Mycoplasma pneumoniae and 50 copies/mL for drug-resistant Mycoplasma pneumoniae, with high specificity and high sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116287343B_ABST
    Figure CN116287343B_ABST
Patent Text Reader

Abstract

The present invention discloses a primer combination for detecting Mycoplasma pneumoniae and its macrolide resistance sites. The primer combination comprises: a Mycoplasma pneumoniae-specific primer and a specific probe, a Mycoplasma pneumoniae 23S rRNA site-specific primer and an LNA-modified specific probe, and a Mycoplasma pneumoniae 23S rRNA site-specific primer and an LNA-modified specific probe. The primer combination simultaneously takes into account Mycoplasma pneumoniae detection and detection of the 2067 (A / G) and 2617 (C / G) resistance sites. A detection reagent prepared using the primer combination has the advantages of high detection sensitivity, strong specificity, good repeatability, low requirements for instruments and equipment, simple operation, and short required time. The primer combination is suitable for the detection of Mycoplasma pneumoniae and its resistance sites and has great application value in clinical diagnosis and treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a fluorescent quantitative PCR method for detecting Mycoplasma pneumoniae and its macrolide drug resistance sites. Background Art

[0002] Mycoplasma pneumoniae (MP) is the pathogen of human mycoplasma pneumonia, accounting for 10-30% of community-acquired pneumonia (CAP) cases. It is mainly transmitted through droplets and can cause acute respiratory tract infection with lung infection, sometimes complicated by bronchopneumonia. Symptoms after infection include headache, fever, paroxysmal irritating cough, etc. In addition to respiratory manifestations, it can develop into refractory pneumonia with pulmonary or extrapulmonary complications. Severe mycoplasma pneumonia can also lead to death. About 25% of patients are hospitalized for extrapulmonary complications or severe pneumonia.

[0003] Mycoplasma pneumoniae strains lack a cell wall and are insensitive to drugs that affect cell wall synthesis. They are sensitive to drugs that affect bacterial protein synthesis, such as macrolides, tetracyclines, quinolones, and aminoglycosides. Macrolides are the preferred treatment for M. pneumoniae infections in children under 8 years of age due to their lower side effects and lack of contraindications compared to other drug classes. Quinolones are the preferred treatment for adults. With the widespread use and even abuse of macrolide antibiotics in recent years, the emergence of drug resistance in M. pneumoniae during treatment has attracted increasing attention. The primary mechanism of macrolide resistance in M. pneumoniae is site-specific mutations, which reduce the affinity of the antibiotic for the ribosome and lead to resistance. Sites 2063 and 2064 in the V region of the 23S rRNA domain are the most common, followed by sites 2067 and 2617 in the II region of the 23S rRNA.

[0004] At present, the detection technology of MP resistance mainly includes drug sensitivity test (Antimicrobialsusceptibility test, AST) and molecular biology technology. The AST method is not suitable for clinical diagnosis due to the long initial culture experiment cycle and low isolation and culture positive rate; the commonly used molecular biology technology is polymerase chain reaction (PCR) technology, which is simple to operate and low in cost, but sequencing requires professional institutions to complete, and the results need to wait 1-2 days. Although there are currently detection reagents for Mycoplasma pneumoniae resistance detection, there are unreasonable phenomena in the design of primer probes, which makes most detection reagents unable to achieve accurate, rapid and sensitive detection. The primer probe invented by publication number CN103820557 A can only detect sensitive strains and 2063 site mutant strains, and publication number CN106191239 A can only detect sensitive strains and 2063, 2064 site mutant strains. With the use of macrolide drugs, new drug-resistant mutation sites have been generated, and the detection of these new sites is also actively important for clinical guidance of medication. Summary of the Invention

[0005] In response to the shortcomings of existing Mycoplasma pneumoniae resistance detection, the present invention provides a primer combination for detecting Mycoplasma pneumoniae and its macrolide drug resistance sites. The present invention utilizes LAN probe technology to design specific primers and LAN probes for Mycoplasma pneumoniae 23S rRNA, achieving high-sensitivity detection of Mycoplasma pneumoniae and drug-resistant Mycoplasma pneumoniae.

[0006] The primer combinations of the present invention are as follows:

[0007] The specific primers for Mycoplasma pneumoniae are MP-F: GGTGGATCCAATACAAGTGAG and MP-R: CTGGAAGGACGACCCTGGTCC; the probe for Mycoplasma pneumoniae is: CCGGCATGAGTAACGCTT GG;

[0008] The specific primers for the 2067 position (A / G) of Mycoplasma pneumoniae 23S rRNA were 2067-F: GGCTATAGACTCGGTGAAATCC and 2067-R: CCTGATCAATATTAAGCTACAG; the probe was AGG (LNA)CCCCGTGAAGCTTTACTG;

[0009] The specific primers for the 2617 site (C / G) of Mycoplasma pneumoniae 23S rRNA are 2617-F: CGCCGATTAAAGAGATACG and GAAGCAACACTCTTCAATCTTC; the probe is GAGACAGGTTGGTCG (LNA)CTATCTAT.

[0010] The Mycoplasma pneumoniae-specific primer probe provided by the present invention can realize the detection of Mycoplasma pneumoniae. In addition, based on the sequence of the V region of the Mycoplasma pneumoniae 23SrRNA domain, a specific primer sequence for the 2067 site is designed, and based on the II region of the Mycoplasma pneumoniae 23SrRNA, a specific primer sequence for the 2617 site is designed, which can realize the detection of the two drug-resistant sites 2067 (A / G) and 2617 (C / G).

[0011] The probe for Mycoplasma pneumoniae is labeled with a FAM fluorescent group at the 5' end and a BHQ1 quencher at the 3' end; the probe for the 2067 (A / G) site is labeled with a CY5 fluorescent group at the 5' end and a BHQ2 quencher at the 3' end; the probe for the 2617 (C / G) site is labeled with a ROX fluorescent group at the 5' end and a BHQ2 quencher at the 3' end.

[0012] Another object of the present invention is to use the above primer combination in the preparation of a detection reagent for Mycoplasma pneumoniae and its macrolide resistance site, wherein the detection reagent includes the above primer combination, wild-type and mutant positive plasmids, and also includes the conventional reagents required for fluorescent quantitative PCR.

[0013] The method of the present invention for rapidly detecting Mycoplasma pneumoniae and drug-resistant mutations using the above-mentioned detection reagent is as follows:

[0014] 1. Sample types include sputum, swab, and bronchoalveolar lavage fluid;

[0015] 2. DNA extraction of samples: Tianlong Nucleic Acid Extraction and Purification Kit (Ex-DNA / RNA Virus 4.0) and Tianlong Nucleic Acid Automatic Extractor were used for DNA extraction;

[0016] 3. Using the DNA from step 2 as a template, perform single-plex fluorescence quantitative PCR detection using specific primers and probes targeting Mycoplasma pneumoniae;

[0017] The interpretation of positive test results includes the following: (1) If the CT value of the FAM fluorescent probe channel of the Mycoplasma pneumoniae probe sequence is greater than 36, Mycoplasma pneumoniae is reported as positive. (2) If the CT value of the CY5 fluorescent probe channel of the Mycoplasma pneumoniae 23S rRNA 2067 site is less than 36, Mycoplasma pneumoniae is reported as a mutant type with the presence of the 2067 (A / G) drug-resistant mutation; if the CT value is greater than 36 or NA, it is wild type. (3) If the CT value of the ROX fluorescent probe channel of the Mycoplasma pneumoniae 23S rRNA 2617 site is less than 36, Mycoplasma pneumoniae is reported as a mutant type with the presence of the 2617 (C / G) drug-resistant mutation; if the CT value is greater than 36 or NA, it is wild type. (4) The amplification curve shows a standard "S" shape with no abnormal fluctuations.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] The primers and LNA probes provided by the present invention have good specificity. Combined with the real-time PCR detection method, they can achieve rapid, accurate, and sensitive detection of Mycoplasma pneumoniae and its drug-resistant mutations. Experiments have shown that the primers and probes of the present invention have a minimum detection limit of 30 copies / mL for Mycoplasma pneumoniae and a minimum detection limit of 50 copies / mL for drug-resistant forms of Mycoplasma pneumoniae. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The results are for the universal real-time PCR annealing temperature (60°C) for Mycoplasma pneumoniae;

[0021] Figure 2 The result is the universal real-time PCR annealing temperature (65°C) for Mycoplasma pneumoniae;

[0022] Figure 3 The results of the real time PCR annealing temperature (55°C) of the drug resistance site of Mycoplasma pneumoniae 2067 are shown;

[0023] Figure 4 The results of the real-time PCR annealing temperature (60°C) of the drug-resistant site of Mycoplasma pneumoniae 2067 are shown;

[0024] Figure 5 The results are the real time PCR annealing temperature (60°C) of the drug resistance site of Mycoplasma pneumoniae 2617;

[0025] Figure 6 The results are the real time PCR annealing temperature (65°C) of the drug resistance site of Mycoplasma pneumoniae 2617;

[0026] Figure 7 The results of 2067 drug-resistant sites detected in 10 patients suspected of Mycoplasma pneumoniae infection;

[0027] Figure 8 These are the detection results of 2617 drug-resistant sites in 10 patients suspected of Mycoplasma pneumoniae infection. DETAILED DESCRIPTION

[0028] The present invention is further described below with reference to the examples, but the implementation and protection of the present invention are not limited thereto. It should be noted that if there are any processes not specifically described below, they can be implemented or understood by those skilled in the art with reference to the prior art; the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0029] Example 1: Design of primers and probes

[0030] 1. Download the reference sequence of Mycoplasma pneumoniae standard strain from the NCBI (National Center for Biotechnology Information) website;

[0031] 2. Use Mega 6 software to align the nucleotide sequences and Primer Select software to design primers and probes.

[0032] 3. Primer and probe BLAST evaluation: The nucleotide sequences of the primers and probes that have been preliminarily designed are compared again using the BLAST search function on the NCBI website to select primers and probe sequences with high specificity;

[0033] 4. The specific probe targeting 2067 (A / G) and 2617 (C / G) was modified with LNA at sites 2067 and 2617, so that the probe can only bind to the mutant template and an amplification curve is present. On the contrary, it does not bind to the wild-type template and no amplification curve is present.

[0034] The nucleotide sequences of the specific primers and probes targeting the Mycoplasma pneumoniae pathogen and the 2067 / 2617 mutation site are shown in Table 1:

[0035] Table 1 Mycoplasma pneumoniae primer and probe sequence information

[0036] Primer name Primer sequence (5'-3') MP-F 5'-GGTGGATCCAATACAAGTGAG-3' MP-R 5'-CTGGAAGGACGACCCTGGTCC-3' MP-P 5'-FAM-CCGGCATGAGTAACGCTTGG-BHQ1-3' 2067-F 5'-GGCTATAGACTCGGTGAAATCC-3' 2067-R 5'-CCTGATCAATATTAAGCTACAG-3' 2067(G)-P 5'CY5-AGG(LNA)CCCCGTGAAGCTTTACTG-BHQ2-3' 2617-F 5'-CGCCGATTAAAGAGATACG-3' 2617-R 5'-GAAGCAACACTCTTCAATCTTC-3' 2617(G)-P 5'-ROX-GAGACAGGTTGGTCG(LNA)CTATCTAT-BHQ2-3' .

[0037] Example 2: Establishment of a Real-time PCR Method for Mycoplasma pneumoniae and Its Drug-Resistant Mutation Sites

[0038] 1. Plasmid construction

[0039] Beijing Qingke Biotechnology Co., Ltd. constructed Mycoplasma pneumoniae-positive plasmids, 2067(A) wild-type plasmid, 2067(G) mutant-positive plasmid, 2617(C) wild-type plasmid, and 2617(G) mutant-positive plasmid by ligating Mycoplasma pneumoniae-specific sequences SEQ ID NO:1-SEQ ID NO:5 with the pUC57 vector. The copy number of the plasmid was calculated based on the plasmid length and concentration using the following formula:

[0040]

[0041] 2. Optimization of annealing temperature for real-time PCR reaction

[0042] We used Mycoplasma pneumoniae positive plasmid, 2067(A) wild-type plasmid, 2067(G) mutant positive plasmid, 2617(C) wild-type plasmid, and 2617(G) mutant positive plasmid as templates, respectively. The template concentration was 10 3 The real-time PCR reaction was carried out, the reaction conditions and primer annealing temperature were optimized, and three annealing temperatures of 55°C, 60°C, and 65°C were set for testing. The Pro Taq HS premixed probe qPCR kit from Acry Biotech was used for real-time PCR detection.

[0043] The Mycoplasma pneumoniae detection reaction system is as follows:

[0044]

[0045] The 2067(A / G) reaction system is as follows:

[0046]

[0047] Note: Two reaction systems were prepared, and the 2067(A) wild-type and 2067(G) mutant positive plasmids were added for testing respectively.

[0048] The 2617 (C / G) reaction system is as follows:

[0049]

[0050] Note: Two reaction systems were prepared, and the 2617(C) wild type and 2617(G) mutant positive plasmids were added for testing respectively.

[0051] The reaction system was configured and detected using a Biori FQD-96a real-time fluorescence quantitative PCR instrument. The real-time PCR reaction program was set as follows: pre-denaturation at 95°C for 1 min, denaturation at 95°C for 10 s, annealing and extension at 60°C for 30 s, extension at 72°C for 10 s, and 40 cycles. Fluorescence signals were collected during the extension phase of each cycle in the second round, and the annealing temperature was optimized at 55°C-65°C.

[0052] The optimization results of primer annealing temperature for Mycoplasma pneumoniae are as follows Figure 1 、 2 As shown, 60°C has better amplification efficiency than 65°C, so 60°C was used.

[0053] The results of the 2067(A / G) resistance site test are as follows Figure 3 、 4As shown in the figure, when the annealing temperature is 55°C, amplification curves are present in the PCR reactions in which the 2067(A) and 2067(G) positive plasmids are added, respectively. At this time, it is impossible to distinguish whether the 2067 site has mutated. When the annealing temperature is 60°C, amplification curves are present only in the PCR reaction in which the 2067(G) positive plasmid is added, while no amplification curve is present in the PCR reaction system in which the 2067(A) positive plasmid is added, indicating the presence of the 2067(A / G) drug-resistant mutation.

[0054] 2617(C / G) resistance site test results are as follows Figure 5 、 6 As shown in the figure, when the annealing temperature was 60℃ and 65℃ respectively, in the PCR reactions with the addition of 2617(C) and 2617(G) positive plasmids, only 2617(G) had an amplification curve, while no amplification curve was found in the PCR reaction system with the addition of 2617(C) positive plasmid, indicating the presence of a 2617(C / G) drug-resistant mutation; however, the amplification efficiency at 65℃ was lower than that at 60℃, so 60℃ was selected.

[0055] The final real-time PCR reaction program was determined as follows: pre-denaturation at 95°C for 1 min, denaturation at 95°C for 10 s, annealing and extension at 60°C for 30 s, and extension at 72°C for 10 s, for 40 cycles. Fluorescence signals were collected during the extension phase of each cycle in the second round.

[0056] Example 3: Feasibility study of primer-probe combinations for Mycoplasma pneumoniae and its drug resistance sites

[0057] 1. Limit of Detection (LOD) Test

[0058] In order to take into account both the qualitative detection of Mycoplasma pneumoniae and the detection of 2067 (A / G) and 2617 (C / G) resistance sites, this embodiment uses the following combinations: ① Mycoplasma pneumoniae + 2067 (A / G), that is, the probe mixture: MP-P + 2067 (A / G)-P, the upstream primer mixture: MP-F + 2067-F, the downstream primer mixture: MP-R + 2067-R, ② Mycoplasma pneumoniae + 2617 (C / G), that is, the probe mixture: MP-P + 2617 (C / G)-P, the upstream primer mixture: MP-F + 2617-F, the downstream primer mixture: MP-R + 2617-R; the dual nucleic acid detection reagent for Mycoplasma pneumoniae and drug-resistant Mycoplasma pneumoniae is prepared as follows:

[0059]

[0060] (2) Sample preparation

[0061] The positive plasmid constructed in Example 2 was gradiently diluted to prepare Mycoplasma pneumoniae universal positive plasmid, 2067 (A / G) positive plasmid and 2617 (C / G) positive plasmid at concentrations of 200 copies / mL-10 copies / mL.

[0062] (3) Sample testing

[0063] The prepared positive plasmid samples of different concentrations were prepared according to the above reaction system and tested according to the reaction program optimized in Example 2. That is, the real-time PCR reaction program was: 95°C pre-denaturation for 1 min, 95°C denaturation for 10 s, 60°C annealing and extension for 30 s, 72°C extension for 10 s, 40 cycles, and fluorescence signals were collected during the extension phase of each cycle in the second round.

[0064] Note: At this time, the templates added are: combination ①: Mycoplasma pneumoniae positive plasmid + 2067 (A / G) positive plasmid mixed in equal proportions; combination ②: Mycoplasma pneumoniae positive plasmid + 2617 (C / G) positive plasmid mixed in equal proportions.

[0065] (4) Result analysis

[0066] The primer-probe combination designed in Example 1 and the detection method of Example 2 were used to perform dual nucleic acid detection of Mycoplasma pneumoniae and its drug-resistant Mycoplasma pneumoniae samples at various concentration gradients. The detection sensitivity (LOD) of this detection method was 30 copies / mL for Mycoplasma pneumoniae and 50 copies / mL for drug-resistant Mycoplasma pneumoniae. Specific data are shown in Tables 2 and 3.

[0067] Table 2: Confirmation of detection limits for Mycoplasma pneumoniae

[0068] Sample concentration (copies / mL) Detection repeat number Number of positive tests Positive detection rate 10 12 0 0.0% 20 12 8 66.7% 30 12 12 100.0% 50 12 12 100.0% 100 12 12 100.0% 200 12 12 100.0% ;

[0069] Table 3: Confirmation of detection limits for 2067 (A / G) and 2617 (C / G) resistant Mycoplasma pneumoniae

[0070] Sample concentration (copies / mL) Detection repeat number Number of positive tests Positive detection rate 10 12 0 0.0% 20 12 4 33.33% 30 12 9 75.0% 50 12 12 100.0% 100 12 12 100.0% 200 12 12 100.0% ;

[0071] 2. Cross-reactions with other diseases

[0072] (1) Sample selection and DNA extraction

[0073] Clinical samples of wild-type Mycoplasma pneumoniae, drug-resistant Mycoplasma pneumoniae, Staphylococcus aureus, drug-resistant Staphylococcus epidermidis (MRSE), Corynebacterium diphtheriae, Haemophilus influenzae, Streptococcus pneumoniae, Escherichia coli, and Candida albicans were collected, and 200 μL of the collected clinical samples were taken for nucleic acid extraction and purification. The nucleic acid extraction kit used was the Tianlong Nucleic Acid Extraction and Purification Kit (Ex-DNA / RNA Virus 4.0), and the instrument used was the Tianlong Nucleic Acid Automatic Extractor for DNA extraction.

[0074] (2) Detection

[0075] The sample extracted in step (1) was subjected to real-time PCR detection according to the following reaction system and reaction procedure. The reaction system is as follows:

[0076]

[0077] Reaction procedure:

[0078] The real-time PCR reaction procedures for combination ① and combination ② were as follows: pre-denaturation at 95°C for 1 min, denaturation at 95°C for 10 s, annealing and extension at 60°C for 30 s, and extension at 72°C for 10 s, for 40 cycles. Fluorescence signals were collected during the extension phase of each cycle in the second round.

[0079] (3) Result analysis:

[0080] The above-mentioned real-time PCR detection method was used to detect Mycoplasma pneumoniae, drug-resistant Mycoplasma pneumoniae, and other pathogens. The results showed that the detection method of the present invention was positive for Mycoplasma pneumoniae-positive samples. If the sample was wild-type Mycoplasma pneumoniae, there was no amplification curve, indicating a negative result. If it was a mutant Mycoplasma pneumoniae, an amplification curve appeared, indicating a positive result. In addition, the detection method had no cross-reaction with samples infected with pathogens such as Staphylococcus aureus, drug-resistant Staphylococcus epidermidis (MRSE), Corynebacterium diphtheriae, Haemophilus influenzae, Streptococcus pneumoniae, Escherichia coli, and Candida albicans, indicating its high specificity. Specific results are shown in Table 4.

[0081] Table 4 Cross-reaction test results

[0082] Sample name Test results Sample name Test results Mycoplasma pneumoniae Positive Drug-resistant Staphylococcus epidermidis (MRSE) Negative Wild-type Mycoplasma pneumoniae Negative Corynebacterium diphtheriae Negative Mutant Mycoplasma pneumoniae Positive Haemophilus influenzae Negative Staphylococcus aureus Negative Streptococcus pneumoniae Negative Escherichia coli Negative Candida albicans Negative .

[0083] Example 4: Preliminary clinical validation of the Mycoplasma pneumoniae and its resistance site primer probe combination of the present invention

[0084] 1. Ten samples suspected of being positive for Mycoplasma pneumoniae were collected from the hospital. The sample types included sputum, swabs, and bronchoalveolar lavage fluid.

[0085] 2. DNA extraction of samples: Tianlong Nucleic Acid Extraction and Purification Kit (Ex-DNA / RNA Virus 4.0) and Tianlong Nucleic Acid Automatic Extractor were used for DNA extraction;

[0086] 3. Using the DNA from step 2 as a template, real-time PCR detection was performed using specific primers and probes targeting Mycoplasma pneumoniae. The reaction system was prepared as in Example 3.

[0087] (4) Result analysis

[0088] The interpretation of positive test results includes the following: (1) If the CT value of the FAM fluorescent probe channel is less than 36, the Mycoplasma pneumoniae is reported to be positive. (2) If the CT value of the CY5 fluorescent probe channel is less than 36, the Mycoplasma pneumoniae is reported to be a mutant type with the presence of the 2067 (A / G) drug-resistant mutation; if the CT value is greater than 36 or NA, the Mycoplasma pneumoniae is reported to be wild type. (3) If the CT value of the ROX fluorescent probe channel is less than 36, the Mycoplasma pneumoniae is reported to be a mutant type with the presence of the 2617 (C / G) drug-resistant mutation; if the CT value is greater than 36 or NA, the Mycoplasma pneumoniae is reported to be wild type. (4) The amplification curve shows a standard "S" shape with no abnormal fluctuations.

[0089] The results of the sample test of 10 patients suspected of Mycoplasma pneumoniae showed that 7 cases were positive for Mycoplasma pneumoniae and 3 cases were negative. Among them, there were 3 patients with 2067 (A / G) resistance and 1 patient with 2617 (C / G) resistance, and one patient was dual-drug resistant. The results are shown in Table 5 and Figure 7 、 Figure 8 As shown;

[0090] Table 5 Real-time PCR test results of 10 patients suspected of Mycoplasma pneumoniae infection

[0091] Sample No. Test results (CT) Whether it is drug-resistant / drug-resistant site 1 Positive (31.06) no 2 Negative — 3 Positive (27.19) no 4 Positive (15.87) Yes, 2063(A / G) 5 Positive (26.09) no 6 Negative 7 Positive (22.78) Yes, 2063(A / G) 8 Positive (22.48) Yes, 2063(A / G), 2617(C / G) 9 Negative 10 Positive (26.73) no

[0092] The above description represents only a preferred embodiment of the present invention. The real-time PCR detection method of the present invention can be used to detect clinical samples infected with Mycoplasma pneumoniae, enabling both detection of Mycoplasma pneumoniae and detection of two macrolide resistance loci, 2067 (A / G) and 2617 (C / G). This method, with its high specificity and sensitivity, can be applied to the detection of Mycoplasma pneumoniae and its resistance genes, demonstrating its valuable application in the clinical diagnosis and treatment of Mycoplasma pneumoniae.

Claims

1. A primer-probe combination for detecting Mycoplasma pneumoniae and its macrolide resistance sites, the primer-probe combination being as follows: The specific primers for Mycoplasma pneumoniae are MP-F: GGTGGATCCAATACAAGTGAG and MP-R: CTGGAAGGACGACCCTGGTCC; the probe MP-P for Mycoplasma pneumoniae is: CCGGCATGAGTAACGCT TGG; The specific primers for the 2067 site of Mycoplasma pneumoniae 23S rRNA are 2067-F: GGCTATAGACTCGGTGAAATCC and 2067-R: CCTGATCAATATTAAGCTACAG; the LNA modified probe is AGGCCCCGTG AAGCTTTACTG; The specific primers for the 2617 site of Mycoplasma pneumoniae 23S rRNA are 2617-F: CGCCGATTAAAGAGATACG and 2617-R: GAAGCAACACTCTTCAATCTTC; the LNA modified probe is: GAGACAGGTTGGTCGCTATCTAT.

2. Use of the primer-probe combination according to claim 1 in the preparation of a reagent for detecting resistance sites of Mycoplasma pneumoniae and its macrolide drugs.

Citation Information

Patent Citations

  • MP (Mycoplasma Pneumoniae) drug resistance diagnostic kit

    CN103820557A

  • Primers, probe, method and kit for detecting mycoplasma pneumoniae nucleic acid and drug-resistant mutation through real-time fluorescent PCR

    CN106191239A