Peptides exhibiting hair growth and / or hair growth promotion activity and uses thereof

Abstract

The present application provides a peptide exhibiting hair growth promoting activity. The peptide of the present application promotes hair follicle cell growth and exhibits excellent effects on hair growth by promoting the expression of hair growth-related growth factors and hair growth-related factors. The peptide of the present application can be used for hair loss prevention or improvement, hair growth promotion, and hair growth improvement. Furthermore, the excellent activity and stability of the peptide of the present application can be very advantageously applied to pharmaceuticals, quasi-drugs, or cosmetics.

Description

[0001] This application is a divisional application of the same invention patent application 201780010329.8, filed on February 9, 2017. [Technical Field]

[0002] This invention relates to peptides exhibiting hair growth and / or hair development promoting activity, hair growth promoting compositions containing the above-mentioned peptides as active ingredients, and the use of the above-mentioned peptides in promoting hair growth. [Background Technology]

[0003] Hair follicles, unique organs of mammalian skin, grow from the lower part of the primary epidermis and extend into deeper layers of skin. At the base of the hair follicle lies a plug of cells known as vesicles or dermal papilla cells (Stennand Paus, Physiol. Rev., 81:449 (2002)). These papillae are essential for the normal circulation of the hair follicle (Oliver, Embryol. Exp. Morph. 15:3311 (1966); Oliver, Embryol. Exp. Morph. 16:231 (1966)) and for the growth of the hair shaft. The hair shaft is a pedal-shaped structure made from tightly packed cells filled with keratin filaments and fibrin aggregates.

[0004] Human hair cycles through anagen (growth), catagen (transitional), and telogen (resting) phases, undergoing a process of shedding and regrowth. The hair cycle is determined by hormonal regulation or the regulation of many growth factors. On the other hand, severe stress or nutritional deficiencies can cause hair to prematurely pass through the catagen phase and enter the telogen phase, thus inducing severe hair loss (American Journal of Pathology, 162(3)(2003), (Arck, Petra Clara; Handjiski, Bori)).

[0005] In male pattern baldness, hair follicles on the front and upper part of the scalp are sensitive to androgens. Therefore, in male pattern baldness, the destruction of hair follicles is equivalent to their miniaturization, due to the excessive secretion of androgens. Excessive androgen secretion activates 5-alpha reductase, which converts testosterone into dihydrotestosterone (DHT). This DHT shortens the hair growth period, miniaturizes hair follicles, and reduces the number of thick, strong hairs, thus inducing hair loss.

[0006] Hair loss typically spreads with age. Different medical conditions, such as traumatic alopecia, burns, or scarring associated with pressure injuries, can lead to significant hair loss. To treat this type of hair loss, various substances are currently used as medicines, but these are too expensive and cause numerous side effects.

[0007] Furthermore, it has the following drawbacks: this medicine needs to be used continuously, and when it is stopped, it may induce hair loss again; the efficacy varies greatly from person to person, and the side effects also vary from person to person.

[0008] In addition to their low price, the raw materials used in cosmetics are often composed of plant extracts, which limits their actual efficacy. Therefore, there is a significant need in this field for new, more cost-effective active ingredients that are both efficient and economical.

[0009] Currently, the two most known available medications (minoxidil and phenasteride) can delay additional hair loss, but they do not induce hair follicle regeneration. Furthermore, in the hair cosmetics market, there are many hair loss prevention products that utilize plant extracts and the like.

[0010] For example, products for male pattern baldness have been developed containing extracts of Sophora flavescens, capsicum, Angelica dahurica, Pinellia ternata, Panax notoginseng root bark, Panax ginseng leaf, ginseng, licorice, peony root, Rehmannia glutinosa, fennel, Cornus officinalis, and garlic. These products also exhibit hair growth-promoting effects by adding a combination containing xanthine and growth hormone to improve the inhibition of excessive dihydrotestosterone-based cell metabolism, while growth hormone promotes hair growth, thereby preventing hair loss and promoting hair regrowth. Furthermore, products containing minerals, vitamins, green tea, and rosemary have been developed to further promote hair growth. Products containing extracts of incense, mugwort, and licorice are used to nourish the scalp and hair, and are effective in preventing hair loss and promoting hair growth. Other hair loss products for men use a mixture of vitamins B, C, D, and E, niacin, pantothenic acid, biotin, and folic acid, along with plant extracts, to inhibit 5-alpha reductase in the body, thus preventing the formation of dihydrotestosterone during the metabolism of male hormones and aiding in hair metabolism. However, it is difficult to find products that actually affect the generation of new hair.

[0011] This specification references numerous academic papers and patent documents, and their citations are acknowledged. The full disclosures of all cited papers and patent documents are inserted within this specification for reference, thereby more clearly illustrating the level of technical expertise to which this invention pertains and the content of this invention. [Summary of the Invention]

[0012] [Technical Issues]

[0013] The inventors have worked to develop peptides with excellent hair growth and / or hair development effects. As a result, the inventors screened three peptides from a peptide library that exhibited excellent hair growth effects and demonstrated these effects through experiments, thus completing this invention.

[0014] Therefore, the object of the present invention is to provide a peptide consisting of an amino acid sequence selected from sequences 1 to 3 that exhibits hair growth and / or hair development promoting activity.

[0015] Another object of the present invention is to provide a composition for preventing and / or improving hair loss, comprising one or more peptides selected from amino acid sequences selected from sequences 1 to 3 as active ingredients.

[0016] Another object of the present invention is to provide a hair growth and / or hair development promotion composition comprising one or more peptides selected from amino acid sequences selected from sequences 1 to 3 as active ingredients.

[0017] Another object of the present invention is to provide the use of a peptide composed of an amino acid sequence selected from sequences 1 to 3 for preventing and / or improving hair loss.

[0018] Another object of the present invention is to provide the use of a peptide composed of an amino acid sequence selected from sequences 1 to 3 for promoting hair growth and / or hair development.

[0019] Other objects and advantages of the invention will become clearer from the following detailed description of the invention, the scope of protection claimed, and the accompanying drawings.

[0020] Solution to the problem

[0021] The inventors have worked to develop peptides with excellent hair growth and / or hair regrowth promotion effects. As a result, the inventors screened three peptides from a peptide library that exhibited excellent hair growth and / or hair regrowth promotion effects, and demonstrated these effects through experiments.

[0022] One embodiment of the present invention relates to a peptide comprising an amino acid sequence selected from sequences 1 to 3 that exhibits hair growth and / or hair development promoting activity.

[0023] The peptide may comprise an amino acid sequence selected from sequences 1 to 3, for example, it may consist of an amino acid sequence selected from sequences 1 to 3.

[0024] In this specification, "peptide" refers to a linear molecule formed by the combination of amino acid residues linked together by peptide bonds. The peptides of the present invention can be prepared by chemical synthesis methods known in the art, especially solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (US Patent No. 5516891).

[0025] The peptides of this invention were selected by the inventors from a preserved peptide library through cell proliferation experiments. Three peptides with excellent hair growth effects were provided as the peptides of this invention.

[0026] As part of the selected amino acid sequence of the peptide of the present invention, in order to increase its activity, the N-terminus and / or C-terminus of the peptide may be induced to deform.

[0027] For example, the above-mentioned C-terminal deformation can be the C-terminus of a peptide deformed into hydroxyl (-OH), amino (-NH2), azide compound (-NHNH2), etc., but is not limited to this.

[0028] Furthermore, the aforementioned N-terminal modification can be that the N-terminus of the peptide is bound with one or more protecting groups selected from acetyl, fluorenylmethoxycarbonyl, formyl, palmitoyl, myristyl, stearoyl, and polyethylene glycol (PEG), but is not limited thereto. These protecting groups serve to protect the peptide of the present invention from attack by protein-cleaving enzymes in vivo.

[0029] The N-terminal and / or C-terminal deformation of the above-mentioned peptides greatly improves the stability of the peptides. Through this deformation, the peptides of the present invention can increase the lifespan when administered in vivo, thereby having a high half-life.

[0030] In this specification, the term "stability" refers not only to in vivo stability but also to storage stability (e.g., room temperature storage stability).

[0031] In this invention, "hair growth promotion" refers to the generation of hair, used broadly to increase the speed and amount of hair growth. Furthermore, it also refers to enhancing hair root function or shortening the hair loss and growth cycle, thereby increasing the number of hairs growing from the hair follicle.

[0032] In this invention, "hair growth" or "hair development" refers to the increase in the thickness or length of the generated hair (hair) and the effect on its growth rate.

[0033] According to another embodiment of the present invention, the peptide of the present invention promotes the growth of hair follicle cells and promotes the expression of β-catenin, a hair growth-related factor, thereby increasing the expression of keratinocyte growth factor (KGF), basic fibroblast growth factor (bFGF), and vascular endothelial growth factor (VEGF), all of which are hair growth-related growth factors. It also increases the expression of phosphatidylinositol 3-kinase (PI3K), a hair growth signaling molecule, and promotes the expression of extracellular signal-regulated kinase (ERK). Increased phosphorylation of kinase leads to changes in the expression of MSH homeobox 2 and keratin-14, which are hair growth-related factors, inhibits the expression of transforming growth factor-β1, which is associated with delayed hair growth, and induces an increase in the expression of B-cell lymphoma-2, which is an apoptosis-inhibiting protein, and a decrease in the expression of B-cell lymphoma-2-associated X protein, which is an apoptosis-related protein.

[0034] This result implies that the peptides of the present invention have excellent efficacy in promoting hair growth and / or hair development. Therefore, the peptides of the present invention can be used for the prevention and / or improvement of hair loss, and for promoting hair growth and / or hair development.

[0035] Another embodiment of the present invention relates to a composition for preventing or improving hair loss, comprising the peptides of the present invention as active ingredients.

[0036] In this invention, hair loss prevention "refers to inhibiting or weakening the phenomenon of hair falling out of the hair follicle or scalp".

[0037] The peptides of this invention can generate new hair follicles by inducing the proliferation of cells located in hair follicles in skin tissue capable of generating hair roots. In particular, it expresses hair growth-promoting genes by activating β-catenin signaling and increases the expression of growth factors involved in hair growth.

[0038] The peptides of this invention promote the anagen phase, the period during which hair grows and develops. By maintaining the hair cycle during the catagen phase, which is influenced by various environmental factors, the peptides exhibit a hair loss inhibitory effect. Furthermore, in normal hair, they provide nutrients to maintain hair health. Therefore, the compositions of this invention are highly effective in preventing and / or improving hair loss.

[0039] The compositions of the present invention contain the peptides of the present invention described above as active ingredients; therefore, common descriptions among them are omitted to avoid making this specification too complex.

[0040] Another embodiment of the present invention provides a hair growth and / or hair development promotion composition comprising one or more peptides selected from peptides as active ingredients, wherein the peptides are composed of amino acid sequences selected from sequences 1 to 3.

[0041] The compositions of the present invention can be prepared into cosmetic compositions, but are not limited thereto.

[0042] The above-mentioned cosmetic composition may contain a cosmetically effective amount of the peptide of the present invention.

[0043] Furthermore, the aforementioned cosmetic composition may also include a carrier acceptable on cosmetics, but is not limited thereto.

[0044] In this specification, the term "cosmetic effective amount" means the amount sufficient to achieve the efficacy of the cosmetic composition of the present invention.

[0045] The cosmetic compositions of the present invention can be prepared into any dosage form commonly prepared in the art to which this invention pertains, for example, into solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, cleansers containing surfactants, oils, powder foundations, emulsion foundations, wax foundations, and / or sprays, but are not limited thereto. For example, they can be prepared into softening toners, nourishing toners, nourishing creams, massage creams, serums, eye creams, cleansing creams, facial cleansers, makeup removers, masks, sprays, and / or powders.

[0046] When the dosage form of the above-mentioned cosmetic composition is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, amine gum, cellulose derivatives, polyethylene glycol, silicon, bentonite, silica, talc or zinc oxide may be used as carrier components, but are not limited to these.

[0047] When the above-mentioned cosmetic composition is in the form of powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as carrier components. In particular, in the case of spray, it may also contain propellants such as chlorofluorocarbons, propane / butane or dimethyl ether, but is not limited thereto.

[0048] When the dosage form of the above-mentioned cosmetic composition is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylethylene glycol oil, glycerol fatty acid ester, polyethylene glycol or fatty acid ester of sorbitol.

[0049] When the dosage form of the above-mentioned cosmetic composition is a suspension, the carrier component may be a liquid diluent such as water, ethanol or propylene glycol; a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitan ester and polyoxyethylene dehydrated sorbitan ester; microcrystalline cellulose; aluminum hydroxide; bentonite; agar or amine yellow gum, etc., but not limited to these.

[0050] When the dosage form of the above-mentioned cosmetic composition is a facial cleanser containing surfactants, fatty alcohol sulfates, fatty alcohol ether sulfates, sulfosuccinate monoesters, hydroxyethyl sulfonates, imidazoline derivatives, methyl taurine, sarcosinates, fatty acid amide ether sulfates, alkylamide betaine, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, or ethoxylated glycerol fatty acid esters may be used as carrier components, but are not limited to these.

[0051] In addition to peptides and carrier components that are active ingredients, the cosmetic compositions contained in this invention include a variety of ingredients commonly used in cosmetic compositions, such as antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances, but are not limited thereto.

[0052] Another embodiment of the present invention relates to the use of a peptide composed of an amino acid sequence selected from sequences 1 to 3 for the prevention and / or improvement of hair loss.

[0053] The peptides described above are the same as those described above; therefore, to avoid making this specification too complicated, common descriptions between them are omitted.

[0054] Another embodiment of the present invention relates to the use of a peptide composed of an amino acid sequence selected from sequences 1 to 3 for promoting hair growth and / or promoting hair development.

[0055] The peptides described above are the same as those described above; therefore, to avoid making this specification too complicated, common descriptions between them are omitted.

[0056] [The effects of the invention]

[0057] This invention relates to peptides having hair growth and / or hair regrowth promoting activity, compositions for preventing and / or improving hair loss containing the aforementioned peptides as active ingredients, compositions for promoting hair growth and / or hair regrowth containing the aforementioned peptides as active ingredients, uses of the aforementioned peptides for preventing and / or improving hair loss, and uses of the aforementioned peptides for promoting hair growth and / or hair regrowth. The aforementioned peptides promote hair follicle cell growth and exhibit excellent effects on hair growth and / or hair regrowth by promoting the expression of hair growth-related growth factors and hair growth-related factors. Furthermore, due to their excellent activity and stability, they are very advantageously applicable to cosmetics. [Attached Image Description]

[0058] Figure 1a A graph illustrating the growth-promoting effect of a peptide composed of the amino acid sequence of Sequence 1 of an embodiment of the present invention on human hair follicle dermal papilla cells (HHFDPC).

[0059] Figure 1b A graph illustrating the growth-promoting effect of a peptide composed of the amino acid sequence of Sequence 2 of an embodiment of the present invention on human hair follicle dermal papilla cells.

[0060] Figure 1c A graph illustrating the growth-promoting effect of a peptide composed of the amino acid sequence of sequence 3 of an embodiment of the present invention on human hair follicle dermal papilla cells.

[0061] Figure 2a A graph illustrating the results of confirmation of increased expression of the peptide β-catenin composed of the amino acid sequence of Sequence 1 of an embodiment of the present invention.

[0062] Figure 2b A graph illustrating the results of confirmation of increased expression of the peptide β-catenin composed of the amino acid sequence of sequence 2 of an embodiment of the present invention.

[0063] Figure 2c A graph illustrating the results of confirmation of increased expression of the peptide β-catenin composed of the amino acid sequence of sequence 3 of an embodiment of the present invention.

[0064] Figure 3a Photographs showing the results of confirming the expression of keratinocyte growth factor and basic fibroblast growth factor based on peptides composed of the amino acid sequence of Sequence 1 of an embodiment of the present invention.

[0065] Figure 3b A graph showing the results of confirming increased expression of vascular endothelial growth factor based on a peptide composed of the amino acid sequence of sequence 2 of an embodiment of the present invention.

[0066] Figure 3c A graph showing the results of confirming increased expression of vascular endothelial growth factor and basic fibroblast growth factor in peptides based on the amino acid sequence of sequence 3 of an embodiment of the present invention.

[0067] Figure 4a A graph illustrating the results confirming the increased expression of phosphatidylinositol-3 kinase and the increased phosphorylation of extracellular signal-regulated kinases in peptides based on the amino acid sequence of Sequence 1 of an embodiment of the present invention.

[0068] Figure 4bA graph illustrating the results confirming the increased expression of phosphatidylinositol-3 kinase and the increased phosphorylation of extracellular signal-regulated kinases in a peptide based on the amino acid sequence of sequence 3 of an embodiment of the present invention.

[0069] Figure 5a A photograph showing the results of distinguishing the increased expression of MSH homology box 2 in peptides based on the amino acid sequence of sequence 2 of an embodiment of the present invention.

[0070] Figure 5b A photograph showing the results of distinguishing the increased expression of MSH homology box 2 in peptides based on the amino acid sequence of sequence 3 of an embodiment of the present invention.

[0071] Figure 6a A photograph showing the results of confirming the inhibition of transforming growth factor-β1 expression based on a peptide composed of the amino acid sequence of Sequence 1 of an embodiment of the present invention.

[0072] Figure 6b A photograph showing the results of confirming the inhibition of transforming growth factor-β1 expression based on a peptide composed of the amino acid sequence of sequence 2 of an embodiment of the present invention.

[0073] Figure 7a Photographs showing the results of confirming the increased expression of B-cell lymphoma-2 and the decreased expression of B-cell lymphoma-2-associated X protein in a peptide based on the amino acid sequence of Sequence 1 of an embodiment of the present invention.

[0074] Figure 7b Photographs showing the results of confirming the increased expression of B-cell lymphoma-2 and the decreased expression of B-cell lymphoma-2-associated X protein in a peptide based on the amino acid sequence of sequence 3 of an embodiment of the present invention.

[0075] Figure 8 A photograph illustrating the results of confirming increased expression of keratin-14 based on a peptide composed of the amino acid sequence of Sequence 1 of an embodiment of the present invention.

Detailed Implementation Methods

[0076] The present invention will now be described in more detail through embodiments. These embodiments are only for the purpose of further illustrating the invention, and the scope of the invention is not limited to these embodiments, as will be apparent to those skilled in the art.

[0077]

Example

[0078]

Synthesis Example 1: Peptide Synthesis

[0079] 700 mg of chlorotritylchloride resin (CTL resin, Novabiochem Cat No. 01-64-0021) was placed in a reaction vessel, and 10 ml of dichloromethane (MC) was added and stirred for 3 minutes. The solution was removed, and 10 ml of dimethylformamide (DMF) was added and stirred for 3 minutes, after which the solvent was removed again. 10 ml of the dichloromethane (DCM) solution was added to the reactor, along with 200 mmol of Fmoc-Ile-OH (Bachem, Swiss) and 400 mmol of diisopropylethylamine (DIEA), and the mixture was stirred until homogeneous. The mixture was stirred for 1 hour and allowed to react. After the reaction, the mixture was washed by dissolving methanol and diisopropylethylamine (2:1) in dichloromethane, reacting for 10 minutes, and then washing with excess dichloromethane / dimethylformamide (1:1). The solution was removed, and 10 ml of dimethylformamide (DMF) was added and stirred for 3 minutes, after which the solvent was removed again. 10 ml of the deprotection solution (20% piperidine / dimethylformamide) was added to the reaction vessel, and the mixture was stirred at room temperature for 10 minutes, after which the solution was removed. The same amount of deprotection solution was added, and the reaction was maintained for another 10 minutes, after which the solution was removed. The mixture was then washed twice with dimethylformamide, once with dichloromethane, and once with dimethylformamide, each for 3 minutes, to prepare the Ile-CTL Resin resin. In a new reactor, 10 ml of dimethylformamide solution was added, along with 200 mmol / L Lys(Boc)-OH (Bachem, Swiss), 200 mmol / L hydroxybenzotriazole (HoBt), and 200 mmol / L benzotriazole-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate (Bop), and the mixture was stirred until homogeneous. In a reactor, 400 mmol of N,N-diisopropylethylamine (DIEA) was added twice via fractional distillation, and the mixture was stirred for at least 5 minutes until all solids dissolved. The dissolved amino acid mixture was then placed in a reaction vessel with a deprotected resin and stirred at room temperature for 1 hour. The reaction mixture was removed, and the resin was stirred with dimethylformamide solution for 5 minutes each time, for a total of 3 times, before removal. A small amount of the reacted resin was taken, and the extent of reaction was checked using the Nihydrin test. Lys(Boc)-Ile-CTL Resin resin was prepared by performing two deprotection reactions using the same method as described above. After thorough washing with dimethylformamide and dichloromethane, the Nihydrin test was repeated, followed by the amino acid adhesion experiment performed using the same method as described above.Based on the selected amino acid sequence, a chain reaction was carried out in the order of Fmoc-Arg(Pbf)-OH and Fmoc-Arg(Pbf)-OH. The Fmoc-protecting group was reacted twice with a deprotection solution at 10-minute intervals, then cleaned and removed. The peptide resin, prepared after acetylation with acetic anhydride and N,N-diisopropylethylamine and hydroxybenzotriazole (HoBt) for 1 hour, was washed three times with dimethylformamide, dichloromethane, and methanol, respectively. After drying with slow nitrogen inflow, it was completely dried under reduced pressure (vacuum) in phosphorus pentoxide (P2O5). Then, it was placed in 30 ml of a leakage solution [95% trifluoroacetic acid (TFA), 2.5% distilled water, and 2.5% thioanisole], and the reaction was maintained at room temperature with slight agitation for 2 hours. The resin was filtered and washed with a small amount of solution before being mixed with the mother liquor. The mixture was then distilled under reduced pressure until approximately half the total volume remained. 50 ml of cool ether was added to induce precipitation, followed by centrifugation to collect the precipitate. The precipitate was washed twice with even cooler ether. The mother liquor was removed, and the mixture was thoroughly dried under nitrogen conditions to synthesize 0.7 g of peptide 1 composed of the unpurified amino acid sequence Arg-Arg-Lys-Ile (yield: 90.0%). The molecular weight was determined to be 571.7 (theoretical value: 571.72) using a molecular weight analyzer.

[0080] The same method was also used to synthesize peptide 2, consisting of the amino acid sequence of sequence 2, and peptide 3, consisting of the amino acid sequence of sequence 3, as another peptide.

[0081] Table 1

[0082]

[0083] To ensure that the peptides exhibiting hair growth-promoting effects are those that meet our criteria, we screened our peptide library using cell proliferation experiments and selected three peptides. Subsequently, we observed the hair growth-promoting effects of these three peptides by monitoring changes in the expression of various genes and proteins, thus confirming their excellent efficacy.

[0084] Example 1: DPC Proliferation Analysis

[0085] Human hair follicle dermal papilla cells were used at a concentration of 2 × 10⁻⁶. 3Cells were seeded at a density per well in 96-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 3 days with peptide treatment, followed by treatment with 100 μl of 4 mg / ml MTT solution per well for 4 hours. The absorbance was measured at 560 nm using a microplate reader after dissolving the generated formazan in dimethyl sulfoxide (DMSO). Figures 1a to 1c The results are shown.

[0086] As from Figures 1a to 1c It was confirmed that treatment of peptides consisting of amino acid sequences 1, 2, or 3, respectively, promoted the growth of human hair follicle dermal papilla cells in a concentration-dependent manner.

[0087] [Example 2: β-catenin activation assay]

[0088] Human hair follicle dermal papillary cells were divided into 2×10 3 Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 15 and 30 minutes by peptide treatment, and then recovered to isolate nuclear and cytoplasmic proteins. Immunoblotting was performed using a β-ringin antibody (Santacruz biotechnology, USA) to compare the expression morphology of β-ringin in the nucleus. Figures 2a to 2c The results are shown.

[0089] from Figures 2a to 2c It was confirmed that nuclear translocation, based on increased activity of β-catenin, a hair growth-related factor, was promoted in human hair follicle dermal papilla cells by peptide treatment consisting of amino acid sequences of sequence 1, sequence 2, or sequence 3.

[0090] [Example 3: Reverse transcription-polymerase chain reaction (RT-PCR) of keratinocyte growth factor, basic fibroblast growth factor, and vascular endothelial growth factor]

[0091] Human hair follicle dermal papillary cells were divided into 4×10 5Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 24 hours with peptide treatment, and then the cells were recovered to isolate ribonucleic acid (RNA). After ribonucleic acid quantification, complementary deoxyribonucleic acid (cDNA) was synthesized using a complementary deoxyribonucleic acid (cDNA) synthesis kit (Intron, Korea). Polymerase chain reaction (PCR) was performed using a polymerase chain reaction (PCR) premix (Intron, Korea) and primers for various keratinocyte growth factors, basic fibroblast growth factors, and vascular endothelial growth factors. Electrophoresis was then performed on a 5% agarose gel to compare the expression levels of messenger ribonucleic acid (mRNA) of these growth factors under different sample treatment conditions. Figures 3a to 3c The results are shown.

[0092] Table 2

[0093] Serial Number Primer naming Sequence list (5'-3') 4 Keratinocyte growth factor-F TCTGTCGAACACAGTGGTACCT 5 Keratinocyte growth factor R GTGTGTCCATTTAGCTGATGCAT 6 Basic fibroblast growth factor_F TGCTGGTGATGGGAGTTGTA 7 Basic fibroblast growth factor R CCTCCAAGTAGCAGCCAAAG 8 Vascular endothelial growth factor F CCATGAACTTTCTGCTGTCTT 9 Vascular endothelial growth factor R TCGATCGTTCTGTATCAGTCT

[0094] As from Figure 3a It was confirmed that peptide treatment consisting of the amino acid sequence of sequence 1 increased the expression of messenger RNA of keratinocyte growth factor and basic fibroblast growth factor, which are growth factors associated with hair growth, in human hair follicle dermal papilla cells.

[0095] Furthermore, as from Figure 3b It was confirmed that peptide treatment, consisting of the amino acid sequence of sequence 2, increased the expression of vascular endothelial growth factor (VEGF) messenger RNA, a factor that influences hair growth in human hair follicle dermal papilla cells. Figure 3c It was confirmed that peptide treatment consisting of the amino acid sequence of sequence 3 increased the expression of messenger RNA of vascular endothelial growth factor and basic fibroblast growth factor.

[0096] [Example 4: Phosphatidylinositol-3-kinase & p-extracellular signal-regulated kinase WB]

[0097] Human hair follicle dermal papillary cells were divided into 4×10 5 Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 15 and 30 minutes by peptide treatment, and then recovered to prepare cell lysate. Immunoblotting was performed using a phosphatidylinositol-3 kinase antibody (Santa Cruz Biotechnology, USA) and a phospho-ERK antibody (Cell Signaling Technology, USA) to compare protein expression morphology. Figure 4a and Figure 4b The results are shown.

[0098] As from Figure 4a and Figure 4b It was confirmed that peptide treatment consisting of amino acid sequences of sequence 1 or sequence 3 resulted in increased expression of phosphatidylinositol-3 kinase, a hair growth signaling molecule, and increased oxidation of phosphatidylinositol kinase, an extracellular signal-regulated kinase, in human hair follicle dermal papilla cells.

[0099] [Example 5: Reverse transcription-polymerase chain reaction of MSH homeobox 2]

[0100] Human hair follicle dermal papillary cells were divided into 4×10 5 Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 24 hours with peptide treatment, and then the cells were recovered to isolate ribonucleic acid (RNA). Following RNA quantification, complementary deoxyribonucleic acid (CDNA) was synthesized using a complementary deoxyribonucleic acid synthesis kit (Intron, Korea). Polymerase chain reaction (PCR) was then performed using a polymerase chain reaction premix (Intron, Korea) and MSH homology cassette 2 primers. Electrophoresis was performed on a 5% agarose gel to compare the expression levels of messenger RNA of the aforementioned growth factors under various sample treatment conditions. Figure 5a and Figure 5b The results are shown.

[0101] Table 3

[0102] Serial Number Primer naming Sequence list (5'-3') 10 MSX2_F AACACAAGACCAACCGGAAG 11 MSX2_R GCAGCCATTTTCAGCTTTTC

[0103] As from Figure 5a and Figure 5b It was confirmed that peptide treatment consisting of the amino acid sequences of sequence 2 or sequence 3 promoted the expression of MSH homeobox 2 messenger RNA, a growth factor associated with hair growth, in human hair follicle dermal papilla cells.

[0104] [Example 6: Reverse transcription-polymerase chain reaction of transforming growth factor-β1]

[0105] Human hair follicle dermal papillary cells were divided into 4×10 5Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 24 hours with peptide treatment, and then the cells were recovered to isolate ribonucleic acid (RNA). Following RNA quantification, complementary deoxyribonucleic acid (CDNA) was synthesized using a complementary deoxyribonucleic acid synthesis kit (Intron, Korea). Polymerase chain reaction (PCR) was then performed using a polymerase chain reaction premix (Intron, Korea) and transforming growth factor-β1 primers. Electrophoresis was performed on a 5% agarose gel to compare the expression levels of messenger RNA under various sample treatment conditions. Figure 6a and Figure 6b The results are shown.

[0106] Table 4

[0107] Serial Number Primer naming Sequence list (5'-3') 12 TGF-β1_F GCCCTGGATACCAACTATTGC 13 TGF-β1_R TCAGCACTTGCAGGAGTAGCG

[0108] As from Figure 6a and Figure 6b It was confirmed that peptide treatment consisting of the amino acid sequences of sequence 2 or sequence 3 promoted the expression of MSH homeobox 2 messenger RNA, a growth factor associated with hair growth, in human hair follicle dermal papilla cells.

[0109] [Example 7: Western blot analysis of B-cell lymphoma-2 / B-cell lymphoma-2-associated X protein]

[0110] Human hair follicle dermal papillary cells were divided into 4×10 5 Cells were seeded at a density per well in 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 24 hours with peptide treatment, and then recovered to prepare cell lysate. Immunoblotting was performed using antibodies against B-cell lymphoma-2 and B-cell lymphoma-2-associated X protein (Santa Cruz Biotechnology, USA) to compare protein expression morphology. Figure 7a and Figure 7b The results are shown.

[0111] As from Figure 7a and Figure 7b It was confirmed that peptide treatment consisting of amino acid sequences of sequence 1 or sequence 3 increased the expression of B-cell lymphoma-2, an apoptosis-inhibiting protein, and decreased the expression of B-cell lymphoma-2-associated X protein, an apoptosis-related protein, in human hair follicle dermal papilla cells.

[0112] [Example 8: Reverse transcription-polymerase chain reaction of keratin-14]

[0113] Human hair follicle dermal papillary cells were divided into 5×10 5Cells were seeded at a density of 6-well plates and cultured overnight. After changing to serum-free medium, the cells were cultured for 24 hours with peptide treatment, and then the cells were recovered to isolate ribonucleic acid (RNA). Following RNA quantification, complementary deoxyribonucleic acid (CDNA) was synthesized using a complementary deoxyribonucleic acid synthesis kit (Intron, Korea). Polymerase chain reaction (PCR) was then performed using a polymerase chain reaction premix (Intron, Korea) and keratin-14 primers. Electrophoresis was performed on a 5% agarose gel to compare the expression levels of messenger RNA under various sample treatment conditions. Figure 8 The results are shown.

[0114] Table 5

[0115] Serial Number Primer naming Sequence list (5'-3') 14 Keratin-14F CCACCTTTCATCTTCCCAATTCTC 15 Keratin-14_R GTGCGGATCTGGCGGTTG

[0116] As from Figure 8 It was confirmed that peptide treatment consisting of the amino acid sequence of sequence 1 increased the expression of keratin-14 messenger RNA, a hair growth-related factor, in human hair follicle dermal papilla cells.

[0117] The foregoing has described specific aspects of the present invention in detail. However, it is clear that these specific descriptions are merely examples for those skilled in the art, and the scope of the present invention is not limited thereto. Therefore, the essential scope of the present invention is defined by the appended claims and their equivalents.

[0118] [Industry Applicability]

[0119] This invention relates to peptides exhibiting hair growth and / or hair development promoting activity, hair growth promoting compositions containing the above-mentioned peptides as active ingredients, and the use of the above-mentioned peptides in promoting hair growth.

[0120] This instruction manual also includes the following:

[0121] 1. A peptide exhibiting hair growth promoting activity, comprising an amino acid sequence selected from sequences 1 to 3.

[0122] 2. The peptide according to embodiment 1, wherein the peptide promotes hair follicle cell growth.

[0123] 3. The peptide according to Embodiment 1, wherein the peptide increases the expression of β-catenin.

[0124] 4. The peptide according to Embodiment 1, wherein the peptide increases the expression of a hair growth-related growth factor selected from keratinocyte growth factor, basic fibroblast growth factor, and vascular endothelial growth factor.

[0125] 5. The peptide according to Embodiment 1, wherein the peptide increases the expression of hair growth-related factors selected from MSH homeobox 2 and keratin-14.

[0126] 6. The peptide according to embodiment 1, wherein the peptide increases the expression of phosphatidylinositol-3 kinase and phosphorylation of extracellular signal-regulated kinase.

[0127] 7. The peptide according to Embodiment 1, wherein the peptide inhibits the expression of transforming growth factor-β1.

[0128] 8. The peptide according to Embodiment 1, wherein the peptide increases the expression of B-cell lymphoma-2 and decreases the expression of B-cell lymphoma-2-associated X protein.

[0129] 9. A composition for preventing or improving hair loss, comprising one or more peptides selected from amino acid sequences of sequences 1 to 3 as an active ingredient.

[0130] 10. A hair growth or hair development promoting composition comprising one or more peptides selected from amino acid sequences of sequences 1 to 3 as an active ingredient.

[0131] 11. Use of a peptide composed of an amino acid sequence selected from sequences 1 to 3 for the manufacture of a composition for the prevention or improvement of hair loss.

[0132] 12. Use of a peptide consisting of an amino acid sequence selected from sequences 1 to 3 for the manufacture of a hair growth or hair regrowth promotion composition.

Claims

1. A peptide exhibiting hair growth promoting activity, consisting of the amino acid sequence of SEQ ID NO:

3.

2. The peptide according to claim 1, wherein the peptide promotes hair follicle cell growth.

3. The peptide according to claim 1, wherein the peptide increases expression of β-catenin.

4. The peptide according to claim 1, wherein the peptide increases expression of vascular endothelial growth factor as a hair growth-related growth factor.

5. The peptide according to claim 1, wherein the peptide increases expression of MSH homologous box 2 as a hair growth-related factor.

6. The peptide according to claim 1, wherein the peptide increases expression of phosphatidylinositol-3 kinase and phosphorylation of extracellular signal-regulated kinase.

7. The peptide according to claim 1, wherein the peptide increases expression of B-cell lymphoma-2 and decreases expression of B-cell lymphoma-2-associated X protein.

8. A composition for preventing or ameliorating alopecia, comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 3 as an effective ingredient.

9. A composition for promoting hair growth or hair development, comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 3 as an effective ingredient.

10. Use of a peptide consisting of the amino acid sequence of SEQ ID NO: 3 for manufacturing a composition for preventing or ameliorating alopecia.

11. Use of a peptide consisting of the amino acid sequence of SEQ ID NO: 3 for manufacturing a composition for promoting hair growth or hair development.

Images