A rapid detection method and application for Race 4 of Fusarium oxysporum f. sp. cubense

Abstract

The present invention relates to the field of biotechnology, and particularly to a rapid detection method for the tropical race 4 physiological race of banana wilt disease. This detection method couples the LAMP primer technology and CRISPR / Cas12a. By utilizing the characteristics of high specificity, strong sensitivity, and the ability to amplify gene sequences in large quantities in a short time of LAMP, as well as the characteristics of precise cleavage and high sensitivity of CRISPR / Cas12a, a rapid detection method for the tropical race 4 physiological race of banana wilt disease is constructed. Compared with the widely used fluorescence quantitative PCR technology at present, the technology of the LAMP-CRISPR / Cas12a coupling for detecting banana wilt disease strains in the present invention has a shorter required time, simpler experimental equipment, lower detection costs, and the sensitivity and specificity are no different from those of q-PCR, providing a simple and efficient tool for the early prevention and control of banana wilt disease.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a rapid detection method and identification system for the tropical race 4 physiological race of banana fusarium wilt, and a detection kit for fusarium oxysporum Background Art

[0002] Banana fusarium wilt, as a soil-borne disease, occurs in many countries and regions and is a key object for quarantine. At present, the methods for controlling fusarium wilt in banana production practice in China mainly include the breeding of banana fusarium wilt-resistant varieties; the development of molecular diagnostic techniques for fusarium wilt pathogens. In addition to the traditional PCR amplification using pathogen nucleic acids, there are fluorescence quantitative PCR detection methods, detection methods combining LAMP with HNB and SYBR Green I dye, LAMP-gel electrophoresis detection methods, real-time fluorescence quantitative LAMP detection methods based on RAPD marker sequences, supervised classification algorithms based on unmanned aerial vehicle multispectral remote sensing images for the identification and location of banana fusarium wilt, and the excavation of unique variable regions based on the published whole genome of banana fusarium wilt for the design of PCR-based molecular markers for Foc R1, TR4, and STR4 for specific detection; the study of the interaction mechanism of soil microenvironment flora on banana fusarium wilt resistance; the phylogeny and omics analysis of banana fusarium wilt pathogens; the screening of antagonistic bacteria, etc. However, these methods have disadvantages such as expensive experimental equipment, high difficulty coefficient, complex experimental operation, long time consumption, and high professional requirements for operators

[0003] According to the different banana varieties infected, banana fusarium wilt pathogens can be divided into 3 physiological races, namely physiological race 1 (Foc 1), physiological race 2 (Foc 2), and physiological race 4 (Foc 4). Among them, Foc 4 can be further divided into subtropical race 4 (Subtropical Race 4, Foc STR4) and tropical race 4 (Tropical Race 4, Foc TR4) according to different infection conditions. Physiological race 1 mainly infects the banana variety "Dahami" (AAA); physiological race 2 only infects triploid staple bananas (ABB) and has only been found in Central America at present; physiological race 4 has very strong pathogenicity and is pathogenic to almost all banana cultivars, seriously affecting the growth of about 50% of the global banana cultivar Cavendish (AAA). Therefore, it is of great significance to establish a rapid detection method for the tropical race 4 physiological race of banana fusarium wilt Summary of the Invention

[0004] One of the purposes of the present invention is to provide a rapid detection method for the tropical race 4 physiological race of banana fusarium wilt, which can quickly and conveniently detect the tropical race 4 physiological race of banana fusarium wilt, avoiding the deficiencies in the prior art

[0005] The second object of the present invention is to provide an identification system for the tropical race 4 physiological race of banana Fusarium wilt.

[0006] The third object of the present invention is to provide a detection kit for Fusarium oxysporum.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] Provide a rapid detection method for the tropical race 4 physiological race of banana Fusarium wilt, including

[0009] S1. Screening of specific gene sequences of the tropical race 4 physiological race of banana Fusarium wilt:

[0010] Obtain 13 GenBank Accessions of Fusarium oxysporum from the Broad Institute, download the corresponding protein sequences of Fusarium oxysporum from NCBI according to the accession numbers of GenBank Accession, preliminarily identify 16 specific protein family members of Fusarium oxysporum f. sp. cubense, and screen out 10 specific protein-coding gene sequences of Fusarium oxysporum f. sp. cubense through comparison with the NCBI NR public database, which are FOIG_05146, FOIG_07960, FOIG_03579, FOIG_04436, FOIG_05334, FOIG_07242, FOIG_15711, FOIG_16482, FOIG_16668, FOIG_16941;

[0011] Specificity verification of specific protein-coding gene sequences:

[0012] Design PCR primers for 10 specific protein-coding gene sequences for specificity verification. The experimental group is the genomic DNA of Fusarium oxysporum f. sp. cubense II5 (TR4) strain, the negative control group is the genomic DNA of the non-pathogenic strain Fo47 of Fusarium wilt which is highly homologous to it, and the blank control is double-distilled water without enzyme. Dilute the genomic DNA templates of II5 (TR4) strain and Fo47 genomic DNA, and add the PCR primers to the genomic DNA templates of II5 (TR4) strain and Fo47 genomic DNA respectively, and obtain that the specific sequence of the tropical race 4 physiological race of banana Fusarium wilt is FOIG_16668;

[0013] S2. Design of LAMP primers and crRNA:

[0014] Design LAMP primers. The sequence of the LAMP primers is as shown in SEQ ID NO: 1. The GC ratio of the LAMP primers is between 40% and 60%. The difference in Tm values between primer pairs does not exceed 5°C. The length of the amplification product is ≤280 bp. The dimer ΔG ≥ -3.5, and the primer end ΔG ≤ -4.0. Compare the designed LAMP primers with the Fusarium wilt pathogen database to ensure the uniqueness of the amplifiable fragment of the LAMP primers. Also, perform BLAST sequence alignment on the designed LAMP primer sequences to evaluate the specificity of the primers;

[0015] Design crRNA by retrieving the CRISPR / Cas12a cleavage site PAM: 5'-TTTN-3' in the sequence through CRISPR-DT. The crRNA has the following conserved repeat sequence: 5′-UAAUUUCUACUAAGUGUAGAU-3′. After this repeat sequence is a target-specific sequence, and the target-specific sequence varies according to the target gene. The target-specific sequence is as shown in SEQID NO: 2,

[0016] S3. Amplify the specific sequence FOIG_16668 of Fusarium oxysporum f. sp. cubense tropical race 4 by LAMP primers, including the following steps:

[0017] Prepare the LAMP reaction system. The LAMP reaction system includes NEB LAMP and primer mixture system. The primer mixture system includes FIP and BIP, F3 and B3, LF and LB; Fusarium wilt of banana DNA template; nuclease-free double-distilled water; Amplify at 65°C in a constant-temperature metal bath for 45 minutes to obtain the amplified specific sequence FOIG_16668;

[0018] S4. CRISPR / Cas12a-mediated cleavage, including the following steps:

[0019] Prepare the CRISPR / Cas12a-mediated cleavage system. The cleavage system includes Cas12a protein, crRNA, single-stranded DNA probe with FAM group and fluorescence quenching group, and nuclease-free double-distilled water. Place the specific sequence FOIG_16668 obtained by LAMP amplification in S3 into the CRISPR / Cas12a-mediated cleavage system and incubate in a constant-temperature metal bath at 37°C for 15 min to obtain the cleaved system;

[0020] S5. Identify the specific sequence FOIG_16668, including the following steps: Use fluorescence quantitative method, blue light method or test strip method to identify whether the specific sequence FOIG_16668 exists. If so, it indicates that the strain belongs to Fusarium oxysporum f. sp. cubense tropical race 4, where,

[0021] The blue light method uses a blue light method - ssDNA probe, and the blue light method - ssDNA probe is 6 - FAM - TTATT - BHQ1. The single - stranded DNA probe used has a BHQ - 1 fluorescence quenching group at the 3' end and a FAM fluorescence group at the 5' end.

[0022] The test strip method uses a test strip method - ssDNA probe, and the test strip method - ssDNA probe is 6 - FAM - TTATT - Biotin. The single - stranded DNA probe used has a Biotin group at the 3' end and a FAM fluorescence group at the 5' end.

[0023] In some embodiments, in step S1, the concentrations of the genomic DNA templates of II5(TR4) strain and Fo47 genomic DNA template are both diluted to 5 ng / μL. 1 μL of the genomic DNA template of II5(TR4) strain is added to a 25 - μL PCR system, and 1 μL of the Fo47 genomic DNA template is added to a 25 - μL PCR system.

[0024] In some embodiments, the LAMP primers and PCR primers are purified by the HAP method.

[0025] In some embodiments, in step S2, when performing BLAST sequence alignment on the LAMP primer sequences, the Evalue is set to 1, and the parameter - task blastn - short is added.

[0026] In some embodiments, in step S3, the volume of the LAMP reaction system is 25 μL. This LAMP reaction system includes 12.5 μL of 1×NEB LAMP, where the code of NEB LAMP is E1700S, a 1 - μM primer mixture system, where 2.5 μl of the primer mixture system includes 0.16 μM FIP and BIP, 0.02 μM F3 and B3, 0.04 μM LF and LB; 1 μL of a genomic DNA template with a concentration of 5 ng / μL, and 9 μL of enzyme - free double - distilled water.

[0027] In some embodiments, in step S4, the total volume of the CRISPR / Cas12a - mediated cleavage reaction system is 50 μL. In this cleavage reaction system, the Cas12a protein is from a Cas12a protein kit, and this Cas12a protein kit contains 5 μL of 10× buffer and 0.5 μL of 2 - μM Cas12a protein; the crRNA is 0.2 μL of 10 μM, the single - stranded DNA probe with a FAM group and a BHQ1 quenching group is 0.2 μL of 10 μM, and the enzyme - free double - distilled water is 19.1 μL.

[0028] In some embodiments, the Cas12a protein kit is selected from Guangzhou Magigene Biotechnology Co., Ltd., encoding: C001.

[0029] In some embodiments, in step S4, for the blue light method, observation and shooting are carried out using a GeneDireX LED blue light transilluminator, and the model of the GeneDireX LED blue light transilluminator is: the blue light instrument of BLOOK;

[0030] For the test strip method, a Magigene nucleic acid test strip is used for detection. The Magigene nucleic acid test strip is selected from Guangzhou Magigene Biotechnology Co., Ltd., with the number: C008.

[0031] Advantages of the usage method of the rapid detection method for Race 4 physiological race of banana Fusarium wilt of the present invention:

[0032] The present invention screens out the specific sequence of the most harmful banana Fusarium wilt strain - Race 4 physiological race through bioinformatics analysis, and couples the LAMP primer technology and CRISPR / Cas12a. By using the characteristics of high specificity, strong sensitivity, and large-scale amplification of gene sequences in a short time of LAMP, and the characteristics of precise cleavage and high sensitivity of CRISPR / Cas12a, a rapid detection method for Race 4 physiological race of banana Fusarium wilt is constructed. Compared with the currently widely used fluorescence quantitative PCR technology, the LAMP-CRISPR / Cas12a coupling technology for detecting banana Fusarium wilt strains of the present invention has a shorter required time, simpler experimental equipment, lower detection cost, and the sensitivity and specificity are no different from q-PCR. It provides a simple and efficient tool for the early prevention and control of banana Fusarium wilt, and is of great significance for the molecular biology early detection of banana Fusarium wilt, which is difficult to control, in production and epidemic prevention.

[0033] The second object of the present invention is to provide an identification system for Race 4 physiological race of banana Fusarium wilt, including the above-mentioned LAMP reaction system and the CRISPR / Cas12a-mediated cleavage system.

[0034] The third object of the present invention is to provide a Fusarium oxysporum detection kit, including the above-mentioned identification system for Race 4 physiological race of banana Fusarium wilt. Brief Description of the Drawings

[0035] Figure 1 is a flowchart of the rapid detection method for Race 4 physiological race of banana Fusarium wilt based on the LAMP-CRISPR / Cas12a technology in the embodiment.

[0036] Figure 2 is a result diagram of detecting Race 4 physiological race of banana Fusarium wilt by the LAMP-CRISPR / Cas12a technology.

[0037] Figure 3 It is the sequence of the LAMP primer.

[0038] Figure 4 It is the structural diagram of the LAMP primer.

[0039] Figure 5 They are the sequences of 10 specific protein-coding genes of Fusarium oxysporum f. sp. cubense, where II5: experimental group; Fo47: negative control, N: blank control.

[0040] Figure 6 It is the comparison diagram of the sensitivity of the LAMP-CRISPR / Cas12a detection system. Detailed implementation manners

[0041] The preferred embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. Although the preferred embodiments of the present invention are shown in the drawings, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided to make the present invention more thorough and complete, and to fully convey the scope of the present invention to those skilled in the art.

[0042] The terms used in the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The singular forms "a", "the" used in the present invention and the appended claims are intended to include the plural forms unless the context clearly dictates otherwise. It should also be understood that the term "and / or" used herein refers to and includes any and all possible combinations of one or more of the associated listed items.

[0043] It should be understood that although the terms "first", "second", "third", etc. may be used in the present invention to describe various information, such information should not be limited to these terms. These terms are only used to distinguish the same type of information from each other. For example, without departing from the scope of the present invention, the first information may also be referred to as the second information, and similarly, the second information may also be referred to as the first information. Thus, the features defined with "first" and "second" may explicitly or implicitly include one or more of such features. In the description of the present invention, "a plurality" means two or more unless otherwise specifically defined.

[0044] Example 1

[0045] The rapid detection method for the tropical race 4 of Fusarium oxysporum f. sp. cubense disclosed in this example includes

[0046] S1. Screening of the specific gene sequence of the tropical race 4 of Fusarium oxysporum f. sp. cubense:

[0047] Thirteen GenBank Accessions of Fusarium oxysporum were obtained from the Broad Institute. According to the accession numbers of GenBank Accession, the corresponding protein sequences of Fusarium oxysporum were downloaded from NCBI. Sixteen specific protein family members of Fusarium oxysporum f. sp. cubense were initially identified. Ten specific protein-coding gene sequences of Fusarium oxysporum f. sp. cubense were screened out by comparing with the NCBI NR public database, which were FOIG_05146, FOIG_07960, FOIG_03579, FOIG_04436, FOIG_05334, FOIG_07242, FOIG_15711, FOIG_16482, FOIG_16668, FOIG_16941 respectively;

[0048] Specificity verification of specific protein-coding gene sequences:

[0049] PCR primers were designed for the 10 specific protein-coding gene sequences for specificity verification. The experimental group used the genomic DNA of Fusarium oxysporum f. sp. cubense II5 (TR4) strain, the negative control group used the genomic DNA of the non-pathogenic Fusarium oxysporum strain Fo47 which is highly homologous to it, and the blank control was double-distilled water without enzyme. The genomic DNA templates of II5 (TR4) strain and Fo47 genomic DNA were diluted, and the PCR primers were added to the genomic DNA templates of II5 (TR4) strain and Fo47 genomic DNA respectively. The specific sequence of race 4 of Fusarium oxysporum f. sp. cubense was obtained as FOIG_16668;

[0050] Among them, Figure 5 it can be seen that FOIG_16668 is specific.

[0051] Design of LAMP primers and crRNA:

[0052] LAMP primers were designed. The LAMP primers were all designed by LAMP Primer Design Tool (https: / / lamp.neb.com). The sequence of the LAMP primers is shown in SEQ ID NO: 1. Figures 3 - 4As shown, suitable LAMP primers are the key to efficient amplification. Therefore, the GC ratio of the LAMP primers is between 40% and 60%, the difference in Tm values between primer pairs does not exceed 5°C, the length of the amplification product is ≤280 bp, the dimer ΔG ≥ -3.5, and the primer end ΔG ≤ -4.0. The designed LAMP primers are compared with the Fusarium wilt pathogen database to ensure the uniqueness of the amplified fragments of the LAMP primers. The designed LAMP primer sequences are also subjected to BLAST sequence alignment to evaluate the specificity of the primers. The designed primer sequences are aligned to the genome of the reference strain II5 using BLASTN. Since it is a primer alignment, the Evalue is set to 1, and the parameter -task blastn-short is added. Then, according to the alignment results, it is checked whether the primers are suitable for LAMP amplification.

[0053] There are a total of 6 LAMP primers. Figure 3 As shown, there are 8 regions on the target gene sequence, including the forward inner primer (FIP), backward inner primer (BIP), forward outer primer (F3), backward outer primer (B3), forward loop primer (LF), and backward loop primer (LB). Among them, FIP includes the F1c sequence and the F2 sequence complementary to F2c, and these two sequences are directly connected, that is, 5'-F1c-F2-3'; BIP includes the B1c sequence complementary to the B1 region and the B2 sequence, and these two sequences are directly connected, that is, 5'-B1c-B2-3'; the outer primers F3 and B3 are complementary to the F3c and B3c sequences respectively; LF and LB are loop primers, which are non-essential primers, and the purpose of the loop primers is to accelerate the reaction amplification rate. The F2 region and the B2c region are specific sequences located at both ends of the target sequence, the F1 region and the B1c region are specific sequences located inside the F2 region and the B2c region respectively, and the F3 region and the B3c region are specific sequences located outside the F2 and B2c regions respectively.

[0054] When designing LAMP primers, primers are designed according to the specific target sequence, and complete different primer sets are selected from the LAMP Primer Design Tool and specific tests should be carried out. The performance is evaluated by the rapid and accurate amplification of positive samples and the discrimination between positive and negative samples.

[0055] Design crRNA by retrieving the CRISPR / Cas12a cleavage site PAM: 5'-TTTN-3' in the sequence through CRISPR-DT (http: / / bioinfolab.miamioh.edu / CRISPR-DT / ). The crRNA has the following conserved repeat sequence: 5′-UAAUUUCUACUAAGUGUAGAU-3′. After this repeat sequence is a target-specific sequence, which varies according to the target gene. The target-specific sequence is shown as SEQ ID NO: 2. The length of the targeting sequence can vary between 18-24 nt, but does not include the PAM (TTTV), and the PAM site should be located at the 5' end of the non-complementary DNA sequence to be targeted.

[0056] S3. Amplify the specific sequence FOIG_16668 of Fusarium oxysporum f. sp. cubense tropical race 4 by LAMP primers, including the following steps:

[0057] Prepare the LAMP reaction system, which includes NEB LAMP and primer mixture system, the primer mixture system includes FIP and BIP, F3 and B3, LF and LB, DNA template of Fusarium oxysporum f. sp. cubense, and double-distilled water without enzymes; Amplify the LAMP reaction system at 65°C for 45 minutes in a constant-temperature metal bath (COYOTE, model: H2O3-PROIII) to obtain the amplified specific sequence FOIG_16668;

[0058] S4. CRISPR / Cas12a-mediated cleavage, including the following steps:

[0059] Prepare the CRISPR / Cas12a-mediated cleavage system, which includes Cas12a protein, crRNA, single-stranded DNA probe with FAM group and fluorescence quenching group, and double-distilled water without enzymes. Place the specific sequence FOIG_16668 obtained by LAMP amplification in S3 into the CRISPR / Cas12a-mediated cleavage system and incubate in a constant-temperature metal bath at 37°C for 15 min to obtain the cleaved system;

[0060] S5. Identify the specific sequence FOIG_16668, including the following steps: Use fluorescence quantification method, blue light method or test strip method to identify whether the specific sequence FOIG_16668 exists. If so, it indicates that the strain belongs to Fusarium oxysporum f. sp. cubense tropical race 4, where

[0061] The blue light method uses a blue light method-ssDNA probe, and the blue light method-ssDNA probe is 6-FAM-TTATT-BHQ1. The single-stranded DNA probe used has a BHQ-1 fluorescence quenching group at the 3' end and a FAM fluorescence group at the 5' end.

[0062] The test strip method uses a test strip method-ssDNA probe, and the test strip method-ssDNA probe is 6-FAM-TTATT-Biotin. The single-stranded DNA probe used has a Biotin group at the 3' end and a FAM fluorescence group at the 5' end.

[0063] The principle of nucleic acid detection by CRISPR / Cas12a is to recognize a specific fragment (5'-TTTN-3') with Poly-T as the protospacer adjacent motif (PAM) at the 5' end of the recognition sequence through the guidance of crRNA, and bind to the target sequence for cleavage to generate sticky ends. After recognizing the PAM site of the specific sequence, the nuclease activity of the Cas12a protein is activated, generating cleavage activity to shear the target sequence. At the same time, Cas12a also has strong "non-specific" activity, that is, it cleaves any single-stranded DNA probe in the system (this activity is the trans-cleavage activity), and the cleaved single-stranded DNA activates the release of the FAM fluorescence group with a fluorescent signal.

[0064] A rapid detection method for Race 4 physiological race of Fusarium oxysporum f. sp. cubense based on LAMP-CRISPR / Cas12a technology Figure 1 As shown, it couples the loop-mediated isothermal amplification method (LAMP) and CRISPR / Cas12a with both cis-cleavage activity and trans-cleavage activity. The Cas12a protein recognizes the target sequence in the LAMP amplification product through the mediation of crRNA, thereby activating its trans-cleavage activity to indiscriminately shear the single-stranded DNA probe (ssDNA) in the system. After the probe is sheared, the fluorescent group is released. After this reaction is incubated in a constant temperature metal bath at 37°C for 15 minutes, the fluorescence can be detected by real-time fluorescence detection, blue light visual detection or lateral flow strip detection.

[0065] Figure 6 As shown, the results show that the LAMP-CRISPR / Cas12a detection system not only has strong specificity for the specific sequence of Race 4 physiological race of Fusarium oxysporum f. sp. cubense, but also its accuracy and sensitivity are higher than those of conventional PCR. Figure 6As shown, by comparing the three detection methods, it can be seen that the detection result of the blue light method is more intuitive and the sensitivity is also higher, while the test strip method is more portable.

[0066] Figure 6 As shown, experiments have proved that LAMP-CRISPR / Cas12a can complete the detection within 60 minutes. The lowest detectable concentration of pathogenic bacteria DNA by the blue light method is 0.016 ng / μL, and the required instruments are simple (constant temperature metal bath, blue light transilluminator). The lowest detectable concentration of pathogenic bacteria DNA by the test strip method is 0.08 ng / μL. Neither method has special professional requirements for the experimental environment and operators. The lowest detectable concentration of pathogenic bacteria DNA by the fluorescence quantitative method is 0.016 ng / μL, but compared with the blue light method and the test strip method, it requires professional instruments and professional personnel. Therefore, the LAMP-CRISPR / Cas12a blue light method and the test strip method have great potential in the molecular qualitative detection of wild plant pathogens.

[0067] The experimental results show that the specific sequence FOIG_16668 mined in this study can specifically distinguish race 4, and all three detection methods can accurately and efficiently achieve specific detection. As Figure 2 shown, Foc II5, Foc INDO013, Foc CAV302, and Foc GD48 are all strains of race 4 of Fusarium wilt of banana (Foc TR4); Foc CAV179 is race 4 of the tropics (Foc STR4); Foc HN05 and Foc CAV941 are race 1 (Foc R1); Foc 22994 is race 2 (Foc R2).

[0068] The detection method of this embodiment is to detect the specificity of the sequence FOIG_16668. Using the sequence FOIG_16668 as the amplification target fragment, LAMP and PCR as the amplification methods, and CRISPR / Cas12a and agarose gel electrophoresis as the downstream detection means, four physiological races of Fusarium wilt of banana are distinguished and identified.

[0069] Using the LAMP-CRISPR / Cas12a amplification and cleavage system, three detection methods were respectively used to detect the tropical physiological race 4 of Fusarium wilt of banana Foc TR4: Foc II5, Foc INDO013, Foc CAV302, Foc GD48; the tropical race 4 physiological race Foc STR4: Foc CAV179; the physiological race 1 of Fusarium wilt of banana (Foc HN05, Foc CAV941), and the physiological race 2 of Fusarium wilt of banana Race 2: Foc 22994). The reaction conditions for LAMP were 65 °C for 45 minutes; the cleavage conditions for CRISPR / Cas12a were 37 °C for 15 minutes.

[0070] In this embodiment, in step S1, the concentrations of the genomic DNA templates of the II5 (TR4) strain and the Fo47 genomic DNA template were both diluted to 5 ng / μL. 1 μL of the genomic DNA template of the II5 (TR4) strain was added to the 25 μL PCR system, and 1 μL of the Fo47 genomic DNA template was added to the 25 μL PCR system. Those skilled in the art can adjust according to the actual situation, and no limitation is made here.

[0071] In this embodiment, the LAMP primers and PCR primers were purified by the HAP method.

[0072] In this embodiment, in step S2, when the LAMP primer sequence was subjected to BLAST sequence alignment, the Evalue was set to 1, and the parameter -task blastn-short was added.

[0073] In this embodiment, in step S3, the volume of the LAMP reaction system was 25 μL. The LAMP reaction system included 12.5 μL of 1×NEB LAMP, a primer mixture system of 1 μM, 1 μL of genomic DNA template with a concentration of 5 ng / μL, and 9 μL of enzyme-free double-distilled water, where the coding of NEB LAMP: E1700S, and the 2.5 μl primer mixture system included 0.16 μM FIP and BIP, 0.02 μM F3 and B3, and 0.04 μM LF and LB. Those skilled in the art can adjust according to the actual situation, and no limitation is made here.

[0074] In this embodiment, in step S4, the total volume of the CRISPR / Cas12a-mediated cleavage reaction system is 50 μL. In this cleavage reaction system, the Cas12a protein is from a Cas12a protein kit, and this Cas12a protein kit contains 5 μL of 10× buffer and 0.5 μL of 2 μM Cas12a protein; the crRNA is 0.2 μL of 10 μM, the single-stranded DNA probe with FAM group and BHQ1 quenching group is 0.2 μL of 10 μM, and the enzyme-free double-distilled water is 19.1 μL. Those skilled in the art can adjust according to the actual situation, and no limitation is made here.

[0075] In this embodiment, the Cas12a protein kit is selected from Guangzhou Magigene Biotechnology Co., Ltd., and the code is: C001. Those skilled in the art can adjust according to the actual situation, and no limitation is made here.

[0076] In this embodiment, in step S4, for the blue light method, observation and shooting are carried out using a GeneDireX LED blue light transilluminator, and the model of the GeneDireX LED blue light transilluminator is: the blue light instrument of BLOOK. Those skilled in the art can adjust according to the actual situation, and no limitation is made here.

[0077] For the test strip method, detection is carried out using a Magigene nucleic acid test strip. The Magigene nucleic acid test strip is selected from Guangzhou Magigene Biotechnology Co., Ltd., and the number is: C008. Those skilled in the art can adjust according to the actual situation, and no limitation is made here.

[0078] The sequence of the above LAMP primer is shown as SEQ ID NO: 1 below:

[0079] F3: ACTGCAGTGATTGCAGTGAT

[0080] B3: TTCGACGGGGAGATTGGT

[0081] FIP: GCAGAGCGCCTGACATAAGGGAGCTGCGAGACGAACCAT

[0082] BIP: ATTTTCGGCTTAGAGCTCGCGACTGGCCGAGCTTATTGGC

[0083] LF: GGGAGTGTAAGCGGGACA

[0084] LB: TTGCTGCCCCAAAGCCC;

[0085] The sequence of the above crRNA is shown as SEQ ID NO: 2 below:

[0086] GAAUUUCUACUGUUGUAGAU-GGGCAGCAACUUCGCGAGCUCUAA

[0087] Example 2

[0088] The identification system for the physiological race 4 of Fusarium oxysporum f. sp. cubense tropical race disclosed in this example includes the LAMP reaction system and the CRISPR / Cas12a-mediated cleavage system described in Example 1.

[0089] Example 3

[0090] The detection kit for Fusarium oxysporum disclosed in this example includes the identification system for the physiological race 4 of Fusarium oxysporum f. sp. cubense tropical race described in Example 2.

[0091] Unless otherwise specifically stated, the relative arrangements of the components and steps, numerical expressions, and numerical values set forth in these examples do not limit the scope of the present application. At the same time, it should be understood that, for the sake of convenience of description, the dimensions of the various parts shown in the drawings are not drawn in actual proportional relationships. Technologies, methods, and devices known to those of ordinary skill in the relevant art may not be discussed in detail, but where appropriate, the said technologies, methods, and devices should be regarded as part of the authorization specification. In all the examples shown and discussed here, any specific value should be construed as merely exemplary and not as a limitation. Therefore, other examples of the exemplary embodiments may have different values. It should be noted that: like reference numerals and letters denote like items in the following drawings, and thus, once an item is defined in one drawing, it does not need to be further discussed in subsequent drawings.

[0092] In the description of the present application, it should be understood that the orientation or positional relationships indicated by orientation words such as "front, rear, upper, lower, left, right", "lateral, vertical, perpendicular, horizontal", and "top, bottom" are generally based on the orientation or positional relationships shown in the drawings, and are only for the convenience of describing the present application and simplifying the description. Without contrary description, these orientation words do not indicate and imply that the device or element referred to must have a specific orientation or be constructed and operated in a specific orientation, and thus should not be construed as limiting the protection scope of the present application; the orientation words "inside, outside" refer to the inside and outside relative to the contour of each component itself.

[0093] For ease of description, spatial relative terms such as "above", "over", "on the upper surface", "upper" etc. may be used herein to describe the spatial positional relationship of one device or feature to other devices or features as shown in the figures. It should be understood that the spatial relative terms are intended to encompass different orientations in use or operation in addition to the orientation depicted in the figures. For example, if the device in the figures is inverted, a device described as "above" or "over" other devices or structures will then be positioned "below" or "under" the other devices or structures. Thus, the exemplary term "above" can include both orientations of "above" and "below". The device may also be positioned in other different ways (rotated 90 degrees or in other orientations), and corresponding interpretations of the spatial relative descriptions used herein will be made accordingly.

[0094] In addition, it should be noted that the use of terms such as "first" and "second" to define components is only for the convenience of differentiating the corresponding components. Without additional statements, the above terms have no special meanings, and thus should not be construed as limiting the scope of protection of this application.

[0095] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the scope of protection of the present invention.

Claims

1. An identification system for race 4 of tropical race of banana fusarium wilt, characterized by: It includes a LAMP reaction system and a CRISPR / Cas12a-mediated cleavage system; The LAMP reaction system includes NEB WarmStart ® LAMP and a primer mixture system. The primer mixture system includes FIP and BIP, F3 and B3, LF and LB, and a banana wilt DNA template; Enzyme-free double-distilled water; The sequences of the primers are as follows: F3: ACTGCAGTGATTGCAGTGAT B3: TTCGACGGGGAGATTGGT FIP: GCAGAGCGCCTGACATAAGGGAGCTGCGAGACGAACCAT BIP: ATTTTCGGCTTAGAGCTCGCGACTGGCCGAGCTTATTGGC LF:GGGAGTGTAAGCGGGACA LB: TTGCTGCCCCAAAGCCC; The CRISPR / Cas12a-mediated cleavage system includes Cas12a protein, crRNA, a single-stranded DNA probe with a FAM group and a fluorescence quenching group, and enzyme-free double-distilled water. The sequence of the crRNA is GAAUUUCUACUGUUGUAGAU-GGGCAGCAACUUCGCGAGCUCUAA.

2. The identification system for the tropical race 4 of banana Fusarium wilt according to claim 1, characterized in that: The volume of the LAMP reaction system is 25 μL. The LAMP reaction system includes 12.5 μL of 1×NEB WarmStart ® LAMP, where the NEB WarmStart ® LAMP is encoded as E1700S, a primer mixture system of 1 μM, and 2.5 μl of the primer mixture system includes 0.16 μM of FIP and BIP, 0.02 μM of F3 and B3, and 0.04 μM of LF and LB; 1 μL of genomic DNA template with a concentration of 5 ng / μL and 9 μL of enzyme-free double-distilled water.

3. The identification system for the race 4 of tropical race of banana fusarium wilt according to claim 1, characterized in that: The volume of the CRISPR / Cas12a-mediated cleavage reaction system is 50 μL in total. In this cleavage reaction system, the Cas12a protein is from a Cas12a protein kit, which contains 5 μL of 10× buffer and 0.5 μL of 2 μM Cas12a protein; the crRNA is 0.2 μL of 10 μM, the single-stranded DNA probe with a FAM group and a BHQ1 quenching group is 0.2 μL of 10 μM, and the enzyme-free double-distilled water is 19.1 μL.

4. A Fusarium oxysporum detection kit, characterized in that: It includes the identification system for the tropical race 4 physiological race of Fusarium oxysporum f. sp. cubense as described in any one of claims 1-3.

Images