Peptides exhibiting hair growth and / or hair growth promotion activity and uses thereof

Abstract

The present application provides a peptide exhibiting hair growth promoting activity. The peptide of the present application promotes hair follicle cell growth and exhibits excellent effects on hair growth by promoting the expression of hair growth-related growth factors and hair growth-related factors. The peptide of the present application can be used for hair loss prevention or improvement, hair growth promotion, and hair growth improvement. Furthermore, the excellent activity and stability of the peptide of the present application can be very advantageously applied to pharmaceuticals, quasi-drugs, or cosmetics.

Description

[0001] This application is a divisional application of the same-named application for a patent filed on February 9, 2017, application 201780010329.8.

TECHNICAL FIELD

[0002] The present application relates to a peptide exhibiting hair growth and / or hair growth promotion activity, a hair growth promotion composition containing the above-mentioned peptide as an effective ingredient, and a hair growth promotion use of the above-mentioned peptide.

BACKGROUND

[0003] A hair follicle is a unique organ of mammalian skin, and is an organ in which the lower part of the primary epidermis grows and extends to a further deep skin layer. There is a plug of cells known as a bulge or dermal papilla cell at the base of the hair follicle (Stenn and Paus, Physiol. Rev., 81:449 (2002)), and the papilla is necessary for the normal cycling of the hair follicle (Oliver, Embryol. Exp. Morph. 15:3311 (1966); Oliver, Embryol. Exp. Morph. 16:231 (1966)) and growth of the hair shaft. The hair shaft is a pedal-shaped structure prepared using firmly adhered cells filled with keratin filaments and filaggrin.

[0004] The human hair periodically repeats a growth phase, a regression phase, a resting phase, and goes through a process of hair loss and re-growth. The determination of the hair cycle is formed by the regulation of hormones or many growth factors, etc. On the other hand, the hair can go through the regression phase in advance by severe stress or nutritional deficiency, etc., to enter the resting phase, thereby inducing severe hair loss (American Journal of Pathology, 162(3) (2003), (Arck, Petra Clara; Handjiski, Bori)).

[0005] In male baldness, the hair follicles on the front and upper part of the scalp exhibit sensitivity to androgens. Thus, in the case of male baldness, the miniaturization of the hair follicles, which corresponds to the destruction of the hair follicles, is caused by the excessive secretion of androgens, which are male hormones. The excessive secretion of androgens leads to the activation of 5-alpha reductase, thereby transforming testosterone into dihydrotestosterone (DHT), and the dihydrotestosterone thus produced shortens the period of hair growth, miniaturizes the hair follicles, and thus reduces the number of thick and strong hair, thereby inducing hair loss.

[0006] Hair loss spreads generally as age increases. For example, different disease states such as cicatricial alopecia, burn or cicatrization state related to pressure injury can cause significant hair loss. In order to treat such hair loss, various substances have been used as pharmaceutical products so far, but are too expensive and induce various side effects.

[0007] Also, there are disadvantages that such pharmaceutical products need to be continuously used, when use is stopped, there is a risk of re-inducing hair loss, and there are serious differences in efficacy for each person and also differences in side effects for each person.

[0008] In addition, raw materials used as cosmetics have the advantage of being inexpensive, but are composed of ingredients derived from plant extracts, and thus have the disadvantage that their efficacy is not great in practice. Therefore, there is a demand in the art for a new effective ingredient that is further economical in terms of effectiveness and cost.

[0009] Two available drugs (minoxidil and finasteride) known so far can delay additional hair loss, but do not induce regeneration of hair follicles. Also, in hair cosmetics, hair loss prevention products using plant extracts and the like are on the market.

[0010] For example, a male hair loss product containing extracts of Sophora flavescens, Capsicum annuum, Daphne giraldii, Radix Paeoniae Alba, Radix Paeoniae Rubra, Panax ginseng, Glycyrrhiza uralensis, Paeonia lactiflora, Rehmannia glutinosa, Foeniculum vulgare, Cornus officinalis, Allium sativum, etc. has been developed; a product that presents hair growth promotion effect by improving inhibition of cell metabolism based on excess of dihydrotestosterone through addition of a composition containing xanthine and growth hormone, and growth hormone promotes hair growth to prevent hair loss and regenerate hair; a hair growth promotion product for promoting hair growth and growth of hair by developing a product containing mineral and vitamin, green tea, rosemary, wormwood, glycyrrhiza extract to supply nutrients to scalp and hair, and has effect on prevention of hair loss and promotion of hair growth; a male hair loss product that helps metabolism of hair by inhibiting 5-alpha reductase in the human body by mixing substances such as vitamin B, vitamin C, vitamin D, vitamin E, niacin, pantothenic acid, biotin, and folic acid, and plant extract, and thus does not form dihydrotestosterone in the process of metabolism of male hormone, but it is difficult to find a product that has an effect on generation of new hair.

[0011] Throughout this specification, numerous papers and patent documents have been referred to, and their citations are indicated. The disclosure of the cited papers and patent documents is all inserted in this specification by reference, so as to more clearly explain the level of the art to which the present invention belongs and the contents of the present invention. SUMMARY

[0012] TECHNICAL PROBLEM

[0013] The present inventors have endeavored to develop a peptide having excellent hair growth and / or hair growth promoting effects, as a result, the present inventors have screened three peptides exhibiting excellent hair growth effects from a peptide library, and have clarified hair growth and / or hair growth promoting effects by experiments, thereby completing the present invention.

[0014] Accordingly, an object of the present invention is to provide a peptide exhibiting hair growth and / or hair growth promoting activity consisting of an amino acid sequence selected from the group consisting of Sequence 1 to Sequence 3.

[0015] Still another object of the present invention is to provide a hair loss prevention and / or improvement composition comprising, as an effective ingredient, one or more peptides selected from the group consisting of peptides consisting of an amino acid sequence selected from the group consisting of Sequence 1 to Sequence 3.

[0016] Another object of the present invention is to provide a hair growth and / or hair growth promoting composition comprising, as an effective ingredient, one or more peptides selected from the group consisting of peptides consisting of an amino acid sequence selected from the group consisting of Sequence 1 to Sequence 3.

[0017] Still another object of the present invention is to provide a use of a peptide consisting of an amino acid sequence selected from the group consisting of Sequence 1 to Sequence 3 for hair loss prevention and / or improvement.

[0018] Yet another object of the present invention is to provide a use of a peptide consisting of an amino acid sequence selected from the group consisting of Sequence 1 to Sequence 3 for hair growth and / or hair growth promotion.

[0019] Other objects and advantages of the present invention will be more clearly understood from the following detailed description of the invention, the claims, and the accompanying drawings.

[0020]

Solution to Problem

[0021] The present inventors have endeavored to develop a peptide having excellent hair growth and / or hair growth promoting effects, as a result, the present inventors have screened three peptides exhibiting excellent hair growth and / or hair growth promoting effects from a peptide library, and have clarified hair growth and / or hair growth effects by experiments.

[0022] One embodiment of the present invention relates to a peptide exhibiting hair growth and / or hair growth promoting activity comprising an amino acid sequence selected from the group consisting of Sequence 1 to Sequence 3.

[0023] The above peptide can comprise an amino acid sequence consisting of an amino acid sequence selected from the group consisting of Sequence 1 to Sequence 3, for example, can consist of an amino acid sequence selected from the group consisting of Sequence 1 to Sequence 3.

[0024] In the present specification, "peptide" refers to a linear molecule formed by the mutual combination of amino acid residues by peptide bonds. The peptides of the present application can be prepared by chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, III (1984)) or liquid-phase synthesis techniques (US Patent No. 5516891).

[0025] The peptides of the present application are peptides that were selected by the present inventors from a retained peptide library through cell proliferation experiments to have excellent hair growth effects, and three types of peptides are provided as the peptides of the present application.

[0026] As the peptides of the present application, a portion of the amino acid sequence is selected, and the N-terminus and / or C-terminus of the peptide can be modified in order to increase the activity thereof.

[0027] For example, the above-mentioned C-terminus modification can be modification of the C-terminus of the peptide into a hydroxyl group (-OH), an amino group (-NH2), an azide compound (-NHNH2), etc., but is not limited thereto.

[0028] Also, the above-mentioned N-terminus modification can be binding of the N-terminus of the peptide to one or more protecting groups selected from the group consisting of an acetyl group, a fluorenylmethyloxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, and a stearyl group, and polyethylene glycol (PEG), but is not limited thereto. The above-mentioned protecting group functions to protect the peptide of the present application from attack by a protein cleavage enzyme in the body.

[0029] The N-terminus and / or C-terminus modification of the above-mentioned peptide functions to greatly improve the stability of the peptide, and by such modification, the peptide of the present application can increase the decay period upon administration in the body, thereby having a high half-life.

[0030] In the present specification, the term "stability" refers not only to in vivo stability but also to storage stability (e.g., room temperature storage stability).

[0031] In the present application, "hair growth promotion" is used in a broad sense to mean the generation of hair, such that the speed of hair generation and the amount of hair generation are increased. Also, it refers to the enhancement of the function of hair roots or the shortening of the cycle of hair loss and generation, such that the number of hairs grown from hair follicles is increased.

[0032] In the present application, "hair growth" or "hair growth promotion" refers to an increase in the thickness of the generated hair (head hair) or an effect on the length and growth speed of the hair.

[0033] According to still another embodiment of the present application, the peptide of the present application promotes the growth of hair follicle cells and increases the expression of beta-catenin, which is a hair growth-related factor, increases the expression of keratinocyte growth factor (KGF), basic fibroblast growth factor (bFGF), and vascular endothelial growth factor (VEGF), which are hair growth-related growth factors, increases the expression of phosphoinositide 3-kinase (PI3K), which is a hair growth signal molecule, increases the phosphorylation of extracellular signal-regulated kinase (ERK), increases or decreases the expression of MSH homologous box 2 and keratin-14, which are hair growth-related factors, inhibits the expression of transforming growth factor-beta 1, which is associated with hair growth retardation, and induces the increase in the expression of B-cell lymphoma-2, which is a cell apoptosis inhibitory protein, and the decrease in the expression of B-cell lymphoma-2-associated X protein, which is an apoptosis-related protein.

[0034] This result means that the peptide of the present application has very excellent efficacy for hair growth and / or hair growth promotion. Accordingly, the peptide of the present application can be used for hair loss prevention and / or improvement, hair growth and / or hair growth promotion.

[0035] Another embodiment of the present application relates to a composition for hair loss prevention or improvement, which comprises the peptide of the present application as an effective ingredient.

[0036] In the present application, hair loss prevention refers to the inhibition or weakening of the phenomenon of hair loss from hair follicles or the scalp.

[0037] The peptide of the present application can generate new hair follicles by inducing the proliferation of cells of hair follicles, which are skin tissues in which hair roots can be generated. In particular, by activating the signal of beta-catenin, hair growth promotion genes are expressed, and the expression of growth factors involved in hair growth is increased.

[0038] The peptide of the present application plays a role in promoting the anagen phase, which is a period in which hair is generated and grown, presents a hair loss inhibition effect by maintaining the cycle of hair in which the anagen phase is followed by the catagen phase due to various environmental factors, and in normal hair, provides nutrients to hair to maintain the health of hair. Accordingly, the composition of the present application is very effective for hair loss prevention and / or improvement.

[0039] The composition of the present application contains the above-mentioned peptide of the present application as an effective ingredient, and thus, in order to avoid the present specification from being too complicated, the common description therebetween is omitted.

[0040] Still another embodiment of the present application provides a composition for promoting hair growth and / or hair growth, which contains one or more peptides selected from the group consisting of the peptides consisting of the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 3 as an effective ingredient.

[0041] The composition of the present application can be prepared as a cosmetic composition, but is not limited thereto.

[0042] The above-mentioned cosmetic composition can contain a cosmetically effective amount of the peptide of the present application.

[0043] Also, the above-mentioned cosmetic composition can further contain a cosmetically acceptable carrier, but is not limited thereto.

[0044] In the present specification, the term "cosmetically effective amount" means an amount sufficient to achieve the efficacy of the cosmetic composition of the present application.

[0045] The cosmetic composition of the present application can be prepared in any dosage form generally prepared in the art to which the present application pertains, for example, can be formulated in the form of a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a cleanser containing a surfactant, an oil, a powder foundation, an emulsion foundation, a wax foundation, and / or a spray, but is not limited thereto. For example, can be prepared in the form of a skin softening lotion, a nutrition lotion, a nutrition cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a makeup remover, a pack, a spray, and / or a powder.

[0046] In the case where the above-mentioned cosmetic composition is in the form of a paste, a cream, or a gel, an animal oil, a vegetable oil, a wax, a paraffin, starch, gum arabic, a cellulose derivative, polyethylene glycol, silicon, bentonite, silica, talc, or zinc oxide, etc. can be used as a carrier ingredient, but is not limited thereto.

[0047] In the case where the above-mentioned cosmetic composition is in the form of a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or a polyamide powder can be used as a carrier ingredient, and in the case of a spray, a propellant such as chlorofluorocarbon, propane / butane, or dimethyl ether, etc. can be further contained, but is not limited thereto.

[0048] In the case where the above-mentioned cosmetic composition is in the form of a solution or an emulsion, a solvent, a solubilizer, or an emulsifier is used as a carrier ingredient, for example, water, ethanol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol fatty acid ester, polyethylene glycol, or sorbitol fatty acid ester.

[0049] In the case where the above-mentioned cosmetic composition is in the form of a suspension, as the carrier component, a liquid diluent such as water, ethanol or propylene glycol, etc.; a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, etc.; microcrystalline cellulose; aluminum metahydroxide; bentonite; agar or gum arabic, etc. can be used, but are not limited thereto.

[0050] In the case where the above-mentioned cosmetic composition is in the form of a cleansing agent containing a surfactant, as the carrier component, a fatty alcohol sulfate, a fatty alcohol ether sulfate, a sulfosuccinic acid monoester, a hydroxyethylsulfonate, an imidazoline derivative, a methyltaurinate, a sarcosinate, a fatty acid amide ether sulfate, an alkyl amido betaine, a fatty alcohol, a fatty acid glyceride, a fatty acid diethanolamide, a vegetable oil, a lanolin derivative or an ethoxylated glycerol fatty acid ester, etc. can be used, but are not limited thereto.

[0051] The components included in the cosmetic composition of the present application, in addition to the peptide as the effective component and the carrier component, include various components generally used in cosmetic compositions, for example, an antioxidant, a stabilizer, a solubilizer, a vitamin, a pigment, a perfume and the like, but are not limited thereto.

[0052] Still another embodiment of the present application relates to the use of a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3 for preventing and / or improving alopecia.

[0053] The above-mentioned peptide is the same as the above-mentioned peptide, and thus the common description therebetween is omitted in order to avoid the present specification from being too complicated.

[0054] Still another embodiment of the present application relates to the use of a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3 for promoting hair growth and / or hair development.

[0055] The above-mentioned peptide is the same as the above-mentioned peptide, and thus the common description therebetween is omitted in order to avoid the present specification from being too complicated.

[0056]

Effects of the Invention

[0057] The present application relates to a peptide having hair growth and / or hair development promoting activity, a composition for preventing and / or improving alopecia containing the above-mentioned peptide as an effective component, a composition for promoting hair growth and / or hair development containing the above-mentioned peptide as an effective component, the use of the above-mentioned peptide for preventing and / or improving alopecia, and the use of the above-mentioned peptide for promoting hair growth and / or hair development, the above-mentioned peptide promoting hair follicle cell growth and exhibiting excellent effects on hair growth and / or hair development by promoting the expression of hair growth-related growth factors and hair growth-related factors, and being very advantageously applicable to cosmetics due to excellent activity and stability.

BRIEF DESCRIPTION OF DRAWINGS

[0058] Figure 1a A graph showing the growth promotion effect of human hair follicle dermal papilla cells (HHFDPC) by a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present application.

[0059] Figure 1b A graph showing the growth promotion effect of human hair follicle dermal papilla cells by a peptide consisting of the amino acid sequence of Sequence 2 of an embodiment of the present application.

[0060] Figure 1c A graph showing the growth promotion effect of human hair follicle dermal papilla cells by a peptide consisting of the amino acid sequence of Sequence 3 of an embodiment of the present application.

[0061] Figure 2a A graph showing the results of confirming the increase in expression of β-catenin by a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present application.

[0062] Figure 2b A graph showing the results of confirming the increase in expression of β-catenin by a peptide consisting of the amino acid sequence of Sequence 2 of an embodiment of the present application.

[0063] Figure 2c A graph showing the results of confirming the increase in expression of β-catenin by a peptide consisting of the amino acid sequence of Sequence 3 of an embodiment of the present application.

[0064] Figure 3a A photograph showing the results of confirming the expression of keratinocyte growth factor, basic fibroblast growth factor based on a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present application.

[0065] Figure 3b A graph showing the results of confirming the increase in expression of vascular endothelial growth factor based on a peptide consisting of the amino acid sequence of Sequence 2 of an embodiment of the present application.

[0066] Figure 3c A graph showing the results of confirming the increase in expression of vascular endothelial growth factor, basic fibroblast growth factor based on a peptide consisting of the amino acid sequence of Sequence 3 of an embodiment of the present application.

[0067] Figure 4a A graph showing the results of confirming the increase in expression of phosphatidylinositol-3 kinase and the increase in phosphorylation of extracellular signal-regulated kinase based on a peptide consisting of the amino acid sequence of Sequence 1 of an embodiment of the present application.

[0068] Figure 4bA photograph showing results of confirmation of an increase in expression of phosphatidylinositol-3 kinase and an increase in extracellular signal-regulated kinase phosphorylation with respect to a peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present application.

[0069] Figure 5a A photograph showing results of distinguishing an increase in expression of MSH homologous box 2 with respect to a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present application.

[0070] Figure 5b A photograph showing results of distinguishing an increase in expression of MSH homologous box 2 with respect to a peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present application.

[0071] Figure 6a A photograph showing results of confirmation of an increase in expression of transforming growth factor-βl with respect to a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present application.

[0072] Figure 6b A photograph showing results of confirmation of an increase in expression of transforming growth factor-βl with respect to a peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present application.

[0073] Figure 7a A photograph showing results of confirmation of an increase in expression of B-cell lymphoma-2 and a decrease in expression of B-cell lymphoma-2-associated X protein with respect to a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present application.

[0074] Figure 7b A photograph showing results of confirmation of an increase in expression of B-cell lymphoma-2 and a decrease in expression of B-cell lymphoma-2-associated X protein with respect to a peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present application.

[0075] Figure 8 A photograph showing results of confirmation of an increase in expression of keratin-14 with respect to a peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present application.

DETAILED DESCRIPTION

[0076] Hereinafter, the present application will be described in greater detail by way of Examples. Such Examples are only for illustrating the present application in more detail, and the scope of the present application is not limited to these Examples, as it would be apparent to those skilled in the art to which the present application pertains.

[0077]

EXAMPLE

[0078]

Synthesis Example 1: Synthesis of Peptide

[0079] A 700 mg of chloro trityl chloride resin (CTL resin, Novabiochem Cat No. 01-64-0021) was put into a reactor and 10 ml of dichloromethane (MC) was put into the reactor and stirred for 3 minutes. After removing the solution, 10 ml of dimethylformamide (DMF) was put into the reactor and stirred for 3 minutes, and then the solvent was removed again. 10 ml of deprotection solution (20% piperidine / dimethylformamide) was put into the reactor and stirred for 10 minutes at room temperature, and then the solution was removed. The same amount of deprotection solution was put into the reactor and stirred for 10 minutes, and then the solution was removed. The Ile-CTL Resin resin was prepared by washing with dimethylformamide twice for 3 minutes each, dichloromethane once, and dimethylformamide once. 10 ml of dimethylformamide solution was put into a new reactor, and 200 mmole of Lys(Boc)-OH (Bachem, Swiss), 200 mmole of hydroxybenzotriazole (HoBt), and 200 mmole of benzotriazol-1-yl oxytris(dimethylamino) phosphonium hexafluorophosphate (Bop) were added and stirred to be uniformly dissolved. 400 mmole of N,N-diisopropyl ethylamine (DIEA) was put into the reactor twice in a fractionated manner, and stirred until all the solids were dissolved for at least 5 minutes. The dissolved amino acid mixture solution was put into the reactor containing the deprotected resin, stirred for 1 hour at room temperature, and reacted. The reaction solution was removed, and dimethylformamide solution was stirred for 5 minutes each time and removed after stirring for 3 times. A small amount of the reaction resin was taken and the reaction degree was checked using the Nihydrin test. The Lys(Boc)-Ile-CTL Resin resin was prepared by performing 2 deprotection reactions using the deprotection solution in the same manner as the above method. The dimethylformamide and dichloromethane were sufficiently washed, and the Nihydrin test was performed again, and then the following amino acid attachment experiment was performed in the same manner as the above method.According to the selected amino acid sequence, the chain reaction was performed in the order of Fmoc-Arg(Pbf)-OH and Fmoc-Arg(Pbf)-OH. After the Fmoc-protecting group was reacted for 10 minutes twice using a deprotection solution, it was washed and removed. The peptide-based resin prepared by acetylating with acetic anhydride and N,N-diisopropyl ethylamine, hydroxybenzotriazole (HoBt) in dimethylformamide, dichloromethane, and methanol for 1 hour was washed three times with slow nitrogen flow, dried under vacuum in a phosphorus pentoxide (P2O5) condition, and completely dried under vacuum. Then, 30 ml of a leakage solution [95% trifluroacetic acid (TFA), 2.5% distilled water, and 2.5% thioanisole] was added, followed by gentle shaking at room temperature for 2 hours. The resin was filtered by filtration, washed with a small amount of the solution, and mixed with the mother liquor. After distillation under reduced pressure to a volume of about half the total volume, 50 ml of cold ether was added to induce precipitation, and the precipitate was collected by centrifugation and washed twice with colder ether. The mother liquor was removed, and the product was sufficiently dried under nitrogen to synthesize 0.7 g of peptide 1 composed of the amino acid sequence Arg-Arg-Lys-Ile of sequence 1 before purification (yield: 90.0%). When measured using a molecular weight measuring instrument, the obtained molecular weight was 571.7 (theoretical value: 571.72).

[0080] The synthesis of peptide 2 composed of the amino acid sequence of sequence 2 and peptide 3 composed of the amino acid sequence of sequence 3, which are other peptides, was also performed in the same manner as described above

[0081] Table 1

[0082]

[0083] To ensure that the peptide exhibits hair growth promotion efficacy, screening was performed on the peptide library of the present company, and three peptides were selected through a cell proliferation experiment. Thereafter, the hair growth promotion efficacy of the three peptides was observed through changes in the expression of various genes and proteins, and their excellent efficacy was confirmed.

[0084] Example 1: DPC proliferation analysis

[0085] Human hair follicle dermal papilla cells were seeded at 2 x 10 3Cells were seeded at a density per well in 96-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 3 days with peptide treatment, followed by treatment with 100 μl of 4 mg / ml MTT solution per well for 4 hours. The absorbance was measured at 560 nm using a microplate reader after dissolving the generated formazan in dimethyl sulfoxide (DMSO). Figures 1a to 1c The results are shown.

[0086] As from Figures 1a to 1c It was confirmed that treatment of peptides consisting of amino acid sequences 1, 2, or 3, respectively, promoted the growth of human hair follicle dermal papilla cells in a concentration-dependent manner.

[0087] [Example 2: β-catenin activation assay]

[0088] Human hair follicle dermal papillary cells were divided into 2×10 3 Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 15 and 30 minutes by peptide treatment, and then recovered to isolate nuclear and cytoplasmic proteins. Immunoblotting was performed using a β-ringin antibody (Santacruz biotechnology, USA) to compare the expression morphology of β-ringin in the nucleus. Figures 2a to 2c The results are shown.

[0089] from Figures 2a to 2c It was confirmed that nuclear translocation, based on increased activity of β-catenin, a hair growth-related factor, was promoted in human hair follicle dermal papilla cells by peptide treatment consisting of amino acid sequences of sequence 1, sequence 2, or sequence 3.

[0090] [Example 3: Reverse transcription-polymerase chain reaction (RT-PCR) of keratinocyte growth factor, basic fibroblast growth factor, and vascular endothelial growth factor]

[0091] Human hair follicle dermal papillary cells were divided into 4×10 5Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 24 hours with peptide treatment, and then the cells were recovered to isolate ribonucleic acid (RNA). After ribonucleic acid quantification, complementary deoxyribonucleic acid (cDNA) was synthesized using a complementary deoxyribonucleic acid (cDNA) synthesis kit (Intron, Korea). Polymerase chain reaction (PCR) was performed using a polymerase chain reaction (PCR) premix (Intron, Korea) and primers for various keratinocyte growth factors, basic fibroblast growth factors, and vascular endothelial growth factors. Electrophoresis was then performed on a 5% agarose gel to compare the expression levels of messenger ribonucleic acid (mRNA) of these growth factors under different sample treatment conditions. Figures 3a to 3c The results are shown.

[0092] Table 2

[0093] Sequence number Naming of primers Sequence list (5'-3') 4 Keratinocyte growth factor_F TCTGTCGAACACAGTGGTACCT 5 Keratinocyte growth factor_R GTGTGTCCATTTAGCTGATGCAT 6 Basic fibroblast growth factor_F TGCTGGTGATGGGAGTTGTA 7 Basic fibroblast growth factor_R CCTCCAAGTAGCAGCCAAAG 8 Vascular endothelial growth factor_F CCATGAACTTTCTGCTGTCTT 9 Vascular endothelial growth factor_R TCGATCGTTCTGTATCAGTCT

[0094] As from Figure 3a It was confirmed that peptide treatment consisting of the amino acid sequence of sequence 1 increased the expression of messenger RNA of keratinocyte growth factor and basic fibroblast growth factor, which are growth factors associated with hair growth, in human hair follicle dermal papilla cells.

[0095] Furthermore, as from Figure 3b It was confirmed that peptide treatment, consisting of the amino acid sequence of sequence 2, increased the expression of vascular endothelial growth factor (VEGF) messenger RNA, a factor that influences hair growth in human hair follicle dermal papilla cells. Figure 3c It was confirmed that peptide treatment consisting of the amino acid sequence of sequence 3 increased the expression of messenger RNA of vascular endothelial growth factor and basic fibroblast growth factor.

[0096] [Example 4: Phosphatidylinositol-3-kinase & p-extracellular signal-regulated kinase WB]

[0097] Human hair follicle dermal papillary cells were divided into 4×10 5 Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 15 and 30 minutes by peptide treatment, and then recovered to prepare cell lysate. Immunoblotting was performed using a phosphatidylinositol-3 kinase antibody (Santa Cruz Biotechnology, USA) and a phospho-ERK antibody (Cell Signaling Technology, USA) to compare protein expression morphology. Figure 4a and Figure 4b The results are shown.

[0098] As can be confirmed from Figure 4a and Figure 4b It was confirmed that an increase in the expression of phosphatidylinositol-3 kinase as a hair growth signaling molecule and an increase in oxidation of extracellular signal-regulated kinase were observed in human hair follicle dermal papilla cells by treatment with a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3.

[0099] [Example 5: Reverse transcription-polymerase chain reaction of MSH homeobox 2]

[0100] Human hair follicle dermal papilla cells were seeded at a density of 4 x 104 5 After culturing overnight, the cells were replaced with serum-free medium, and then treated with a peptide for 24 hours, and the cells were recovered to isolate ribonucleic acid. After quantifying the ribonucleic acid, complementary deoxyribonucleic acid was synthesized using a complementary deoxyribonucleic acid synthesis kit (Intron, Korea), and polymerase chain reaction was performed using a polymerase chain reaction premix (Intron, Korea) and MSH homeobox 2 primers, and electrophoresis was performed in a 5% agarose gel to compare the expression levels of the messenger ribonucleic acid of the growth factor under each sample treatment condition, and the results are shown in Table 3. Figure 5a and Figure 5b The results are shown in Table 3.

[0101] [Table 3]

[0102] Sequence number Naming of primers Sequence list (5'-3') 10 MSX2_F AACACAAGACCAACCGGAAG 11 MSX2_R GCAGCCATTTTCAGCTTTTC

[0103] As can be confirmed from Figure 5a and Figure 5b It was confirmed that the expression of MSH homeobox 2, which is a growth factor related to hair growth, was promoted in human hair follicle dermal papilla cells by treatment with a peptide consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

[0104] [Example 6: Reverse transcription-polymerase chain reaction of transforming growth factor-β1]

[0105] Human hair follicle dermal papilla cells were seeded at a density of 4 x 104 5Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 24 hours with peptide treatment, and then the cells were recovered to isolate ribonucleic acid (RNA). Following RNA quantification, complementary deoxyribonucleic acid (CDNA) was synthesized using a complementary deoxyribonucleic acid synthesis kit (Intron, Korea). Polymerase chain reaction (PCR) was then performed using a polymerase chain reaction premix (Intron, Korea) and transforming growth factor-β1 primers. Electrophoresis was performed on a 5% agarose gel to compare the expression levels of messenger RNA under various sample treatment conditions. Figure 6a and Figure 6b The results are shown.

[0106] Table 4

[0107] Sequence number Naming of primers Sequence list (5'-3') 12 TGF-β1_F GCCCTGGATACCAACTATTGC 13 TGF-β1_R TCAGCACTTGCAGGAGTAGCG

[0108] As from Figure 6a and Figure 6b It was confirmed that peptide treatment consisting of the amino acid sequences of sequence 2 or sequence 3 promoted the expression of MSH homeobox 2 messenger RNA, a growth factor associated with hair growth, in human hair follicle dermal papilla cells.

[0109] [Example 7: Western blot analysis of B-cell lymphoma-2 / B-cell lymphoma-2-associated X protein]

[0110] Human hair follicle dermal papillary cells were divided into 4×10 5 Cells were seeded at a density per well in 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 24 hours with peptide treatment, and then recovered to prepare cell lysate. Immunoblotting was performed using antibodies against B-cell lymphoma-2 and B-cell lymphoma-2-associated X protein (Santa Cruz Biotechnology, USA) to compare protein expression morphology. Figure 7a and Figure 7b The results are shown.

[0111] As from Figure 7a and Figure 7b It was confirmed that peptide treatment consisting of amino acid sequences of sequence 1 or sequence 3 increased the expression of B-cell lymphoma-2, an apoptosis-inhibiting protein, and decreased the expression of B-cell lymphoma-2-associated X protein, an apoptosis-related protein, in human hair follicle dermal papilla cells.

[0112] [Example 8: Reverse transcription-polymerase chain reaction of keratin-14]

[0113] Human hair follicle dermal papillary cells were divided into 5×10 5After the cells were seeded at a density of 1 x 104 cells / well in a 6-well plate, they were cultured overnight. After the medium was replaced with a serum-free medium, the cells were cultured for 24 hours by treating the peptides, and the cells were recovered to isolate the ribonucleic acid. After the ribonucleic acid was quantified, complementary deoxyribonucleic acid was synthesized using a complementary deoxyribonucleic acid synthesis kit (Intron, Korea), and polymerase chain reaction was performed using a polymerase chain reaction premix (Intron, Korea) and keratin-14 primers, and electrophoresis was performed in 5% agarose gel to compare the expression levels of messenger ribonucleic acid under each sample treatment condition, and the results are shown in Table 1. Figure 8 The results are shown in Table 1.

[0114] Table 1

[0115] Sequence number Naming of primers Sequence list (5'-3') 14 Keratin-14_F CCACCTTTCATCTTCCCAATTCTC 15 Keratin-14_R GTGCGGATCTGGCGGTTG

[0116] As can be confirmed from Table 1, it was confirmed that the expression of keratin-14, which is a hair growth-related factor, was increased in human hair follicle dermal papilla cells by treatment with a peptide consisting of the amino acid sequence of SEQ ID NO: 1. Figure 8

[0117] The above detailed specific parts of the present application, but it can be clear that for those of ordinary skill in the art to which the present application belongs, these specific descriptions only belong to an example, the scope of the present application is not limited thereto. Therefore, the substantial scope of the present application is defined by the appended claims and their equivalents.

[0118]

[0119] The present application relates to a peptide exhibiting hair growth and / or hair growth promotion activity, a hair growth promotion composition comprising the above-mentioned peptide as an effective ingredient, and a hair growth promotion use of the above-mentioned peptide.

[0120] The present specification also includes the following:

[0121] 1. A peptide exhibiting hair growth promotion activity, consisting of an amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 3.

[0122] 2. The peptide according to embodiment 1, wherein the peptide promotes hair follicle cell growth.

[0123] 3. The peptide according to embodiment 1, wherein the peptide increases the expression of β-catenin.

[0124] 4. The peptide according to embodiment 1, wherein the peptide increases the expression of a hair growth-related growth factor selected from keratinocyte growth factor, basic fibroblast growth factor, and vascular endothelial growth factor.

[0125] ​​5. The peptide according to Embodiment 1, wherein the peptide increases expression of a hair growth-related factor selected from the group consisting of MSH homologous box 2 and keratin-14.

[0126] 6. The peptide according to Embodiment 1, wherein the peptide increases expression of phosphatidylinositol-3 kinase and phosphorylation of extracellular signal-regulated kinase.

[0127] 7. The peptide according to Embodiment 1, wherein the peptide suppresses expression of transforming growth factor-βl.

[0128] 8. The peptide according to Embodiment 1, wherein the peptide increases expression of B-cell lymphoma-2 and decreases expression of B-cell lymphoma-2-associated X protein.

[0129] 9. A composition for preventing or improving alopecia, comprising as an effective ingredient one or more peptides selected from the group consisting of the amino acid sequences in SEQ ID NO: 1 to SEQ ID NO: 3.

[0130] 10. A composition for promoting hair growth, comprising as an effective ingredient one or more peptides selected from the group consisting of the amino acid sequences in SEQ ID NO: 1 to SEQ ID NO: 3.

[0131] 11. Use of a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3 for manufacturing a composition for preventing or improving alopecia.

[0132] 12. Use of a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3 for manufacturing a composition for promoting hair growth.

Claims

1. A peptide exhibiting hair growth promoting activity, consisting of the amino acid sequence of SEQ ID NO:

2.

2. The peptide according to claim 1, wherein the peptide promotes hair follicle cell growth.

3. The peptide according to claim 1, wherein the peptide increases expression of β-catenin.

4. The peptide according to claim 1, wherein the peptide increases expression of vascular endothelial growth factor as a hair growth-related growth factor.

5. The peptide according to claim 1, wherein the peptide increases expression of MSH homologous box 2 as a hair growth-related factor.

6. A composition for preventing or improving alopecia, comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 2 as an effective ingredient.

7. A composition for promoting hair growth or hair development, comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 2 as an effective ingredient.

8. Use of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 for manufacturing a composition for preventing or improving alopecia.

9. Use of a peptide consisting of the amino acid sequence of SEQ ID NO: 2 for manufacturing a composition for promoting hair growth or hair development.

Images