A kit and method for detecting trace proteins

Abstract

The application discloses a kit and a method for detecting trace protein. The kit in the application can detect MMP13 and SCC protein at a level as low as fg / mL based on DNA string combination technology and a CRISPR-Cas12a system, and has high sensitivity. Moreover, the kit can simultaneously get rid of dependence on real-time amplification reaction, has good stability, can effectively avoid cross contamination between samples, and does not need real-time amplification in the detection process. The used ssDNA string can be prepared in advance, the kit gets rid of the real-time cycle amplification reaction which is dependent on the current detection technology, has low background signal, high stability, and can effectively prevent cross contamination between samples. Moreover, the kit has low cost, does not need to use complex and precise equipment or catalytic enzymes with special functions, and has high universality, and can be popularized to quantitative detection of any kind of protein by only replacing capture antibodies and detection antibodies.

Description

Technical Field

[0001] This invention belongs to the field of immunoassay, specifically relating to a kit and method for detecting trace amounts of protein. Background Technology

[0002] Currently, clinically used protein detection methods mainly employ enzyme-mediated colorimetric, chemiluminescent, and electrochemiluminescent methods, such as horseradish peroxidase, alkaline phosphatase, and ruthenium tripyridine. Studies show that the limits of detection (LOD) for these methods are only 0.01-50 ng / mL, and the results are often close to blank signals when detecting low concentrations of target proteins. In recent years, developing new technologies for detecting trace amounts of proteins has gradually become a research hotspot.

[0003] Since proteins cannot be amplified, the commonly used strategy is to convert protein signals into nucleic acid signals, and then utilize the amplifiability of nucleic acid molecules to amplify and amplify the signal using polymerase chain reaction (PCR) or novel isothermal amplification methods, thereby enabling the detection of low concentrations of target proteins. Immuno-PCR is a representative technique that uses antibody-labeled DNA probe molecules, combined with antigen-antibody reactions and PCR amplification, to significantly improve the detection sensitivity of target proteins, increasing the detection limit by 10% compared to ELISA. 5 While antibody covalent labeling of DNA can achieve higher sensitivity than traditional methods, the complex and time-consuming process, coupled with its strong reliance on temperature-controlled equipment like PCR instruments, limits its widespread application. The maturation of novel isothermal amplification technologies has significantly propelled the development of protein detection techniques. For example, immuno-RCA, based on rolling circle amplification (RCA), can detect cytokines as low as 1 pg / mL; immuno-HCR, based on hybridization chain reaction (HCR), can improve the sensitivity of human IgG detection to fg / mL through the cyclic extension reaction of hairpin chains; and Transcription-mediated amplification (TMA) technology, utilizing the continuous transcription reaction of T7 polymerase to generate a large number of RNA amplicones and combining them with fluorescent aptamer design, can detect HER2 protein as low as 50 fg / mL. However, although these novel detection technologies achieve highly sensitive detection of target proteins, the detection process still relies on real-time cyclic amplification reactions. This increases detection time and makes the process highly susceptible to cross-contamination between samples, leading to false positive results and affecting the repeatability and stability of the detection. In addition, research on novel platforms such as plasmonic nanosensors, superparamagnetic coupling and molecular beacon platforms, and protein chips has greatly promoted the development of the field of trace protein detection. Although these technologies are highly sensitive, require small sample volumes, and do not require real-time amplification reactions, they rely on specific detection equipment or instruments and are expensive, which limits their widespread application.

[0004] In recent years, research on CRISPR systems based on clustered regularly interspaced short palindromic repeats (CRISPR) has received widespread attention in the field of molecular detection, with the CRISPR / Cas12a system being a prime example. CRISPR / Cas12a is a class II type V CRISPR system effector protein. Guided specifically by crRNA, it forms a Cas12a-crRNA-DNA ternary complex with target DNA, which allosterically activates the non-specific paraspecific nuclease activity of the Cas12a protein. It is currently used to detect various targets, including nucleic acids and proteins. However, the CRISPR / Cas12a system has relatively low sensitivity. When detecting proteins, it still requires combined and real-time amplification with PCR or isothermal amplification techniques such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP). This makes it dependent on specific instruments (such as PCR instruments) or catalytic enzymes with specific functions (such as recombinases), increasing detection costs. Furthermore, highly sensitive real-time amplification reactions are prone to sample cross-contamination, leading to poor reproducibility.

[0005] Based on the problems existing in the prior art, the present invention aims to establish a novel, highly sensitive, stable, low-cost method for detecting trace proteins that does not require real-time amplification reaction. Summary of the Invention

[0006] The first aspect of the present invention is to provide a kit for detecting trace amounts of protein.

[0007] A second aspect of the present invention is to provide the application of the above-described reagent kit.

[0008] A third aspect of the present invention is to provide a method for detecting trace amounts of protein.

[0009] The technical solution adopted in this invention is:

[0010] In a first aspect, the present invention provides a kit for detecting trace amounts of protein, comprising: a DNA probe, a short tandem repeat sequence, and crRNA.

[0011] In some embodiments of the present invention, the 5' end sequence of the short tandem repeat sequence is complementary to the reverse sequence of the DNA probe, and the 3' end uses the ACAACTTAAC sequence as a tandem repeat unit.

[0012] In some embodiments of the present invention, the recognition sequence of the crRNA is partially complementary to the short tandem repeat sequence, and the length of the crRNA complementary to the short tandem repeat sequence is preferably 20 to 22 nt.

[0013] In some embodiments of the present invention, the anchoring sequence of the crRNA specifically recognizes the Cas protein.

[0014] In some embodiments of the present invention

[0015] The sequence of the DNA probe is shown below: 5'-CAGTAGCTCATCTTTTTTTTTACGCAGTGTTCCTATAGTTCGATCCAG-3';

[0016] The sequence of the short tandem repeat is as follows: 5'-CTGGATCGAACTATAGGAACACTGCGTATTCAACTTAACACAACTTAACACAACTTAAC(ACAACTTAAC). n -3'; n = 200 to 500.

[0017] The crRNA sequence is as follows: 5'-GGGUAAUUUCUACUAAGUGUAGAUUGUUAAGUUGUGUUAAGUUG-3'.

[0018] In some embodiments of the present invention, the 5' end of the DNA probe is modified with biotin, and the 3' end is modified with C6-SH or C6-HS-SH.

[0019] In some embodiments of the present invention, the kit further includes a capture antibody, a detection antibody, streptavidin, gold nanoparticles, dithiothreitol, streptavidin magnetic beads, FnCas12a, and a fluorescent reporter probe.

[0020] The sequence of the fluorescent reporter probe is shown below: 5'-TTATT-3'.

[0021] In some embodiments of the present invention, the 5' end of the fluorescent reporter probe is modified with a fluorescent group, wherein the fluorescent group is HEX, FAM, TEX or Cy5, and the 3' end is modified with a quenching group, wherein the quenching group is BHQ1 or BHQ2.

[0022] In some embodiments of the present invention, the detection antibody is a biotinylated detection antibody.

[0023] In some embodiments of the present invention, the kit further comprises a buffer solution, the buffer solution comprising: an enzyme digestion buffer and a washing buffer; preferably, the enzyme digestion buffer is NEB 2.1; the washing buffer is an 8-12 mM PBS solution (pH 7-8) containing 0.03-0.07% Tween-20.

[0024] In some embodiments of the present invention, the diameter of the gold nanoparticles is 10-50 nm.

[0025] In some embodiments of the present invention, the preparation method of the short tandem repeat sequence (ssDNA conjoint) is as follows: Bst DNA polymerase, Hairpin, dATP / dTTP / dCTP solution mix, dGTP Cleaner, MgSO4, and PBS are thoroughly mixed and placed in a water bath at 35-39°C for 10-20 min. Then, Primer a is added and mixed well, and the mixture is incubated at 35-39°C for 2-4 h. The reaction is terminated by incubating in a metal bath at 80-95°C, and the mixture is stored at 4-6°C for later use.

[0026] In some embodiments of the present invention, the Hairpin sequence is 5'-ACAACTTAACGGGCCTTTTGGCCCGTTAAGTTGTGTTAAGTTGTTTTTTTTTTTTTTT-3'.

[0027] In some embodiments of the present invention, the dGTP Cleaner sequence is 5'-CCCCGAAAGTGGCCTCGGGCCTTTTGGCCCGAGGCCACTTTCG-3'.

[0028] In some embodiments of the present invention, the Primer a sequence is 5'-CTGGATCGAACTATAGGAACACTGCGTATTCAACTTAACACAACTTAACACAACTTAAC-3'.

[0029] In some embodiments of the present invention, the ssDNA tandem sequence is 5'-CTGGATCGAACTATAGGAACACTGCGTATTCAACTTAACACAACTTAACACAACTTAAC(ACAACTTAAC). n -3', where the ACAACTTAAC sequence (10 nt) is a tandem repeat sequence, and n is 200-500. The 5' end of the ssDNA tandem sequence (CTGGATCGAACTATAGGAACACTGCGTA) is the reverse complementary sequence to the 3' end of the Probe DNA (TACGCAGTGTTCCTATAGTTCGATCCAG).

[0030] In some embodiments of the present invention, the concentration of the Bst DNA polymerase (large fragment) is 500–1000 U / mL, the concentration of Hairpin is 100–1000 nM, the concentration of the dATP / dTTP / dCTP solution mix is ​​400–800 μM, the concentration of the dGTP Cleaner is 50–200 nM, the concentration of MgSO4 is 8–12 mM, the concentration of the PBS solution (pH 7–8) is 8–12 mM, and the concentration of Primer a is 0.8–1.2 μM.

[0031] In some embodiments of the present invention, the types and concentrations of the capture antibody and the detection antibody are adaptively adjusted according to the types of trace proteins detected.

[0032] When detecting MMP13 protein, the working concentration of the capture antibody is 2–6 μg / mL, and the working concentration of the detection antibody is 80–120 ng / mL.

[0033] When detecting SCC protein, the working concentration of the capture antibody is 0.5–2.5 μg / mL, and the working concentration of the detection antibody is 400–600 ng / mL.

[0034] In some embodiments of the present invention, the source of FnCas12a is not specifically limited; it can be purchased or prepared. In the present invention, the preparation process of FnCas12a is as follows: the FnCas12 gene is synthesized using a chemical synthesis method and cloned into the PET-32a prokaryotic expression vector. After sequencing to confirm that the inserted sequence is correct, the recombinant plasmid is transformed into Rosseta (DE3) competent cells. The 6×His-MBP-FnCas12a fusion protein is induced to be expressed using IPTG. The fusion protein is purified by nickel column affinity chromatography. The 6×His and MBP tags of the fusion protein are removed by TEV protease digestion and purified. The FnCas12 protein is identified.

[0035] The preparation process of the crRNA is as follows: synthesize the corresponding sense and antisense strand sequences of crRNA; anneal the two sequences to form double-stranded DNA; transcribe the DNA in vitro using T7 polymerase to form RNA, and purify the crRNA by phenol-chloroform extraction and washing with ethanol solution.

[0036] In some embodiments of the present invention, the justice chain sequence is: 5'-TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATTGTTAAGTTGTGTTAAGTTG-3'.

[0037] In some embodiments of the present invention, the antisense chain sequence is: 5'-CAACTTAACACAACTTAACAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA-3'.

[0038] In some embodiments of the present invention, the crRNA sequence is: 5'-GGGUAAUUUCUACUAAGUGUAGAUUGUUAAGUUGUGUUAAGUUG-3'.

[0039] In some embodiments of the present invention, the crRNA recognition sequence is UGUUAAGUUGUGUUAAGUUG, and the target sequence that binds to the ssDNA conjoint is CAACTTAACACAACTTAACA.

[0040] In some embodiments of the present invention, the trace protein is a trace protein such as MMP13 or SCC.

[0041] In some embodiments of the present invention, appropriate capture antibodies and detection antibodies may be selected according to the type of trace protein.

[0042] A second aspect of the present invention provides the application of the kit described in the first aspect of the present invention in the detection of trace proteins.

[0043] In some embodiments of the present invention, the concentration of streptavidin is 0.63–10 nM, the concentration of gold nanoparticles is 1–4 pM, the concentration of DNA probe is 20–200 μM, the concentration of streptavidin magnetic beads is 0.5–1 mg / mL, the concentration of dithiothreitol is 20–200 mM, the concentration of tandem linker is 6–100 nM, the concentration of FnCas12a is 200–600 nM, the concentration of crRNA is 250–1000 nM, and the concentration of fluorescent reporter probe is 50–150 nM.

[0044] A third aspect of the present invention provides the application of the kit described in the first aspect of the present invention in the preparation and detection of trace amounts of protein.

[0045] A fourth aspect of the present invention provides a method for detecting trace proteins using the kit described in the first aspect of the present invention.

[0046] In some embodiments of the present invention, the method for obtaining trace proteins includes the following steps:

[0047] 1) Prepare a gold nanoparticle-DNA probe by thoroughly mixing the gold nanoparticle solution with the DNA probe. Prepare an FnCas12a / crRNA complex by thoroughly mixing FnCas12a, crRNA, fluorescent reporter probe, and NEBuffer 2.1 for later use.

[0048] 2) The capture antibody is coated, and then the target protein, detection antibody, streptavidin, and gold nanoparticle-DNA probe are added in sequence to form a capture antibody-target protein-detection antibody-streptavidin-gold nanoparticle probe complex.

[0049] 3) Add DTT solution for incubation to release the DNA probe from the surface of the gold nanoparticle-DNA probe. Add streptavidin magnetic beads and short tandem repeat sequences to trap the DNA probe-short tandem repeat sequence complex on the surface of the streptavidin magnetic beads.

[0050] 4) Add FnCas12a / crRNA complex solution; detect the fluorescence intensity after the reaction and analyze the target protein.

[0051] In some embodiments of the present invention, the concentration of streptavidin is 0.63–10 nM, the concentration of gold nanoparticles is 1–4 pM, the concentration of DNA probe is 20–200 μM, the concentration of streptavidin magnetic beads is 0.5–1 mg / mL, the concentration of dithiothreitol is 20–200 mM, the concentration of tandem linker is 6–100 nM, the concentration of FnCas12a is 200–600 nM, the concentration of crRNA is 250–1000 nM, and the concentration of fluorescent reporter probe is 50–150 nM.

[0052] In some embodiments of the present invention, the preparation method of the gold nanoparticle-DNA probe (AuNP probe) is as follows: the gold nanoparticle solution is mixed with the DNA probe and then frozen, then slowly thawed at room temperature, washed and resuspended to prepare the gold nanoparticle probe.

[0053] In some embodiments of the present invention, the FnCas12a / crRNA complex solution is prepared by thoroughly mixing FnCas12a, crRNA, ssDNA fluorescent reporter probe, and NEBuffer 2.1, and incubating at 35-42°C in the dark to obtain the FnCas12a / crRNA complex solution.

[0054] In some embodiments of the present invention, the incubation temperature in step 2) is 30-40°C and the incubation time is 20-40 min.

[0055] The beneficial effects of this invention are:

[0056] This invention provides a highly sensitive protein detection kit based on DNA tandem synthesis technology and CRISPR-Cas12a. Utilizing a novel DNA tandem signal amplification technology, the CRISPR / Cas12a system is activated through multiple tandem modes via DNA tandem synthesis for signal amplification. This kit can detect MMP13 and SCC proteins at levels as low as fg / mL, exhibiting high sensitivity. It has significant clinical value for detecting trace serum tumor markers and assisting in the early diagnosis of cancer patients. Furthermore, while improving the sensitivity of the CRISPR-Cas12a system, it eliminates the dependence on real-time amplification reactions, exhibiting good stability and effectively preventing cross-contamination between samples. The detection process also eliminates the need for real-time amplification; the ssDNA tandems used can be pre-prepared, avoiding the real-time cyclic amplification reactions relied upon by current detection technologies. This results in low background signal, high stability, and effective prevention of cross-contamination between samples. Moreover, this invention is low-cost, requiring no complex and sophisticated equipment (such as PCR instruments) or special functional catalytic enzymes (such as RPA recombinase), and is highly versatile; simply replacing the capture antibody and detection antibody allows for the quantitative detection of any protein. Attached Figure Description

[0057] Figure 1 This is a schematic diagram illustrating the principle of preparing ssDNA tandem strands provided by the present invention.

[0058] Figure 2 The image shows the urea-polyacrylamide gel electrophoresis results of the optimized ssDNA tandem sequence provided by this invention.

[0059] Figure 3 The image provided by this invention is a urea-polyacrylamide gel electrophoresis pattern used to verify the specificity of the DNA tandem synthesis reaction.

[0060] Figure 4 The image shows the SDS-polyacrylamide gel electrophoresis identification of the purified FnCas12a expressed in this invention.

[0061] Figure 5 This is a schematic diagram illustrating the principle of the activated FnCas12a side-cutting fluorescent reporter probe described in this invention.

[0062] Figure 6 This is a schematic diagram illustrating the principle of the combined detection technology of ssDNA conjoints and CRISPR-Cas12a provided by the present invention.

[0063] Figure 7 This is a schematic diagram illustrating the principle of the ssDNA conjoint and CRISPR-Cas12a combined detection technology provided by the present invention for detecting single-stranded target DNA via hybridization capture.

[0064] Figure 8The diagram shows the optimized conditions for detecting single-stranded target DNA using the combined ssDNA conjoint and CRISPR-Cas12a detection technology provided by this invention.

[0065] Figure 9 The image shows the fluorescence results of single-stranded target DNA detected by the combined detection technology of ssDNA conjoint and CRISPR-Cas12a provided by this invention.

[0066] Figure 10 This is a schematic diagram illustrating the principle of the combined detection technology based on ssDNA conjoints and CRISPR-Cas12a for detecting trace target proteins provided by the present invention.

[0067] Figure 11 The diagram shows the optimized conditions for detecting trace target proteins using the combined detection technology based on ssDNA conjoints and CRISPR-Cas12a provided by this invention.

[0068] Figure 12 Fluorescence bar graph for detecting trace amounts of target protein MMP13 provided by the present invention.

[0069] Figure 13 The fluorescent bar graph provided by this invention is for detecting trace amounts of the target protein SCC.

[0070] Figure 14 The image shows the fluorescence results of detecting serum SCC protein in 10 patients with esophageal squamous cell carcinoma and 10 healthy controls, as provided by this invention. Detailed Implementation

[0071] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0072] AuNPs particles were purchased from Xi'an Ruixi Biotechnology Co., Ltd.; Bst DNA polymerase (large fragment) and MgSO4 were purchased from NEB; dATP, dTTP, and dCTP were purchased from G-CLONE; NEBuffer 2.1 was purchased from NEB; MMP13 protein standards, capture antibodies, and detection antibodies were purchased from R&D; SA was purchased from SolarBio; DTT was purchased from Thermo Fisher; SA@MBs solution was purchased from Roche; and SCC capture antibodies, detection antibodies, and protein standards were purchased from Cloud-Clone.

[0073] Example 1

[0074] In this embodiment, the MMP13 protein standard was used as the analyte to evaluate the detection sensitivity of the method.

[0075] 1. Preparation of AuNP probe solution

[0076] 1.1 Add 3 μL of 100 μM probe DNA to 100 μL of a solution of gold nanoparticles (AuNPs) with a diameter of 30 nm.

[0077] 1.2 After mixing, place directly in a -80℃ freezer for 5 minutes or in a -20℃ freezer for 2 hours. Remove the solution after it has frozen.

[0078] 1.3. Melt slowly at room temperature, centrifuge at 13000 rpm at 4℃ for 13 min, discard the supernatant, and wash twice with 1 mL of washing buffer.

[0079] 1.4. Resuspend in 100 μL of resuspension solution and store at 4°C for later use.

[0080] The probe DNA sequence is 5'-CAGTAGCTCATCTTTTTTTTTACGCAGTGTTCCTATAGTTCGATCCAG-3' (SEQ ID NO.1), with the 5' end modified by Biotin and the 3' end modified by C6-SH.

[0081] The washing buffer and resuspension were 10 mM PBS solutions (pH 7.4) containing 0.05% Tween-20.

[0082] 2. Preparation of ssDNA tandem strands

[0083] 2.1. Thoroughly mix 2 μL 8000 U / mL Bst DNA polymerase (large fragment), 2 μL 5 μM Hairpin, 3.6 μL 10 mM dATP / dTTP / dCTP solution mix, 2 μL 1 μM dGTP Cleaner, 2 μL 100 mM PBS (pH 7.4), and 2 μL 100 mM MgSO4, and add enzyme-free water to a volume of 18 μL.

[0084] 2.2 Incubate at 37℃ for 15 minutes.

[0085] 2.3 Add 2 μL of 10 μM Primer a, mix well, and incubate at 37°C for 3 hours.

[0086] 2.4. Prepare ssDNA tansions and store at 4°C for later use.

[0087] Figure 1 The diagram illustrates the principle of preparing ssDNA tandems. With the assistance of hairpin DNA, BstDNA polymerase performs tandem cyclic extension of a short oligonucleotide primer from the 5' end to the 3' end, ultimately producing ssDNA tandem products with short tandem repeat sequences, ranging in length from 2000 to 5000 nt.

[0088] The dGTP Cleaner sequence is CCCCGAAAGTGGCCTCGGGCCTTTGGCCCGAGGCCACTTTCG (SEQ ID NO. 2).

[0089] The working concentrations of Bst DNA polymerase (large fragment) are 800 U / mL, Hairpin is 500 nM, dATP / dTTP / dCTP solution mix is ​​600 μM, dGTP Cleaner is 100 nM, MgSO4 is 10 mM, PBS solution (pH 7.4) is 10 mM, and Primer a is 1 μM.

[0090] Further optimization of the Primer and Hairpin sequences was performed. The following are the primer sequences P1, P2, P3, P4, P5, P6 and their corresponding Hairpin sequences.

[0091] Among them, the P1 sequence is TTAATACTCTC (SEQ ID NO.3), and the corresponding Hairpin sequence is AAATACTCTCGGGCCTTTTGGCCCGAGAGTATTTGAGAGTATTTTTTTTTTTT (SEQ ID NO.4).

[0092] The P2 sequence is TTTTATTCACT (SEQ ID NO.5), and the corresponding Hairpin sequence is ATTATTCACTGGGCCTTTTGGCCCAGTGAATAATAGTGAATAATTTTTTTTTT (SEQ ID NO.6).

[0093] The P3 sequence is TTCAACTTAAC (SEQ ID NO.7), and the corresponding Hairpin sequence is ACAACTTAACGGGCCTTTTGGCCCGTTAAGTTGTGTTAAGTTGTTTTTTTTTTTTTTTTT (SEQ ID NO.8).

[0094] Among them, the P4 sequence is TTTTCTTACTC (SEQ ID NO.9), and the corresponding Hairpin sequence is ATTCTTACTCGGGCCTTTTGGCCCGAGTAAGAATGAGTAAGAATTTTTTTTTT (SEQ ID NO.10).

[0095] The P5 sequence is TTATACTTCAC (SEQ ID NO.11), and the corresponding Hairpin sequence is AATACTTCACGGGCCTTTTGGCCCGTGAAGTATTGTGAAGTATTTTTTTTTTT (SEQ ID NO.12).

[0096] The P6 sequence is TTATCCCTATC (SEQ ID NO.13), and the corresponding Hairpin sequence is AATCCCTATCGGGCCTTTTGGCCCGATAGGGATTGATAGGGATTTTTTTTTTT (SEQ ID NO.14).

[0097] Figure 2 The urea-polyacrylamide gel electrophoresis results of the optimized ssDNA tandem sequence are shown in the figure. In lane 3, a uniform nucleic acid product band with the darkest color is visible at the 3000-5000 bp position indicated by the DNA marker. The bands in the other 5 lanes are lighter and the products are heterogeneous with dragging. This indicates that the ssDNA tandem sequence prepared by the combination of P3 sequence and corresponding Hairpin has high yield and purity.

[0098] Furthermore, the preferred sequence P3 was further designed by adding two tandem repeat units (ACAACTTAAC (SEQ ID NO. 15)) to the 3' end of P3 to provide at least one recognition site for the CRISPR / Cas12a-crRNA complex, and adding a bridge sequence to the 5' end of P3. CTGGATCGAACTATAGGAACACTGCGTA (SEQ ID NO. 16) This provides a hybridization site with the Probe DNA. The final result is Primer a, with the following sequence: CTGGATCGAACTATAGGAACACTGCGTA TTCAACTTAACACAACTTAACACAACTTAAC (SEQ ID NO.17), where the underlined part indicates the Bridge sequence added at the 5' end, the italic part is the original P3 sequence, and the bold part is the sequence of two tandem repeat units added at the 3' end.

[0099] The Hairpin sequence is ACAACTTAACGGGGCCTTTTGGCCCGTTAAGTTGTGTTAAGTTGTTTTTTTTTTTTTTT (SEQ ID NO. 8).

[0100] The ssDNA tandem sequence is (CTGGATCGAACTATAGGAACACTGCGTATTCAACTTAACACAACTTAACACAACTTAAC (SEQ ID NO.17))(ACAACTTAAC (SEQ ID NO.15)) n The ACAACTTAAC sequence (10nt) is a tandem repeat unit, and n is 200 to 500.

[0101] The 28 bases at the 5' end of the ssDNA tandem sequence (CTGGATCGAACTATAGGAACACTGCGTA) are the reverse complementary sequence of the 28 bases at the 3' end of the Probe DNA (TACGCAGTGTTCCTATAGTTCGATCCAG).

[0102] Figure 3 The figure shows the specificity verification results of DNA tandem synthesis technology. As shown in the figure, when Bst DNA polymerase, Hairpin and Primer a are all present, a uniform nucleic acid product band with a length of 2000-3000 bp can be seen in lane 1, while no obvious bands were observed in other lanes, which shows the specificity of DNA tandem synthesis technology.

[0103] 3. Preparation of FnCas12a / crRNA complex solution

[0104] 3.1 Mix 2.5 μL of 5 μM FnCas12a, 5 μL of 5 μM crRNA, 5 μL of 10×NEB 2.1 buffer, 5 μL of 1 μM ssDNA Reporter, and 32.5 μL of enzyme-free water.

[0105] 3.2. The FnCas12a / crRNA complex solution was prepared by incubation at 37°C in the dark.

[0106] The preparation process of FnCas12a is as follows: The FnCas12 gene (accession number: A0Q7Q2) was synthesized using chemical synthesis and cloned into the PET-32a prokaryotic expression vector. After sequencing confirmed that the inserted sequence was correct, the recombinant plasmid was transformed into Rosseta (DE3) competent cells. The expression of 6×His-MBP-FnCas12a fusion protein was induced by IPTG. The fusion protein was purified by nickel column affinity chromatography. The 6×His and MBP tags of the fusion protein were removed by TEV protease digestion and purified. The FnCas12 protein was identified. Figure 4 The SDS-polyacrylamide gel electrophoresis image of FnCas12a protein is shown. A clear protein band with a length of 130 kDa is visible at the protein marker, and the purity is high, indicating the successful expression and purification of FnCas12a.

[0107] The preparation process of crRNA is as follows: synthesize the corresponding sense and antisense strand sequences of crRNA; anneal the two sequences to form double-stranded DNA; transcribe the DNA in vitro using T7 polymerase to form RNA, and purify the RNA by phenol-chloroform extraction and washing with ethanol solution.

[0108] The justice chain sequence is: TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATTGTTAAGTTGTGTTAAGTTG (SEQ ID NO.18).

[0109] The antisense chain sequence is: CAACTTAACACAACTTAACAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA (SEQ ID NO.19).

[0110] The crRNA sequence is: GGGUAAUUUCUACUAAGUGUAGAUUGUUAAGUUGUGUUAAGUUG (SEQ ID NO. 20). GGGUAAUUUCUACUAAGUGUAGAU is the anchoring sequence, which specifically recognizes the Cas protein.

[0111] The crRNA recognition sequence is UGUUAAGUUGUGUUAAGUUG, and the target sequence that binds to the ssDNA conjoint is CAACTTAACACAACTTAACA.

[0112] The ssDNA fluorescent reporter probe sequence is TTATT, with the 5' end modified by the HEX group and the 3' end modified by the BHQ1 group.

[0113] The working concentrations of FnCas12a are 250 nM, crRNA is 500 nM, ssDNA fluorescent reporter probe is 100 nM, and NEBuffer 2.1 is 1×.

[0114] Figure 5 This diagram illustrates the principle of Cas12a protein paracleavage of fluorescent reporter probes after the target DNA activates the CRISPR / Cas12a system. Guided by crRNA, the Cas12a protein specifically recognizes and binds to the target ssDNA to form a ternary complex, simultaneously activating the paracleavage activity of the Cas12a protein. When a reporter probe with both fluorescent and quenching groups is present in the system, the activated Cas12a will cleave the reporter probe, releasing a fluorescent signal.

[0115] 4. MMP13 protein detection

[0116] 4.1 Resuspend the MMP13 capture antibody in PBS and dilute to 4 μg / mL. Transfer 100 μL / well to a 96-well microplate and incubate overnight at 4°C. Wash the 96-well microplate with washing buffer. Add 350 μL of blocking buffer and block at 37°C for 1 h, then wash again. Add 100 μL of different concentrations of MMP13 protein (4, 40, 400, 4000, 40000, 400000 fg / mL) or blank control (NC), and incubate at 37°C for 1 h, then wash. Add 100 μL of 100 ng / mL MMP13 detection antibody and incubate at 37°C for 1 h, then wash. Add 100 μL of 10 nM SA and incubate at 37°C for 20 min, then wash. Add 100 μL of 4 pM AuNP from step 1. The probe was incubated at 37°C for 20 minutes to form a capture antibody-MMP13-detection antibody-SA-AuNP probe complex, followed by plate washing.

[0117] 4.2 Add 50 μL of 100 mM DTT solution and incubate at 37 °C for 30 min to release the Probe DNA from the surface of the AuNP probe and allow it to circulate freely in the solution. Transfer the solution to an Eppendorf tube and add 1.25 μL of 1 μM ssDNA tandem from step 2. Place the tube in a metal bath at 95 °C for 5 min and then slowly cool it to room temperature to form the Probe DNA-ssDNA tandem complex.

[0118] 4.3 Add 50 μL of 0.72 mg / mL SA@MBs and incubate at 37 °C for 20 min to capture the Probe DNA-ssDNA tandem complex onto the SA@MBs. After magnetic adsorption for 1 min, wash the magnetic beads with 1 mL of washing buffer.

[0119] 4.4 Add 50 μL of the FnCas12a / crRNA complex solution from step 3 and incubate at 37°C.

[0120] 4.5. On-machine testing. Instrument name: Tecan SPARK, temperature parameter setting: 37℃, kinetic parameter setting: detection duration 2h, detection time interval 5min, excitation wavelength: 535nm, emission wavelength: 580nm, gain value: 125.

[0121] The working concentrations of the capture antibody and the detection antibody were 4 μg / mL and 100 ng / mL, respectively. In step 4.1, the NC group consisted of 100 μL PBS solution with a concentration of 10 mM and a pH of 7.4. The working concentration of the SA was 10 nM. In step 4.1, the AuNP probe was prepared in step 1 with a working concentration of 4 pM. The working concentration of the DTT was 100 mM. In step 4.2, the ssDNA tandem strand was prepared in step 2 with a working concentration of 25 nM. In step 4.3, the working concentration of the SA@MBs solution was 0.72 mg / mL. The washing buffer in step 4.3 was a 10 mM PBS solution (pH 7.4) containing 0.05% Tween-20.

[0122] Figure 6 This diagram illustrates the principle of the combined detection technology of ssDNA conjoints and CRISPR-Cas12a. Guided by crRNA, the Cas12a protein targets and recognizes two tandem repeat units on a long ssDNA conjoint (2000 nt to 5000 nt), resulting in the tandem activation of a large amount of Cas12a protein, which exhibits strong lateral cleavage activity, cleaving the fluorescent probe substrate and releasing a strong fluorescent signal.

[0123] Figure 7 This diagram illustrates the principle of single-stranded probe DNA detection via hybridization capture using a combined ssDNA conjoint and CRISPR-Cas12a detection technique. The 5' end sequence of the ssDNA conjoint hybridizes with the probe DNA through base complementarity to form a dimer. Then, leveraging the interaction between the biotinylate group at the 5' end of the probe DNA and streptavidin, the dimer is captured onto streptavidin-coated magnetic beads. The addition of a Cas12a / crRNA complex solution activates the paracleavage activity of the Cas12a protein through the tandem repeat sequence of the ssDNA conjoint, releasing a fluorescent signal.

[0124] Figure 8The figure shows the optimized experimental conditions for detecting single-stranded probe DNA using the combined ssDNA conjoint and CRISPR-Cas12a detection technology. As shown in the figure, the optimal signal-to-noise ratio was obtained under the conditions of 250 nM Cas12a, 500 nM crRNA, 100 nM Reporter, NEB 2.1 as the enzyme digestion buffer, and a crRNA recognition sequence length of 20 nt. Therefore, the above experimental parameters are used as the preferred reaction conditions for subsequent detection.

[0125] Figure 9 The image shows a bar graph of fluorescence results for detecting single-stranded probe DNA using the combined detection technology of ssDNA consortium and CRISPR-Cas12a. As can be seen from the graph, the fluorescence intensity signal of the system increases with the increase of probe DNA (target DNA) concentration, and the lowest detectable probe DNA is 100 fM.

[0126] 5. Results:

[0127] Figure 10 A schematic diagram of the detection mode of trace target proteins based on the combined detection technology of ssDNA tandem and CRISPR-Cas12a is shown. (1) Acquisition module: peripheral blood samples are collected and centrifuged to obtain serum; (2) Conversion module: the target protein is captured by the double antibody sandwich method, and the biotinylated DNA-labeled gold nanoprobe is specifically bound to the antigen-antibody complex by the streptavidin-biotin system. Then DTT is added, and the biotinylated probe DNA is released from the surface of the gold nanoparticles into the solution by the ligand displacement reaction, thus completing the conversion from protein signal to nucleic acid signal; (3) Signal amplification module: the Primer with Bridge sequence is amplified by the DNA tandem synthesis reaction. a extends cyclically from 5' to 3' to form a short tandem repeat ssDNA tandem unit (2000-5000nt in length) with sequence a as the unit. It is captured on streptavidin magnetic beads by hybridization of its bridge sequence with the reverse complementary sequence of the probe DNA; (4) Reporter module: The CRISPR / Cas12a reporter system is added. The crRNA guides the Cas12a protein to target two tandem repeat units (20nt) on the ssDNA tandem unit, tandemly activating a large number of Cas12a proteins, efficiently cutting the fluorescent reporter probe, and the fluorescence signal is recorded by the microplate reader; (5) Analysis module: The concentration of the target protein is calculated by analyzing the fluorescence intensity signal.

[0128] Figure 11The figure shows the optimized experimental conditions for detecting trace target proteins using a combined detection technique based on ssDNA conjoints and CRISPR-Cas12a. As shown in the figure, the optimal signal-to-noise ratio was obtained when the SA concentration was 2.5 nM, the AuNP concentration was 4 pM, the SA@MB incubation time was 20 min, the ssDNA conjoint concentration was 25 nM, the incubation time for synthesizing the ssDNA conjoints was 3 h, and the DTT incubation temperature was 37 °C. Therefore, the above experimental parameters were used as the preferred reaction conditions for subsequent detection.

[0129] Figure 12 The fluorescence results of MMP13 protein detection using the combined detection technology based on ssDNA conjoints and CRISPR-Cas12a are shown in the bar graph. As can be seen from the figure, the fluorescence intensity signal of the system increases with the increase of target protein concentration, and there is a good linear relationship in the range of 40 fg / mL to 400 pg / mL. The lowest detectable concentration of MMP13 protein is 40 fg / mL, indicating that the method has high sensitivity.

[0130] Example 2

[0131] In this embodiment, SCC protein standards were used as analytes to evaluate the detection sensitivity of this method.

[0132] The difference from Example 1 is that the MMP13 capture antibody, detection antibody, and protein standard are replaced with SCC capture antibody, detection antibody, and protein standard.

[0133] The working concentration of the SCC capture antibody is 1.67 μg / mL, the working concentration of the SCC detection antibody is 500 ng / mL, and the concentration gradient of the SCC standard is 0, 500 fg / mL, 5 pg / mL, 50 pg / mL, 500 pg / mL, and 5 ng / mL.

[0134] Figure 13 The results of fluorescence detection of SCC protein using the combined detection technology based on ssDNA conjoints and CRISPR-Cas12a are shown in the bar graph. As can be seen from the figure, the fluorescence intensity signal of the system increases with the increase of target protein concentration, and there is a good linear relationship in the range of 500 fg / mL to 5 ng / mL, indicating that this method also has high sensitivity and a wide linear range in the detection of SCC protein.

[0135] Example 3

[0136] In this embodiment, patient serum was used as the analyte to evaluate the application performance of this method in detecting the tumor marker SCC protein in clinical patient serum samples.

[0137] Serum samples were collected from 10 patients with esophageal squamous cell carcinoma (ESCC) and 10 healthy individuals.

[0138] The difference from Example 2 is that the SCC protein standard is replaced with a serum sample.

[0139] The volume of the serum sample was 100 μL.

[0140] Figure 14 The image shows a bar graph illustrating the fluorescence results of serum SCC protein detection in 10 ESCC patients and 10 healthy controls according to the present invention. As can be seen from the graph, the average level of serum SCC protein detected by this method in ESCC patients was higher than that in healthy controls.

[0141] The above detailed embodiments have provided a comprehensive description of the present invention. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.

Claims

1. A kit for detecting trace proteins, comprising: DNA probes, short tandem repeats, crRNA, capture antibodies, detection antibodies, streptavidin, gold nanoparticles, dithiothreitol, streptavidin magnetic beads, FnCas12a, fluorescent reporter probes; The 5' end sequence of the short tandem repeat sequence is complementary to the reverse sequence of the DNA probe, and the 3' end uses the ACAACTTAAC sequence as a tandem repeat unit. The recognition sequence of the crRNA is partially complementary to the short tandem repeat sequence; the sequence of the DNA probe is shown below: 5' CAGTAGCTCATCTTTTTTTTTACCGCAGTGTTCCTATAGTTCGATCCAG 3'; The sequence of the short tandem repeat sequence is shown below: 5' CTGGATCGAACTATAGGAACACTGCGTATTCAACTTAACACAACTTAACACAACTTAAC(ACAACTTAAC) n 3'; n = 200~500; The crRNA sequence is as follows: 5' GGGUAAUUUCUACUAAGUGUAGAUUGUUAAGUUGUGUUAAGUUG 3'.

2. The reagent kit according to claim 1, characterized in that, The sequence of the fluorescent reporter probe is shown below: 5' TTATT 3'.

3. The reagent kit according to claim 1, characterized in that, The kit also contains buffer solutions, which include: enzyme digestion buffer and washing buffer.

4. The reagent kit according to claim 3, characterized in that, The enzyme digestion buffer is NEB 2.

1.

5. The use of the kit according to any one of claims 1 to 4 in the detection of trace proteins or in the preparation of products for detecting trace proteins.

6. The application according to claim 5, characterized in that, The concentration of the streptavidin is 0.63–10 nM, the concentration of the gold nanoparticles is 1–4 pM, the concentration of the DNA probe is 20–200 μM, the concentration of the streptavidin magnetic beads is 0.5–1 mg / mL, the concentration of the dithiothreitol is 20–200 mM, the concentration of the short tandem repeat sequence is 6–100 nM, the concentration of FnCas12a is 200–600 nM, the concentration of the crRNA is 250–1000 nM, and the concentration of the fluorescent reporter probe is 50–150 nM.

7. A method for detecting trace proteins for non-diagnostic purposes, using the kit described in any one of claims 1 to 4, characterized in that, The method for detecting trace proteins includes the following steps: 1) Prepare gold nanoparticles by thoroughly mixing the gold nanoparticle solution with the DNA probe. DNA probes, containing FnCas12a, crRNA, The fluorescent reporter probe and enzyme digestion buffer were thoroughly mixed to prepare the FnCas12a / crRNA complex for later use. 2) Coat the capture antibody, then add the target protein, biotinylated detection antibody, streptavidin, and nanoparticles in sequence. gold DNA probes form capture antibodies Protein to be tested Antibody detection Streptavidin Nano-gold probe complex; 3) Incubate with DTT solution to allow the DNA probe to detach from the gold nanoparticles. DNA probe surface release, streptavidin magnetic beads and short tandem repeat sequences are added, making the DNA probe... Short tandem repeat sequence complexes were captured on the surface of streptavidin magnetic beads; 4) Add FnCas12a / crRNA complex solution; detect the fluorescence intensity after the reaction and analyze the target protein.

8. The method according to claim 7, characterized in that, The incubation temperature in step 2) is 30–40°C.

Images