A magnetic separation detection kit and method for detecting aflatoxin B1

Abstract

The present invention discloses a magnetic separation detection kit and method for detecting aflatoxin B1, which belongs to the field of biotechnology. The magnetic separation detection kit comprises an alkaline phosphatase nanoantibody fusion protein and antigen-modified magnetic beads, the amino acid sequence of the alkaline phosphatase nanoantibody fusion protein is shown in SEQ ID NO: 1, and the antigen-modified magnetic beads are modified on the surface of epoxy resin magnetic beads using the complete antigen ABF1. Based on the alkaline phosphatase nanoantibody fusion protein and the antigen-modified epoxy resin magnetic beads, the present invention develops a magnetic separation competitive chemiluminescence immunoassay for aflatoxin B1 detection that is simpler to operate and faster. This method can achieve high specificity and high sensitivity detection of aflatoxin B1, and at the same time provides a fast, simple and reliable strategy for high-sensitivity analysis of food contaminants, which is of great significance.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a magnetic separation detection kit and method for detecting aflatoxin B1. Background Art

[0002] Aflatoxin B1 (AFB1) is the most prominent and toxic of the more than 20 aflatoxins currently discovered, with contamination primarily occurring in tropical and subtropical regions. However, due to climate change, the regional distribution of AFB1 contamination is likely to increase in the coming years, implying that contamination could occur in many previously safe environments. Studies have shown that long-term exposure to AFB1 can cause cancer, chronic poisoning, birth defects, and even genetic alterations in humans, with consequential economic losses. Due to the lack of efficient and stable detoxification methods, accumulation in the food chain has become a major pathway for these problems. This intensifies the need for rapid detection capabilities, and such rapid and quantitative analysis is crucial for providing timely monitoring or early warning.

[0003] Extensive research has been conducted on the detection of AFB1 using high-performance liquid chromatography, chromatography, and mass spectrometry, with some success. However, the time-consuming pretreatment steps and the need for specialized operators make AFB1 detection challenging. Immunoassays that utilize the specific binding of antibodies and antigens are widely accepted and used due to their universal applicability, high sensitivity, simplicity, and low cost. However, a major drawback of current immunoassays is that separate reagents are required for recognition and signal generation. This necessitates labeling, immobilization, or washing procedures, which further increase analysis time. Furthermore, labeling and complex analytical steps increase batch variability and analytical error. Antibodies are central to molecular recognition and detection. The most widely used polyclonal antibodies (pAbs) and monoclonal antibodies (mAbs) face several key drawbacks that need to be overcome, including their large molecular weight, expensive preparation, poor reproducibility, and susceptibility to inactivation. Currently, many one-step immunoassays have been developed using the fusion of alkaline phosphatase (ALP) with nanobodies, such as those for fumonisin B1, porcine circovirus type 2, and ochratoxin A. While one-step immunoassays simplify the detection process, immobilization of the target or recognition antibody remains time-consuming, and the goal of establishing a "plug-and-play" immunoassay remains unmet. Given these considerations, there is an urgent need for a "plug-and-play" and rapid-readout immunoassay for AFB1 detection. Summary of the Invention

[0004] The purpose of the present invention is to provide a magnetic separation detection kit and method for detecting aflatoxin B1 to solve the problems existing in the above-mentioned prior art. The magnetic separation competitive chemiluminescence immunoassay based on highly tolerant and stable nanoantibodies can sensitively and rapidly detect aflatoxin B1, providing a fast, simple and reliable strategy for high-sensitivity analysis of food contaminants, which is of great significance.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a magnetic separation detection kit for detecting aflatoxin B1, comprising:

[0007] (1) Alkaline phosphatase nanobody fusion protein, the amino acid sequence of the alkaline phosphatase nanobody fusion protein is shown in SEQ ID NO: 1:

[0008] ** 。

[0009] (2) Antigen-modified magnetic beads, wherein the antigen-modified magnetic beads are modified on the surface of epoxy resin magnetic beads using the complete antigen ABF1-BSA.

[0010] Preferably, the method for synthesizing the alkaline phosphatase nanobody fusion protein comprises the following steps: connecting the nanobody Nb gene and the alkaline phosphatase gene through a linker (G4S)3 to form a recombinant gene, cloning the recombinant gene into an expression vector, and then transferring it into Escherichia coli for expression to obtain the alkaline phosphatase nanobody fusion protein.

[0011] Preferably, the nucleotide sequence of the recombinant gene is shown in SEQ ID NO: 2:

[0012]

[0013] Preferably, the method for preparing the antigen-modified magnetic beads comprises the following steps: reacting epoxy resin magnetic beads with aflatoxin B1-bovine serum albumin linker, vertically suspending at room temperature for 10-15 hours, blocking the remaining active sites with magnetic bead blocking buffer, and obtaining antigen-modified magnetic beads.

[0014] Preferably, the diameter of the epoxy resin magnetic beads is 0.3 μm-2.6 μm;

[0015] The mass ratio of the epoxy resin magnetic beads to the aflatoxin B1-bovine serum albumin linker is (10-20):1.

[0016] The present invention also provides a method for detecting aflatoxin B1, comprising the following steps:

[0017] (1) Establishing a detection system: the alkaline phosphatase nanobody fusion protein, the antigen-modified magnetic beads, and the aflatoxin B1 standard were mixed in PBS, and then incubated at 37°C. The alkaline phosphatase-nanobody-aflatoxin B1 complete antigen-magnetic bead complex was collected by magnetic adsorption, and then a luminescent substrate was added to detect the chemiluminescence intensity of the alkaline phosphatase nanobody fusion protein bound to the antigen-modified magnetic beads to obtain a standard curve;

[0018] (2) Using the same method as step (1) and the obtained standard curve, the content of aflatoxin B1 in the sample to be tested is obtained.

[0019] Preferably, in step (1), the volume ratio of the alkaline phosphatase nanobody fusion protein, the antigen-modified magnetic beads and the aflatoxin B1 standard is 3:4:3; the dilution ratio of the alkaline phosphatase nanobody fusion protein is (1:250)-(1:2000), the concentration of the antigen-modified magnetic beads is 0.0625-0.5 mg / mL, and the concentration of the aflatoxin B1 is 1×10 0 -1×10 5 pg / mL.

[0020] Preferably, the particle size of the antigen-modified magnetic beads is 0.3 μm, the dilution ratio of the alkaline phosphatase nanobody is 1:250, and the concentration of the antigen-modified magnetic beads is 0.25 mg / mL.

[0021] Preferably, in step (1), the incubation time is 20 min;

[0022] Before adding the luminescent substrate, the method further comprises washing the alkaline phosphatase-nanoantibody-aflatoxin B1 complete antigen-magnetic bead complex with PBST buffer for one time; the luminescent substrate is APS-5.

[0023] The present invention also provides the use of the magnetic separation detection kit in detecting aflatoxin B1 in food. More preferably, the food includes corn, oats, milk and oil.

[0024] The present invention discloses the following technical effects:

[0025] The present invention develops a simpler and faster magnetic separation competitive chemiluminescence immunoassay (MS-CLIA) for the detection of aflatoxin B1 (AFB1) based on alkaline phosphatase nanobody fusion protein (ALP-Nb) and antigen-modified epoxy resin magnetic beads (AFB1-MBs) (see the detection principle and detection flow chart for details). Figure 9 Specifically, anti-AFB1 nanoantibodies that can specifically recognize AFB1 were screened from immune camels, and AFB1-MBs and ALP-Nb fusion proteins facilitated "plug-and-play" one-step detection, shortening the total detection time of MS-CLIA from 2 hours of traditional competitive ELISA to 30 minutes. At the same time, in order to improve the performance of MS-CLIA, the detection method was optimized and tolerance experiments were conducted under complex conditions. Ultimately, MS-CLIA achieved sensitive detection of AFB1 with a minimum detection limit of 0.743 pg / mL and an IC 50 =0.33 ng / mL, with a linear range of 7.23 pg / mL to 12.38 ng / mL. The assay also demonstrated strong tolerance to sample testing and practicality in complex matrix environments. Therefore, MS-CLIA can achieve highly specific and sensitive AFB1 detection, providing a rapid, simple, and reliable strategy for the high-sensitivity analysis of food contaminants, which is of great significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0027] Figure 1 SEM and TEM images of epoxy resin beads (A), AFB1-MBs (B), and ALP-Nb-AFB1-MBs (C).

[0028] Figure 2To optimize the conditions for detecting AFB1 (1 ng / mL) using AFB1-MBs of different particle sizes and ALP-Nb of different dilutions; A: Optimized concentration of AFB1-MBs with a particle size of 0.3 μm and ALP-Nb of different dilutions; B: Optimized concentration of AFB1-MBs with a particle size of 1.0 μm and ALP-Nb of different dilutions; C: Optimized concentration of AFB1-MBs with a particle size of 2.6 μm and ALP-Nb of different dilutions;

[0029] Figure 3 Standard curves; A: Standard curve established using AFB1-MBs with a particle size of 0.3 μm; B: Standard curve established using AFB1-MBs with a particle size of 1.0 μm; C: Standard curve established using AFB1-MBs with a particle size of 2.6 μm;

[0030] Figure 4 Optimization of detection conditions in the detection system; A: Incubation time of the detection reaction at 37°C for 5, 10, 20, 40, and 80 min; B: Number of washes (1, 2, 3);

[0031] Figure 5 Optimization of detection conditions in the detection system; A: Incubation at 75°C for 0, 10, 20, 30, 40, and 50 min; B: PBS buffer with different pH values ​​was used as the dilution reagent; C: PBS buffer with different NaCl concentrations was used as the dilution reagent;

[0032] Figure 6 Standard curves generated using different methanol concentrations as the diluent; A: Standard curve generated using PBS buffer (10%) containing 10% methanol as the diluent; B: Standard curve generated using PBS buffer containing 30% methanol as the diluent; C: Standard curve generated using PBS buffer containing 60% methanol as the diluent.

[0033] Figure 7 For standard curve and specificity evaluation; A: Standard curve for AFB1 detection, concentration range from 0 to 10 6 pg / mL; B: Specificity evaluation of magnetic separation immunoassay, including AFB2, AFG1, AFG2, AFM1, FB1, DON, ZEN and T2 (all 50 ng mL-1);

[0034] Figure 8 Matrix effects of different foods; A: Matrix effect of corn; B: Matrix effect of oats; C: Matrix effect of oil; D: Matrix effect of milk;

[0035] Figure 9 Schematic diagram of the detection principle and detection process of aflatoxin B1 using magnetic separation competitive chemiluminescence immunoassay;

[0036] Figure 10 is the amino acid sequence of the AFB1 nanobody Nb10E;

[0037] Figure 11 Construct a map for pET-22b-ALP-Nb. DETAILED DESCRIPTION

[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0039] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0040] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0041] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.

[0042] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0043] Example 1

[0044] 1. Experimental methods

[0045] 1.1 Preparation of ALP-Nb fusion protein

[0046] In order to obtain a specific nanoantibody library against AFB1, healthy camels were subcutaneously immunized three times with a complete antigen (AFB1-BSA) (purchased from Shandong Ludu Biotechnology Co., Ltd.) (three immunizations were separated by one week, and each dose was 1 mg). 4-5 days after the last immunization, peripheral blood mononuclear cells were collected from 20 mL blood samples. cDNA was prepared from total RNA (RNA was reverse transcribed into cDNA by reverse transcription kit PrimeScript TM IV 1st strand cDNA Synthesis Mix, purchased from TaKaRa), cDNA was used as a template to obtain the heavy chain antibody gene, primers: Call-1: GTCCTGGCTGCTCTTCTACAAGG, Call-2: GGTACGTGCTGTTGAACTGTTCC; the heavy chain antibody gene was used as a template to obtain the nanobody gene primers: Nb-F: cggggtaccccGTCCTGGCTGCTCTTCTACA, Nb-R: tccccccgggTGAGGAGAYGGTGACCWGGGT, degenerate primers: Y = C / T; W = A / T, and a recombinant vector (named Nb-pCantab) was constructed and used to construct a nanobody phage display library. Through four rounds of phage display biopanning, a nanobody library carrying the recombinant vector Nb-pCantab was infected with M13 phage. After incubation, the nanobodies were expressed on the phage surface. The complete AFB1 antigen was immobilized, and the nanobody-expressing phage bound to the complete AFB1 antigen. Unbound phage were removed by elution using PBST. In the first and second rounds of panning, nanobody-expressing phage bound to the complete antigen were eluted using glycine (0.2M) and Tris-HCl. Phage obtained from each elution round were used for the next round of panning. In the third and fourth rounds, an AFB1 standard was used to competitively elute the nanobody-expressing phage bound to the complete antigen. VHH clones with good competitive binding to AFB1 were selected from the phage VHH (also called Nanobody) library. The VHH gene was PCR amplified using the pET-22b-Nb-F and pET-22b-Nb-R primers. The recombinant plasmid, designated pET-22b-VHH vector, was digested with the PCR products at the same restriction sites and ligated into the pET-22b vector. The VHH proteins were expressed in Escherichia coli (E. coli) strain Trans B (DE3) and induced overnight with isopropyl-β-D-thiogalactopyranoside (IPTG, 0.1 mM) at 16°C. The VHH proteins were directly purified using a Ni-NTA column. To evaluate the binding ability of the expressed and purified products, an indirect competitive enzyme-linked immunosorbent assay (ELISA) using an anti-His-tag mAb-HRP was used. Results showed that Nb10E exhibited superior binding activity and specificity for AFB1.

[0047] The ALP-Nb fusion protein was constructed by fusing Nb, (G4S)3 linker and ALP (derived from Escherichia coli) by SOE-PCR. Then, as described above, the recombinant gene of the alkaline phosphatase nanobody fusion protein was cloned into pET-22b. The pET-22b-ALP-Nb plasmid was transformed into Escherichia coli Trans B (DE3). As described above, the expression and purity of ALP-Nb were determined. Finally, ALP-Nb was identified by SDS-PAGE. The good binding and competitive activity of ALP-Nb were demonstrated by a one-step indirect competitive chemiluminescent immunoassay (icCLIA) using the chemiluminescent reaction intensity of ALP and APS-5 as signal output.

[0048] 1.2 Preparation of AFB1-BSA Immunomagnetic Beads

[0049] 0.2 mL of epoxy resin magnetic beads (MBs) (20 mg mL -1 ) was injected into a 1.5 mL tube. The tube was placed in a magnetic field for separation. The MBs were washed three times with 0.5 mL of PBS buffer (0.1 mM, 1 mM EDTA, pH 8.5). Then, the MBs were suspended in 1 mL of PBS buffer containing 0.15 mg of AFB1-BSA and 185 mg of Na2SO4, and a control group without AFB1-BSA was established, named negative magnetic beads (N-MBs). The two mixtures were gently shaken at room temperature for 12 hours and washed three times with 0.5 mL of PBS buffer. Afterwards, they were blocked with magnetic bead blocking buffer for 6 hours and washed 6 times with 1 mL of PBST (0.1% Tween-20) / PBS buffer to obtain AFB1-BSA-MBs (AFB1-MBs) and N-MBs.

[0050] 1.3 Establishment of detection system

[0051] AFB1-MBs were titrated using a series of ALP-Nb concentrations. The target (AFB1 standard), ALP-Nb, and AFB1-MBs were mixed in PBS to create a reaction system consisting of 30 μL AFB1 standard, 30 μL ALP-Nb, and 40 μL AFB1-MBs. The mixture was then added to a low-specificity white ELISA plate and incubated at 37°C. ALP-Nb-AFB1-MBs were collected by magnetic adsorption, and free AFB1 and ALP-Nb-AFB1 were washed with PBST. Subsequently, 100 μL APS-5 was added to the reaction well, and the chemiluminescent signal (CL) intensity of ALP-Nb bound to AFB1-MBs was monitored using a SpectraMax-5M (Molecular Devices, USA).

[0052] 1.4 Optimization of the detection system

[0053] To achieve the best performance, a single-factor experiment was used to investigate the experimental conditions. The experimental conditions were optimized according to the literature. Specifically, the diameter of the epoxy resin magnetic beads (0.3, 1.0, 2.6 μm), the concentration of AFB1-MBs (0.0625, 0.125, 0.25, 0.5 mg mL -1 ), different antibody dilutions (1:250, 1:500, 1:1000 and 1:2000 for VHH), reaction time (5, 10, 20, 40 and 80 min), number of washes (1, 2, 3), thermal stability of ALP-Nb (0, 10, 20, 30, 40, 50 min at 75 °C), methanol content of target dilution (10%, 30%, 60%), reaction buffer pH (pH = 1.0, 2.0, 4.0, 6.0, 8.0, 10.0, 12.0 in PBS), NaCl concentration (0, 25, 50, 100, 200 and 400 mM in PBS), by comparing 0.5 ng mL -1 The CL intensity and inhibition rate of AFB1 were optimized and screened. The nonspecific adsorption of MBs to ALP-Nb was analyzed using blocked N-MBs as negative control.

[0054] 1.5 Specificity

[0055] Specificity, expressed as inhibition ratio (IR), is assessed against structural analogs such as aflatoxin B2 (AFB2), aflatoxin G1 (AFG1), aflatoxin G2 (AFG2), aflatoxin M1 (AFM1), fumonisin B1 (FB1), deoxynivalenol (DON), zearalenone (ZEN), and trichothecene-2 ​​(T2). IR (%) is expressed as the inhibition ratio of the target analyte and the analog at the same concentration.

[0056] 1.6 Magnetic separation competitive immunoassay method in samples

[0057] The accuracy of the detection system is determined by the recovery rate and coefficient of variation of the standard additions. First, the influence of the matrix effect on the detection system was evaluated. 20 ml of PBS solution containing 60% methanol was added to 5 g of oats / corn, and 5 ml of PBS solution containing 60% methanol was added to 1 g of milk / oil. The mixture was shaken vigorously at room temperature for 30 min, centrifuged at 6000 g for 10 min, and the supernatant was collected. The supernatant was then diluted 1-fold with PBS as an AFB1 diluent, and the effects of the supernatants of different samples and PBS solution containing 30% methanol on the detection of 1 ng mL -1The CL intensity and inhibition rate of AFB1 were affected by the concentrations of AFB1 standard (0.08, 0.4, 0.8, 8 and 80 μg·kg -1 ) was added to oat / milk / oil / corn samples (according to the IC 50 、IC 20 and IC 80 ) and extracted with PBS containing 60% methanol. The spiked recovery (R, %) and coefficient of variation (CV, %) were calculated using the following formulas: Recovery (%) = (measured value / spiked value) × 100%, Coefficient of variation (%) = (standard deviation / mean) × 100%.

[0058] 2. Results and Analysis

[0059] 2.1 Acquisition of anti-AFB1 nanobodies

[0060] Nanobodies have been widely reported in immunoassays and can be easily obtained through several rounds of biopanning. After three immunizations with AFB1-BSA, the anti-AFB1 antibody titer reached 1:5000. Total cellular RNA was isolated from approximately 20 mL of peripheral blood, reverse transcribed into cDNA, and amplified to a fragment of approximately 750 bp in the first round of PCR. Then, a target band of approximately 450 bp was amplified in the second round of PCR. Finally, a phage display library targeting AFB1 was constructed with a capacity of approximately 6×10 7 CFU·mL -1 The insertion of the VHH gene and the diversity of the library were confirmed by colony PCR of 10 randomly selected individual clones, indicating an insertion rate exceeding 90%. Sequencing results showed a large diversity. These results indicate the successful development of a reliable phage display library for screening nanobodies against AFB1.

[0061] During the four rounds of biopanning, the encapsulation concentration of AFB1-BSA antigen decreased in each round. Specific phages that bound to the AFB1 antigen were eluted with Tris-HCl in the first and second rounds of biopanning, and then competitively eluted with AFB1 standards in the third and fourth rounds of biopanning. Positive clones were sequenced using M13 primers and subsequently classified based on the amino acid sequences of the complementary determining regions (CDRs). Finally, a specific anti-AFB1 nanobody was obtained and named Nb10E ( Figure 10 Furthermore, icELISA revealed that Nb10E exhibited high binding activity to AFB1.

[0062] 2.2 Preparation of ALP-Nb

[0063] The construction of pET-22b-ALP-Nb is shown in Figure 11 The positive recombinant plasmid was confirmed by sequencing and the correct plasmid was transformed into Escherichia coli Trans B (DE3). A colony was selected from the 2YT agar plate and cultured in a shaking incubator at 37°C and 220 rpm. When the OD 600 When the RI value reached between 0.4 and 0.6, IPTG was added to induce expression of the ALP-Nb fusion protein. After purification using a Ni-NTA column, the ALP-Nb fusion protein was analyzed by SDS-PAGE. SDS-PAGE analysis showed that the fusion protein was soluble and had a single band at approximately 70 kDa. ALP-Nb was successfully produced.

[0064] 2.3AFB1-BSA modified epoxy resin magnetic beads

[0065] Epoxy groups [-CH(O)CH-] have the ability to react with multifunctional compounds to form cured products with cross-linked structures. They can undergo ring-opening reactions with sulfhydryl groups and bind thioethers under mild conditions due to the high tension in the three-membered ring. Bovine serum albumin (BSA) has a free sulfhydryl group located at position 34 of the BSA peptide chain. Therefore, AFB1-BSA can be modified on the surface of epoxy-based magnetic beads. Figure 1 As shown in A and B, field emission scanning electron microscopy (SEM) images show that the epoxy-based magnetic beads are clumpy with a rough surface and an average diameter of approximately 0.3 μm. The rough surface of the magnetic beads is conducive to labeling biomacromolecules such as proteins. However, AFB1-MBs are monodisperse and uniform with a smooth surface. Figure 1 The detailed structures in A and B show that the edges of MBs are clear and the surface is uneven by field emission transmission electron microscopy (TEM), while the edges of AFB1-MBs are blurred. TEM images show similar size and surface morphology, which is consistent with the results of SEM. E. coli ALP is a dimer composed of the same monomer. Therefore, Figure 1 C shows that a gap of fixed size is formed at the junction of AFB1-MBs and ALP-Nb, and the above phenomenon is more obvious in the TEM image.

[0066] 2.4 Optimization of the detection system

[0067] 2.4.1 Concentrations of AFB1-MBs and different dilutions of ALP-Nb.

[0068] The dilution of ALP-Nb represents the concentration series of ALP-Nb in the detection system. Low ALP-Nb content will lead to insufficient CL intensity. Conversely, low detection sensitivity may be due to high ALP-Nb content. The same is true for the effect of AFB1-MBs concentration on sensitivity. Therefore, the appropriate AFB1-MBs and ALP-Nb content is crucial for the reaction system ( Figure 2 Our results showed that when the concentration of AFB1-MBs was 0.25 mg·mL -1 When the ALP-Nb dilution was 1:250, the sensitivity of the detection system was optimal. The three sizes of magnetic beads had the best inhibition rate on AFB1 (1.0 ng mL-1) at the above ratio concentration.

[0069] 2.4.2 Epoxy Bead Size

[0070] The size of epoxy magnetic beads affects the CL intensity and the stability of antibody / antigen binding. Therefore, MBs with the optimal diameter and surface area can bind the substance and more easily detect sufficient CL signal. After determining the ratio of MBs to ALP-Nb in the detection system, three standard curves with different MB particle sizes were established ( Figure 3 A, B, C). Our results show that 0.3 μm MBs achieve the best sensitivity, (IC 50 0.422 ng·mL -1 The linear range is 0.0372~4.314ng·mL -1 ),( Figure 1 A).

[0071] 2.4.3 Reaction time and number of washes

[0072] To improve the sensitivity of the assay and reduce the detection time, the reaction time and wash times were optimized. The reaction system was incubated at 37°C for 5, 10, 20, 40, and 80 minutes. The results showed that the reaction reached the maximum CL intensity at 20 minutes and exhibited excellent sensitivity, and remained stable at 40 and 80 minutes. Figure 4 A). Therefore, the reaction incubation time was set to 20 minutes, which saved a lot of time compared to traditional ELISA and other methods. Subsequently, after the 20-minute incubation, the number of post-reaction washes was optimized. The free sample was eluted, and the ALP-Nb-AFB1-MBs were adsorbed to the bottom of the reaction pool by magnetic enrichment. They were then eluted with PBST 1, 2, and 3 times, respectively. The results showed that when the number of washes was 1, the CL intensity and detection sensitivity were better ( Figure 4 B) In summary, this method ensures improved sensitivity while significantly shortening the detection time, from sample addition to result acquisition to just 30 minutes. Furthermore, the operation process is simple and convenient.

[0073] 2.4.4 Stability and sensitivity

[0074] Compared with traditional antibodies, nanobodies have unique physical and chemical advantages, such as high tolerance to temperature, methanol, salt concentration and pH value. In order to enable the detection system to cope with the complex and uncontrollable detection environment after the fusion expression of Nb and ALP, to verify whether the advantages of Nb itself are affected, and to examine the tolerance of ALP to the above conditions. We conducted a series of reaction conditions and tolerance experiments. In the results of the thermal stability experiment, we found that ALP-Nb still has high activity. After incubation at 75°C for 20 minutes, the binding ability of Nb to the target and the ALP-catalyzed chemiluminescence activity of APS-5 are relatively stable ( Figure 5 A). Methanol is a commonly used target extraction solvent in crop sample testing. In order to make our method more practical and better applied to sample testing, we established standard curves in three different concentrations of methanol solutions, such as Figure 6 AC. The results showed that ALP-Nb had good tolerance, high activity and detection sensitivity in PBS buffer containing 60% methanol. In PBS buffer containing 10% and 30% methanol, IC 50 Close to (IC in PBS buffer containing 10% methanol 50 =0.39 ng·mL -1 PBS buffer containing 30% methanol 50 =0.46ng·mL -1 ), but the linear range of the detection was wider in PBS buffer containing 30% methanol. Finally, the pH value and salt concentration were optimized. HCl and NaOH were added to the PBS buffer to adjust the pH value. ALP-Nb showed a certain tolerance to strong acids and strong bases under different pH reaction conditions. The CL intensity was the largest at a pH of 8.0 in PBS buffer ( Figure 5 B), which may be determined by the characteristics of ALP itself. Due to the characteristics of Nb, alkaline conditions do not affect the activity of the target bound by Nb. As above, NaCl was added to PBS buffer to prepare PBS buffer with different salt concentrations. Our method has excellent sensitivity in 200mM NaCl-PBS buffer ( Figure 5 C). Many samples contain high concentrations of NaCl, making the method's salt tolerance extremely valuable. Overall, this robust tolerance to temperature, acidity, base concentration, and salt concentration allows our method to be more readily applied to sample analysis and demonstrates strong potential.

[0075] 2.5 AFB1 magnetic separation immunoassay based on ALP-Nb10E

[0076] Under the optimized experimental conditions (30% methanol, pH 8.0, 200 mM NaCl-PBS buffer), a standard curve for the detection of AFB1 was established ( Figure 7 A). After optimization, the LOD of the immunoassay was 0.743 pg·mL. -1 (IC 90 ), IC 50 0.33 ng·mL -1 The linear range is 7.23 pg mL-1~12.38 ng·mL -1 (IC 20 -IC 80 Compared with traditional ELISA, MS-icCLIA greatly improved the detection sensitivity of AFB1. Under the same reaction conditions, ALP-Nb10E, IC based on icCLIA 50 1.05 ng·ml -1 The linear range was 35.13 pg·mL -1 ~28.205 ng·mL -1 ; Nb10E based on icELISA, IC 50 1.36 ng·mL -1 The linear range was 179.64 pg mL -1 ~13.33 ng·mL -1 .

[0077] 2.6 Cross-reactivity

[0078] To evaluate the selectivity of our immunoassay, we used AFB2, AFG1, AFG2, AFM1, FB1, DON, ZEN, and T2 (50 ng mL -1 ), which are similar to each other, to determine selectivity. Cross-reactivity is determined by analogs (50 ng mL -1 The above experiments showed that the cross-reactivity with the structural analogues of AFB1 was very low ( Figure 7 B).

[0079] 2.7 Matrix Effects

[0080] Most samples contain complex matrix compounds such as proteins, fats, sugars, and pigments. These substances may lead to inevitable and unexpected matrix effects in direct detection. Considering that the sample matrix may affect the immunoassay, we first investigated the effect of the sample matrix on our method. A PBS solution containing 60% methanol was added to the sample, shaken vigorously, and then centrifuged to collect the supernatant, which was the blank extract. The blank extract was diluted 1, 4, and 10 times, containing 0.5 ng mL -1 AFB1. The CL intensity and sensitivity of different matrix solutions were compared with PBS solution containing 30% methanol. The results showed that when the sample matrix was diluted 1, 4, and 10 times, the CL intensity and detection sensitivity remained relatively stable ( Figure 8 A, B, C, D). In order to simplify the detection procedure and shorten the detection time, the final dilution factor was determined to be 1.

[0081] 2.8 Sample testing

[0082] Recovery experiments were conducted by analyzing the culture medium spiked with six levels of AFB1 (0, 0.08, 0.4, 0.8, 8, 80 μg kg -1 ) corn, oat, milk, and oil samples. Five replicates were performed for each sample. As shown in Table 1, the average recovery of corn ranged from 81.75% to 120.30% with a CV of 2.99 to 7.26% when samples were spiked with varying amounts of AFB1. The average recovery of oat ranged from 88.95% to 103.96% with a CV of 2.24 to 11.91% when samples were spiked with varying amounts of AFB1. The average recovery of oil ranged from 98.56% to 122.25% with a CV of 2.24 to 11.91% when samples were spiked with varying amounts of AFB1. The average recovery of milk ranged from 96.24% to 123.37% with a CV of 1.48 to 9.66% when samples were spiked with varying amounts of AFB1. These results demonstrate that the established immunoassay has good accuracy and specificity for detecting AFB1 in different substrates (corn, oat, milk, and oil samples).

[0083] Table 1 Recovery analysis of AFB1 spiked into samples (corn, oats, cooking oil, milk) using magnetic separation competitive immunoassay (n=5)

[0084]

[0085]

[0086] In summary, we have developed an ultrasensitive, specific, and stable magnetic separation immunoassay for AFB1 based on ALP-Nb10E, achieving the goal of one-step detection, in which the detection procedure is significantly simplified. The detection sample and detection reagent are added to the reaction pool at the same time, the reaction time is 20 minutes, and only one washing is required, and the detection can be completed within 30 minutes. The chemiluminescence intensity is used as the output, so the detection signal is amplified, showing better sensitivity compared with the traditional ELISA. In addition, since Nb is easy to prepare, express on a large scale, and genetically modify, our detection method has the advantages of low cost and easy large-scale production. The developed nanoantibody shows a high binding affinity for AFB1, and its sensitivity can meet the detection requirements of AFB1. The recombinant protein used in the immunoassay can be mass-produced by prokaryotic expression, and people only need to retain its DNA sequence information for long-term storage. In particular, our method shows high sensitivity for AFB1, with an LOD of 0.734 pg·mL -1 , IC 50 =0.33ng·mL -1 More importantly, our detection method showed a strong ability to cope with complex testing conditions. This also means that the ALP-Nb10E-based magnetic separation immunoassay shows good application prospects in the field of rapid detection of AFB1.

[0087] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A magnetic separation detection kit for detecting aflatoxin B1, characterized in that: include: (1) an alkaline phosphatase nanobody fusion protein, the amino acid sequence of which is shown in SEQ ID NO: 1; (2) Antigen-modified magnetic beads, wherein the antigen-modified magnetic beads are modified on the surface of epoxy resin magnetic beads using the complete antigen ABF1-BSA.

2. The magnetic separation detection kit according to claim 1, wherein The method for synthesizing the alkaline phosphatase nanobody fusion protein comprises the following steps: connecting the nanobody Nb gene and the alkaline phosphatase gene via a linker (G4S)3 to form a recombinant gene, cloning the recombinant gene into an expression vector, and then transferring the recombinant gene into Escherichia coli for expression to obtain the alkaline phosphatase nanobody fusion protein.

3. The magnetic separation detection kit according to claim 2, wherein The nucleotide sequence of the recombinant gene is shown in SEQ ID NO:

2.

4. The magnetic separation detection kit according to claim 1, wherein The preparation method of the antigen-modified magnetic beads comprises the following steps: reacting epoxy resin magnetic beads and aflatoxin B1-bovine serum albumin linker, vertically suspending at room temperature for 10-15 hours, and blocking the active sites of the magnetic beads with a magnetic bead blocking buffer to obtain antigen-modified magnetic beads.

5. The magnetic separation detection kit according to claim 4, wherein The diameter of the epoxy resin magnetic beads is 0.3 μm-2.6 μm; The mass ratio of the epoxy resin magnetic beads to the aflatoxin B1-bovine serum albumin linker is (10-20):

1.

6. A method for detecting aflatoxin B1, characterized in that: The following steps are involved: (1) Establishing a detection system: the alkaline phosphatase nanobody fusion protein, the antigen-modified magnetic beads, and the aflatoxin B1 standard are mixed in PBS, and then incubated at 37°C. The alkaline phosphatase-nanobody-aflatoxin B1 complete antigen-magnetic bead complex is collected by magnetic adsorption. Then, an alkaline phosphatase chemiluminescent substrate is added to detect the chemiluminescence intensity of the alkaline phosphatase nanobody fusion protein bound to the antigen-modified magnetic beads to obtain a standard curve; (2) Using the same method as in step (1) and the obtained standard curve, obtain the content of aflatoxin B1 in the sample to be tested.

7. The method according to claim 6, wherein In step (1), the volume ratio of the alkaline phosphatase nanobody fusion protein, the antigen-modified magnetic beads and the aflatoxin B1 standard is 3:4:3; the dilution ratio of the alkaline phosphatase nanobody fusion protein is (1:250)-(1:2000), the concentration of the antigen-modified magnetic beads is 0.0625-0.5 mg / mL, and the concentration of the aflatoxin B1 is 1×10 0 -1×10 5 pg / mL.

8. The method according to claim 7, wherein In step (1), the particle size of the antigen-modified magnetic beads is 0.3 μm, the dilution ratio of the alkaline phosphatase nanobody is 1:250, and the concentration of the antigen-modified magnetic beads is 0.25 mg / mL.

9. The method according to claim 6, wherein In step (1), the incubation time is 20 min; Before adding the luminescent substrate, the method further comprises washing the alkaline phosphatase-nanoantibody-aflatoxin B1 complete antigen-magnetic bead complex with PBST buffer for one time; the luminescent substrate is APS-5.

10. Use of the magnetic separation detection kit according to any one of claims 1 to 5 in detecting aflatoxin B1 in food.

Images